Association Between the SLC2A2 Gene rs1499821 Polymorphism and Caries Susceptibility

Abstract

Objectives:

This study was designed to analyze the association between the SLC2A2 rs1499821 polymorphism and caries susceptibility in the Chinese Han, Zhuang, and Baikuyao populations.

Materials and Methods:

The present case-control study included 1067 12-year-old children: 481 with caries (142 Han, 166 Zhuang and 173 Baikuyao) and 586 who were caries-free (135 Han, 178 Zhuang and 273 Baikuyao). Questionnaires about diet and oral habits were obtained from all subjects. All of the children received dental examinations and DNA collection. The SLC2A2 rs1499821 SNP was genotyped using the SNPscan technique.

Results:

The rs1499821 T polymorphism was significantly associated with caries susceptibility in both the Han population and the combined populations of the three ethnic subgroups. SLC2A2 rs1499821 was associated with caries susceptibility in the dominant model in the Han (p = 0.045) population and the combined (p = 0.038) group. The CT+TT genotypes at rs1499821 were associated with a higher risk of caries in the Han (OR = 1.69, adjusted 95% CI: 1.01-2.81) and combined (OR = 1.33, adjusted 95% CI: 1.02-1.74) populations. In both Han (p = 0.009) and the combined populations (p = 0.004), there were statistically significant associations between the frequency of sweet food intake and dental caries. However, the rs1499821 polymorphisms did not associate with the frequency of sweet food intake in these ethnic subgroups.

Conclusion:

In the Han population, the SLC2A2 rs1499821 T allele and the frequency of sweet food intake may be regarded as risk factors for caries susceptibility. The SLC2A2 rs1499821 T allele had no association with the frequency of sweet food intake in any of the three ethnic groups.

Introduction

With 3.55 billion affected, dental caries is one of the most common diseases in the world (Petersen et al., 2005; Vos et al., 2016). Dental caries is a biofilm-mediate, sugar-driven, multifactorial, dynamic disease. It begins with demineralization and organic degradation of dental hard tissues, and then develops to pulp and periapical inflammation, toothache, and premature tooth loss (Hunter, 1988). It involves multifactorial etiology; both environmental and genetic factors have been suggested to play important roles in dental caries' initiation and development. According to heritability studies, the effect of genetic factors can range from 50% to 70% for primary teeth and from 35% to 55% for permanent teeth (Bretz et al., 2005; Conry et al., 1993; Wang et al., 2012). Previous research reported that host gene polymorphisms associated with caries susceptibility can act as risk factors or confer protection (Kulkarni et al., 2013; Tannure et al., 2012; Wang et al., 2010). Research for candidate genes usually encompasses four main types of genes: genes involved in enamel development, saliva composition, the immune response, and taste perception. Among the four primary categories of genes related with caries susceptibility, genes involved in taste preference can influence sugar intake, which has been confirmed as the most important dietary etiological cause of dental caries by numerous research, including human, animal, and experimental studies (Moynihan, 2002; Sanders, 2004; Sayegh et al., 2002; Sheiham, 2001). The fermentation of sugar decreases the pH, causes disintegration of tooth crystals, and benefits pH-tolerant caries-causing bacteria (Chapple et al., 2017). Taste-influencing genes or pathways have a significant impact in the development of dental caries. Gene families TAS1R and TAS2R, which regulate sweet and bitter tastes, were the primary focus of previous research on taste preference-related genes. But in recent years, the Solute Carrier Family 2 Member gene family is gradually coming into view. Previous studies focused mostly on the Solute Carrier Family 2 Member 2 (SLC2A2) gene.

The SLC2A2 gene expresses in many tissues associated with sugar intake, such as organs that process sugar in food including the liver, pancreatic β cells, and the gut (Thorens et al., 1988), in taste cells on the tongue (Garcia-Bailo et al., 2009), in the central nervous system (Liu et al., 2009; Roncero et al., 2004), and in regions of the human hypothalamus involved in the regulation of energy balance, eating behavior, and glucose metabolism (Roncero et al., 2004). The SLC2A2 gene encodes a class I transporter protein (Joost and Thorens, 2001) called glucose transporter 2 (GLUT2), which moves glucose and other simple sugars in and out of cells, providing a unified message to the entire body by signaling the scarcity and abundance of sugar (Leturque et al., 2009). This glucose transporter, which affects glucose homeostasis, may also regulate eating behavior.

Studies have demonstrated that single nucleotide polymorphisms (SNPs) of the SLC2A2 gene are one of the reasons of individual differences in sweet taste perception and are related to greater sugar consumption. Given that dental caries is a disease driven by sugar, the SLC2A2 gene may relate to caries susceptibility. It is reported that SLC2A2 rs5400 was a risk factor for dental caries in a Canadian Caucasian adult population (Kulkarni et al., 2013). In a study of Czech children, carriers of the A allele at the rs5400 locus of the SLC2A2 gene had a significantly increased risk of dental caries (Holla et al., 2015). In young Swedish men and women, SLC2A2 rs1996220, rs5400, and rs11917504 were associated with the increase of caries score (Eriksson et al., 2019).

The association between SLC2A2 SNP and caries susceptibility in the Chinese population has not yet been reported. This study aims to investigate the relationship between SLC2A2 rs1499821 and caries susceptibility in Chinese population.

Materials and Methods

Subjects

A total of 1184, 12-year-old participants who were from Nandan County, Guangxi, China, were invited to participate in the study, and 1067 of them were enrolled, including 481 subjects with caries (142 Han, 166 Zhuang, and 173 Baikuyao) and 586 subjects without caries (135 Han, 178 Zhuang, and 273 Baikuyao). Those with cognitive or language impairment, systemic diseases, or who used orthodontic appliances were excluded. Before enrollment, the guardians of all participants signed informed consent forms. This study was approved by the Ethics Committee of Guangxi Medical University (code: 20160229-7).

Questionnaire

The questionnaire designed with reference to the Questionnaire of Fourth National Oral Health Epidemiology (Lu et al., 2018) was completed by the children themselves. The questionnaires included sociodemographic characteristics, oral health behaviors, and diet custom. Participants indicated their sweet food intake frequency of three categories of sweet foods and beverages (sweet desserts and candies, sweet drinks, and sweetened milk yogurt, milk powder, tea, soy milk, coffee) using the following frequencies: rarely/never, 1-3 times per month, once per week, 2-6 times per week, once a day, and twice or more a day.

Oral examination

Two trained dentists conducted an oral examination on the subjects, concerning the 5th edition of Oral Health Surveys: Basic Methods (World Health Organization, 2013). Caries examination was conducted using an artificial light, mouth mirror, and tip probe. Before the caries status was recorded, food debris was carefully removed. The DMFT index was used as a measurement of caries status in this study. The DMFT score was measured as the total number of teeth that were decayed (D), missing (M), and filled (F). Interobserver reliability was determined using a weighted kappa (κ). The agreement between the two was very good (κ = 0.80).

DNA sample collection

Before collecting exfoliated oral mucosa cells, individuals were requested to fast for 30 min and rinse their mouths with clean water. Four oral swabs in sterile packs were used on each subject to rub at least 20 times from each side of both cheeks inside the mouth, then put in the 5 mL Corning tube and kept at −20°C until analysis.

DNA extraction and SNP genotyping

DNA was extracted using the TIANamp Swab DNA Kit produced by the Tiangen Co. Using the SNPscan kit produced by Shanghai Tianhao Biotechnology Co., Ltd., three primer probes were designed, including two site allele-specific probes, GGAGGTGGTGTAGAGACATAGAGTTTTACG and GAGGTGGTGTAGAGACATAGAGTTTTGCA, and one site universal probe, TTCAAAGGTAAATTATTATCACTCCTCACTTTT. Genotyping was performed using the SNPscan technique.

Statistical analysis

Categorical data were compared by χ² test or the Fisher test analysis. Hardy-Weinberg equilibrium (HWE) was calculated for both the caries groups and the caries-free groups of the three ethnic groups using PLINK 1.07 software. The association between rs1499821 and the frequency of sweet food intake was assessed using the χ² test. We evaluated the relationship of SLC2A2 rs1499821 with caries risk based on the three different genetic models, respectively: dominant, recessive, and additive models. Logistic regression analysis was used to estimate odds ratios (ORs) and its corresponding 95% confidence intervals (CIs), adjusted for gender, eating at school, and teeth brushing frequency. A value of p < 0.05 was considered to indicate statistical significance. All the statistical analyses were performed using the software SPSS software package (ver. 25.0; SPSS, Inc., Chicago, IL, USA).

Results

Participant characteristics

The mean DMFT value and caries frequency of all subjects were 1.04 ± 1.59 and 45.1%, respectively. The mean DMFT values for the Han, Zhuang, and Baikuyao populations were 1.26 ± 1.77, 1.19 ± 1.74, and 0.79 ± 1.29, respectively. The caries frequencies for the Han, Zhuang, and Baikuyao populations were 51.26%, 48.3%, and 38.8%, respectively. The main features of the participants in terms of sociodemographic factors, oral health behavior status, and diet custom are given in Table 1. The results showed that gender, eating at school, the frequency of teeth brushing, and the frequency of sweet food intake were significantly associated with caries susceptibility in the combined population (p < 0.05). For ethnic subgroups, gender and the frequency of sweet food intake were associated with dental caries in the Han population (p < 0.05), whereas only gender was associated with dental caries in the Zhuang population (p < 0.05), and none of these variables was associated with dental caries in Baikuyao population (p > 0.05).

Table 1.

Frequency Distribution of Characteristics in Caries Group and Caries-Free Group [n (%)]

Variable	Han				Zhuang				Baikuyao				Combined population
Variable	Caries group (N = 142)	Caries-free group (N = 135)	χ²	p	Caries group (N = 166)	Caries-free group (N = 178)	χ ²	p	Caries group (N = 173)	Caries-free group (N = 273)	χ ²	p	Caries group (N = 481)	Caries-free group (N = 586)	χ ²	p
Gender			8.72	0.003^*			4.86	0.028^*			3.06	0.080			14.75	<0.001^*
Male	60 (42.3)	81 (60.0)			83 (50.0)	110 (61.8)			81 (46.8)	151 (55.3)			224 (46.6)	342 (58.4)
Female	82 (57.7)	54 (40.0)			83 (50.0)	68 (38.2)			92 (53.2)	122 (44.7)			257 (53.4)	244 (41.6)
The frequency of sweet food intake			6.88	0.009^*			0.05	0.822			1.90	0.169			8.28	0.004^*
≤1/week	25 (17.6)	42 (31.1)			39 (23.5)	40 (22.5)			74 (42.8)	135 (49.5)			138 (28.7)	217 (37.0)
≥2/week	117 (82.4)	93 (68.9)			127 (76.5)	138 (77.5)			99 (57.2)	138 (50.5)			343 (71.3)	369 (63.0)
Eating at school			0.68	0.411			2.38	0.123			0.08	0.779			6.39	0.011^*
Yes	50 (35.2)	54 (40.0)			72 (43.4)	92 (51.7)			124 (71.7)	199 (72.9)			246 (51.1)	345 (58.9)
No	92 (64.8)	81 (60.0)			94 (56.6)	86 (48.3)			49 (28.3)	74 (27.1)			235 (48.9)	241 (41.1)
The frequency of teeth brushing			1.38	0.241			1.62	0.203			1.06	0.303			6.09	0.014^*
≤1/day	71 (50.0)	77 (57.0)			80 (48.2)	98 (55.1)			111 (64.2)	188 (68.9)			262 (54.5)	363 (61.9)
≥2/day	71 (50.0)	58 (43.0)			86 (51.8)	80 (44.9)			62 (35.8)	85 (31.1)			219 (45.5)	223 (38.1)

Mean significant level p < 0.05 (two-sided test).

Genotype distributions

Rs1499821 was in HWE in the caries groups and the caries-free groups of the three separate populations and the combined population. There was no significant difference in the allele frequency or genotype distribution of SLC2A2 rs1499821 between the caries group and the caries-free group in any of the three populations or the combined population (p > 0.05) (Table 2).

Table 2.

Frequency Distribution of rs1499821 Genotypes and Alleles in All Subjects [n (%)]

	Han				Zhuang				Baikuyao				Combined population
	Caries group (N = 142)	Caries-free group (N = 135)	χ ²	p	Caries group (N = 166)	Caries-free group (N = 178)	χ ²	p	Caries group (N = 173)	Caries-free group (N = 273)	χ ²	p	Caries group (N = 481)	Caries-free group (N = 586)	χ ²	p
Genotypes			3.32	0.183			0.80	0.669			0.01	0.996			4.12	0.127
CC	83 (58.5)	93 (68.9)			108 (65.1)	123 (69.1)			136 (78.6)	215 (78.8)			327 (68.0)	431 (73.5)
CT	54 (38.0)	38 (28.1)			53 (31.9)	49 (27.5)			34 (19.7)	53 (19.4)			141 (29.3)	140 (23.9)
TT	5 (3.5)	4 (3.0)			5 (3.0)	6 (3.4)			3 (1.7)	5 (1.8)			13 (2.7)	15 (2.6)
Alleles			2.63	0.105			0.39	0.530			0.0001	0.992			3.24	0.072
C	220 (77.5)	224 (83.0)			269 (81.0)	295 (82.9)			306 (88.4)	483 (88.5)			795 (82.6)	1002 (85.5)
T	64 (22.5)	46 (17.0)			63 (19.0)	61 (17.1)			40 (11.6)	63 (11.5)			167 (17.4)	170 (14.5)

p-Values indicate the difference for comparison of genotype distributions (or allele frequency) between the caries group and caries-free group by the χ² test in the Han, Zhuang, Baikuyao, and combined populations.

Mean significant level p < 0.05 (two-sided test).

Genotypic association of rs1499821 with dental caries

The dominant model was statistically significant (p < 0.05) in the Han population and combined population. The caries risk of CT+TT genotype carriers was 1.33 times higher than carriers with CC genotype in dominant model (adjusted 95% CI: 1.02-1.74) in the combined population. In the Han population, the caries risk of CT+TT genotype carriers was 1.69 times higher than carriers with CC genotype in dominant model (adjusted 95% CI: 1.01-2.81) (Table 3).

Table 3.

Logistic Regression Analysis of rs1499821 Genotypes Associated with Dental Caries in All Subjects

Model	Genotype	Han		Zhuang		Baikuyao		Combined population
Model	Genotype	Adjusted OR (95% CI)	p	Adjusted OR (95% CI)	p	Adjusted OR (95% CI)	p	Adjusted OR (95% CI)	p
rs1499821
Dominant	CT+TT vs. CC	1.69 (1.01-2.81)	0.045^*	1.23 (0.78-1.94)	0.382	1.03 (0.64-1.64)	0.914	1.33 (1.02-1.74)	0.038^*
Recessive	TT vs. CT+CC	1.24 (0.32-4.87)	0.757	0.92 (0.27-3.13)	0.890	0.85 (0.20-3.63)	0.821	1.01 (0.47-2.16)	0.989
Additive	CT vs. TT vs. CC	1.53 (0.97-2.39)	0.065	1.16 (0.78-1.72)	0.476	1.01 (0.67-1.52)	0.976	1.24 (0.98-1.58)	0.069

Adjusted by gender, the frequency of teeth brushing and eating at school.

Significance level p < 0.05 (two-sided test).

CI, confidence interval; OR, odds ratio.

Association between the frequency of sweet food intake and rs1499821

The correlation between rs1499821 and the frequency of sweet food intake was not statistically significant in all three populations and the combined population (p > 0.05) (Table 4).

Table 4.

Association Between the Frequency of Sweet Food Intake and rs1499821 Polymorphism

	Han					Zhuang					Baikuyao					Combined population
Variable	CC (N = 176)	CT (N = 92)	TT (N = 9)	χ ²	p	CC (N = 231)	CT (N = 102)	TT (N = 11)	χ ²	p	CC (N = 351)	CT (N = 87)	TT (N = 8)	χ ²	p	CC (N = 758)	CT (N = 281)	TT (N = 28)	χ ²	p
The frequency of sweet food intake				0.91	0.636				0.36	0.837				0.35	0.854				1.46	0.482
≤1/week	44 (25)	22 (23.9)	1 (11.1)			51 (22.1)	25 (24.5)	3 (27.3)			164 (46.7)	42 (48.3)	3 (37.5)			259 (34.2)	89 (31.7)	7 (25.0)
≥2/week	132 (75.0)	70 (76.1)	8 (88.9)			180 (77.9)	77 (75.5)	8 (72.2)			187 (53.3)	45 (51.7)	5 (62.5)			499 (65.8)	192 (68.3)	21 (75.0)

Significance level p < 0.05 (two-sided test).

Discussion

In this study, the association between the SLC2A2 rs1499821 and caries susceptibility were examined in the Han, Zhuang, Baikuyao, and combined populations. In the genetic models, the rs1499821 SNP was identified as a polymorphism associated with susceptibility to dental caries in the Han and combined populations. The association between rs1499821 and caries susceptibility was revealed to be under the dominant model in both the Han population (p = 0.045, OR = 1.69, adjusted 95% CI = 1.01-2.81) and the combined population (p = 0.038, OR = 1.33, adjusted 95% CI = 1.02-1.74), according to logistic regression analysis, whereas in Zhuang and Baikuyao populations, the relationship between rs1499821 and caries susceptibility was not statistically significant. It was notable that the association of the rs1499821 polymorphism with caries susceptibility is related to ethnicity. Our study shows that the rs1499821 polymorphism associated with caries susceptibility may act as a risk factor. However, an Italian study showed that rs1499821 was a protective factor for caries susceptibility in the Italian Caucasian adult population (Robino et al., 2015), which is inconsistent with our conclusion. We speculate that this difference in results may be owing to different surveyed regions and ethnic groups. Just as the relationship between sugar intake and dental caries is affected by factors such as fluoride exposure and national income and income inequality (Burt and Pai, 2001; Downer et al., 2008; Masood et al., 2012; Ruxton et al., 1999; Sreebny, 1982b; van Loveren, 2019; Woodward and Walker, 1994), the relationship between genetic polymorphisms that may be associated with sugar intake and dental caries may also be affected by similar factors. In the future, we should try to conduct research in different countries, different ethnic groups, and different age groups to get a pure relationship of rs1499821 and dental caries.

However, the identified association between rs1499821 and dental caries was not significant after multiple testing correction. If we use the Bonferroni correction, p-values with statistical significance described in the results of genotypic association of rs1499821 with dental caries will no longer be significant. Therefore, we need to be cautious in interpreting the association between rs1499821 and caries susceptibility. The chances for a false-positive result cannot be dismissed. Validation in a larger, more homogeneous sample is necessary. In the study by Vieira et al. (2008), it was demonstrated that known true associations may be missed when multiple testing correction is applied. Moreover, simply ignoring the nominal association presented in this study may lead people to incorrectly believe that biological relationship does not exist, thereby delaying the discovery of this field. Therefore, our results still support the notion that rs1499821 may play a role in caries susceptibility.

In our study, we found that the association between the frequency of sweet food intake and dental caries was statistically significant in Han and the combined population (p < 0.05). However, no association was found between the rs1499821 polymorphism and the frequency of sweet food intake in all three ethnic groups (p > 0.05). The rs1499821 polymorphism may not increase caries susceptibility via the frequency of sweet food intake. In a Canadian population, SLC2A2 rs5400 was shown to be associated with higher sugar consumption, and those with the rs5400 variant had a significant preference for high-sugar foods (Eny et al., 2008), as the rs5400 polymorphism, rs1499821 may influence caries susceptibility by affecting the amount of sweet food consumption or the preference for sweet foods. An animal experiment found that GLUT2-mediated sugar detection affected meal size rather than meal frequency (Stolarczyk et al., 2010). However, the relative importance of the frequency of sugar intake versus total sugar consumption is difficult to assess. Numerous research have shown that the frequency of sugar intake has a stronger effect on dental caries than the amount of sugar consumed (Gustafsson et al., 1954; Kalsbeek and Verrips, 1994; Sreebny, 1982a); however, two recent longitudinal studies have found that the amount of sugar consumed is more significant than the frequency on dental caries (Burt et al., 1988; Rugg-Gunn, 1993; Szpunar et al., 1995). One study in the United States also showed that the amount of sugar intake may have a stronger association with dental caries than frequency (Alosaimi and Bernabé, 2022). However, there is undoubtedly a strong correlation between the amount of sugar intake and frequency (Rugg-Gunn, 1993), with an increase in one of the two factors often leading to an increase in the other, and it remains controversial which of the two is more important. The effect of the rs1499821 polymorphism on caries susceptibility may also be through a pathway independent of the effect on sweet. Eriksson et al. (2019) reported three SNPs, rs1996220, rs5400, and rs11917504 of SLC2A2 gene, were associated with dental caries, but not associated with the amount of preferred sweet food intake, sweet taste threshold, and sweet liking.

Our research suggests that the SLC2A2 rs1499821 may serve as a biomarker for the early detection of dental caries in the Chinese 12-year-old Han population. It might assist us in creating a genetic test with predictive value to screen and identify patients who are susceptible to dental caries. Combining genetic testing with conventional examination methods can enhance clinical diagnosis, help detect dental caries earlier, and assist clinicians in monitoring preventive treatment. It is beneficial to individuals to predict the risk of dental caries and conduct more targeted preventive or therapeutic treatments. It is favorable for governments to develop new strategies to protect populations at high risk of dental caries and conduct more targeted caries management and prevention programs, for example, providing dietary and oral hygiene advice for children with identified risk genotypes, as well as comprehensive caries interventions such as fluoride varnish application, pit and fissure sealant, and preventive pit and fissure caries restoration.

To our knowledge, before our study, only one study has investigated the association between the rs1499821 polymorphism and caries susceptibility, which was conducted in Italy (Robino et al., 2015). Moreover, our study is the first to examine the influence of SLC2A2 rs1499821 on dental caries in China's diverse ethnic populations, as well as the first to assess the association between the rs1499821 polymorphism and the frequency of sweet food intake, as far as we are aware.

Nevertheless, more studies are needed to further confirm our findings. This study is limited to 12-year-old Chinese Han, Zhuang, and Baikuyao populations, therefore the conclusion may not apply to other ethnic groups. The lack of association between the frequency of sweet food and the rs1499821 polymorphism may be owing to the method used to measure the frequency of sugar intake. We should try different ways to measure the frequency of sweet food intake in the future. And the association between the amount of sweet food intake and dental caries and the rs1499821 polymorphism was not considered in our study. Whether this relation between the rs1499821 polymorphism and caries susceptibility is mediated by the impact of the rs1499821 polymorphism on dietary and nutritional habits remains unclear from our results. Further investigation is needed.

Conclusions

Our study suggests the possible influence of the rs1499821 polymorphism in the SLC2A2 gene on caries susceptibility in the 12-year-old Chinese Han population and suggests a possible caries-risk effect of increased frequency of sweet food intake.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author, upon reasonable request.

Footnotes

Acknowledgments

The authors thank all the individuals who volunteered to take part in the research.

Authors' Contributions

L.L. analyzed the data and drafted the article. F.M. and Q.L. collected the data and drafted part of the article. X.Y. analyzed the data. X.Z. designed the study, wrote and revised the article. All the authors discussed the results and revised the article.

Author Disclosure Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding Information

This study was supported in part by the National Natural Science Foundation of China (8166040023).

References

Alosaimi

, Bernabé

. Amount and frequency of added sugars intake and their associations with dental caries in United States adults. Int J Environ Res Public Health, 2022; 19(8):4511.

Bretz

, Corby

, Schork

, et al. Longitudinal analysis of heritability for dental caries traits. J Dent Res, 2005; 84(11):1047-1051.

Burt

, Eklund

, Morgan

, et al. The effects of sugars intake and frequency of ingestion on dental caries increment in a three-year longitudinal study. J Dent Res, 1988; 67(11):1422-1429.

Burt

, Pai

. Sugar consumption and caries risk: A systematic review. J Dent Educ, 2001; 65(10):1017-1023.

Chapple

, Bouchard

, Cagetti

, et al. Interaction of lifestyle, behaviour or systemic diseases with dental caries and periodontal diseases: Consensus report of group 2 of the joint EFP/ORCA workshop on the boundaries between caries and periodontal diseases. J Clin Periodontol, 2017; 44 (Suppl 18):S39-S51.

Conry

, Messer

, Boraas

, et al. Dental caries and treatment characteristics in human twins reared apart. Arch Oral Biol, 1993; 38(11):937-943.

Downer

, Drugan

, Blinkhorn

. Correlates of dental caries in 12-year-old children in Europe: A cross-sectional analysis. Community Dent Health, 2008; 25(2):70-78.

Eny

, Wolever

, Fontaine-Bisson

, et al. Genetic variant in the glucose transporter type 2 is associated with higher intakes of sugars in two distinct populations. Physiol Genomics, 2008; 33(3):355-360.

Eriksson

, Esberg

, Haworth

, et al. Allelic variation in taste genes is associated with taste and diet preferences and dental caries. Nutrients, 2019;11(7).

10.

Garcia-Bailo

, Toguri

, Eny

, et al. Genetic variation in taste and its influence on food selection. OMICS, 2009; 13(1):69-80.

11.

Gustafsson

, Quensel

C-E

, Lanke

, et al. The Vipeholm dental caries study. The effect of different levels of carbohydrate intake on caries activity in 436 individuals observed for five years. Acta Odontol Scand, 1954; 11:232-364.

12.

Holla

, Linhartova

, Lucanova

, et al. GLUT2 and TAS1R2 polymorphisms and susceptibility to dental caries. Caries Res, 2015; 49(4):417-424.

13.

Hunter

. Risk factors in dental caries. Int Dent J, 1988; 38(4):211-217.

14.

Joost

, Thorens

. The extended GLUT-family of sugar/polyol transport facilitators: Nomenclature, sequence characteristics, and potential function of its novel members (review). Mol Membr Biol, 2001; 18(4):247-256.

15.

Kalsbeek

, Verrips

. Consumption of sweet snacks and caries experience of primary school children. Caries Res, 1994; 28(6):477-483.

16.

Kulkarni

, Chng

, Eny

, et al. Association of GLUT2 and TAS1R2 genotypes with risk for dental caries. Caries Res, 2013; 47(3):219-225.

17.

Leturque

, Brot-Laroche

, Le Gall

. GLUT2 mutations, translocation, and receptor function in diet sugar managing. Am J Physiol Endocrinol Metab, 2009; 296(5):E985-E992.

18.

Liu

, Liu

, Grundke-Iqbal

, et al. Brain glucose transporters, O-GlcNAcylation and phosphorylation of tau in diabetes and Alzheimer's disease. J Neurochem, 2009; 111(1):242-249.

19.

van Loveren

. Sugar restriction for caries prevention: Amount and frequency. Which is more important? Caries Res, 2019; 53(2):168-175.

20.

, Tao

, Lo

ECM

, et al. The 4th National Oral Health Survey in the Mainland of China: Background and methodology. Chin J Dent Res, 2018; 21(3):161-165.

21.

Masood

, Masood

, Newton

. Impact of national income and inequality on sugar and caries relationship. Caries Res, 2012; 46(6):581-588.

22.

Moynihan

. Dietary advice in dental practice. Br Dent J, 2002; 193(10):563-568.

23.

Petersen

, Bourgeois

, Ogawa

, et al. The global burden of oral diseases and risks to oral health. Bull World Health Organ, 2005; 83:661-669.

24.

Robino

, Bevilacqua

, Pirastu

, et al. Polymorphisms in sweet taste genes (TAS1R2 and GLUT2), sweet liking, and dental caries prevalence in an adult Italian population. Genes Nutr, 2015; 10(5):485.

25.

Roncero

, Alvarez

, Chowen

, et al. Expression of glucose transporter isoform GLUT-2 and glucokinase genes in human brain. J Neurochem, 2004; 88(5):1203-1210.

26.

Rugg-Gunn

. Nutrition, diet and dental public health. Community Dent Health, 1993; 10:47-56.

27.

Ruxton

CHS

, Garceau

FJS

, Cottrell

. Guidelines for sugar consumption in Europe: Is a quantitative approach justified?. Eur J Clin Nutr, 1999; 53(7):503-513.

28.

Sanders

. Diet and general health: Dietary counselling. Caries Res, 2004; 38 (Suppl 1):3-8.

29.

Sayegh

, Dini

, Holt

, et al. Food and drink consumption, sociodemographic factors and dental caries in 4-5-year-old children in Amman, Jordan. Br Dent J, 2002; 193(1):37-42.

30.

Sheiham

. Dietary effects on dental diseases. Public Health Nutr, 2001; 4(2b):569-591.

31.

Sreebny

LM.

Sugar and human dental caries. Nutr Educ Mod Concepts Food Assim, 1982a;40:19-65.

32.

Sreebny

LM.

Sugar availability, sugar consumption and dental caries. Community Dent Oral Epidemiol, 1982b;10(1):1-7.

33.

Stolarczyk

, Guissard

, Michau

, et al. Detection of extracellular glucose by GLUT2 contributes to hypothalamic control of food intake. Am J Physiol Endocrinol Metab, 2010; 298(5):E1078-E1087.

34.

Szpunar

, Eklund

, Burt

. Sugar consumption and caries risk in schoolchildren with low caries experience. Community Dent Oral Epidemiol, 1995; 23(3):142-146.

35.

Tannure

, Küchler

, Lips

, et al. Genetic variation in MMP20 contributes to higher caries experience. J Dent, 2012; 40(5):381-386.

36.

Thorens

, Sarkar

, Kaback

, et al. Cloning and functional expression in bacteria of a novel glucose transporter present in liver, intestine, kidney, and β-pancreatic islet cells. Cell, 1988; 55(2):281-290.

37.

Vieira

, McHenry

, Daack-Hirsch

, et al. Candidate gene/loci studies in cleft lip/palate and dental anomalies finds novel susceptibility genes for clefts. Genet Med, 2008; 10(9):668-674.

38.

Vos

, Allen

, Arora

, et al. Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-2015: A systematic analysis for the global burden of disease study 2015. Lancet, 2016; 388(10053):1545-1602.

39.

Wang

, Shaffer

, Weyant

, et al. Genes and their effects on dental caries may differ between primary and permanent dentitions. Caries Res, 2010; 44(3):277-284.

40.

Wang

, Shaffer

, Zeng

, et al. Genome-wide association scan of dental caries in the permanent dentition. BMC Oral Health, 2012; 12(1):1-11.

41.

Woodward

, Walker

. Sugar consumption and dental caries: Evidence from 90 countries. Br Dent J, 1994; 176(8):297-302.

42.

World Health Organization. Oral Health Surveys: Basic Methods. World Health Organization; 2013.