Association of ANRIL Gene Polymorphisms with Gastric Cancer Risk: A Case-Control Study

Abstract

Background:

Gastric cancer’s (GC) cause is unknown, but its complexity indicates that, in addition to environmental factors, it may have genetic origins. Scientists are studying single-nucleotide polymorphisms (SNPs) in the antisense noncoding RNA in the INK4 locus (ANRIL) gene, which encodes a long noncoding RNA molecule. They found a link between the ANRIL gene product and some polymorphisms and GC, suggesting genetic changes may lead to precancerous conditions.

Methods:

In a case-control research that included 250 patients with GC and 210 controls who were age- and gender-matched, four SNPs within the ANRIL gene were genotyped. These SNPs were rs1333049, rs496892, rs2383207, and rs2151280. Tetra-primer amplification refractory mutation system-PCR was utilized to carry out the process of genotyping.

Results:

It was found that the chance of developing GC was connected with three SNPs rs2151280, rs1333049, and rs496892. Nevertheless, rs2383207 did not demonstrate any meaningful connection. In addition, whereas CCTC and TTCC haplotypes were shown to be less common, certain haplotypes that contained these SNPs (TTCG, TCTC, and TTTC) displayed a considerably higher prevalence in the cancer group in comparison to the control group.

Conclusion:

This study showed novel associations between specific ANRIL gene polymorphisms (SNPs) and the risk of GC. These findings shed light on the potential role of ANRIL SNPs in GC risk and highlight the need for additional research to clarify the underlying functional processes. Understanding these functional processes might lead to developing novel diagnostic or treatment approaches for this cancer.

Introduction

Gastric cancer (GC) constitutes a significant global health challenge, consistently ranking among the top five most prevalent and lethal malignancies internationally (Iwu and Iwu-Jaja, 2023). One of the main reasons for the high mortality rate is the lack of specific early symptoms and noninvasive diagnostic biomarkers, which leads to delayed diagnosis and a poor prognosis (Petkevicius et al., 2020). Therefore, finding methods for the early diagnosis of GC can increase treatment effectiveness and improve survival rates (Smyth et al., 2020). Accordingly, in recent years, different strategies for earlier diagnosis of GC, such as using various types of biomarkers and genetic information, have been developed (Chen et al., 2021b; Liu et al., 2022; Xiao et al., 2022; Xu et al., 2022). Given that genetic codes contribute to the development of many cancers alongside environmental factors, examining genetic sequences can be highly valuable for understanding the disease’s pathogenesis and devising strategies for early diagnosis and effective treatment (Xu et al., 2022).

Approximately 75% of the human genome is transcribed into RNA, yet only a small fraction (∼2%) ultimately encodes proteins. The remaining ∼98.5% gives rise to noncoding RNAs (ncRNAs), categorized primarily by size into small ncRNAs, long noncoding RNAs (lncRNAs), and microRNAs (Hombach and Kretz, 2016). Among these, lncRNAs, defined as RNA molecules exceeding 200 nucleotides in length that lack protein-coding ability, can be further classified based on their structural features, such as natural antisense, intergenic, and intronic lncRNAs (Carninci et al., 2005). Several lines of evidence point to the role of lncRNAs in cell cycle regulation and affect differentiation, proliferation, and apoptosis (Ghafouri-Fard et al., 2020). Several studies have revealed that LncRNAs involve numerous biological and pathological processes, including development, proliferation, metastasis, and invasion (Maruei-Milan et al., 2021, Tano and Akimitsu, 2012). Notably, these processes significantly influence gene expression at transcriptional and posttranscriptional levels. Additionally, lncRNAs can function as protein scaffolds, facilitating interactions between proteins (Mercer et al., 2009). With these in mind, it can be said that various types of ncRNAs express at different levels, collaborate in a network, and contribute to carcinogenesis by modifying oncogenes or tumor suppressors (Wan et al., 2015). Numerous studies have linked the important lncRNA antisense noncoding RNA on the INK4 locus (ANRIL) to various cancers (Kangarlouei et al., 2019). The INK4 locus encodes three tumor suppressor genes, including P16, P15, and ARF (Yap et al., 2010). In recent years, accumulating studies have shown that increased expression of ANRIL can cause the growth and proliferation of cells and cause cancer by reducing the expression of two tumor suppressors, p15 and p16 (Kotake et al., 2011). It is proven that ANRIL is upregulated in GC tissues. Furthermore, there was a positive correlation between the expression level of ANRIL and the size of the tumor (Zhang et al., 2014).

Beyond investigating the association between ANRIL expression and cancer risk, exploring single-nucleotide polymorphisms (SNPs) within this gene presents another intriguing avenue in cancer research. SNP analysis has the potential to identify disease-causing genes in humans and facilitate early-stage cancer diagnosis, emphasizing the significant medical value of this research field. Notably, a growing body of research has linked ANRIL SNPs to various cancers (Deng et al., 2019; Gong et al., 2016; Iacobucci et al., 2011; Khorshidi et al., 2017; Li et al., 2020; Poi et al., 2017; Royds et al., 2015; Taheri et al., 2017; Zhu et al., 2019), underscoring the crucial role of such studies in advancing our understanding of cancer susceptibility and diagnosis.

This study examined associations of lncRNA ANRIL (rs1333049, rs496892, rs2151280, and rs2383207) polymorphisms (Fig. 1.) with GC in the Iranian population.

FIG. 1.

Maps of the ANRIL gene with polymorphism positions indicated. Exons 1-7 are numbered and represented by black boxes.

Material and Methods

Study subjects

This hospital-based case-control study was conducted on 250 patients with histologically confirmed GC and 210 population-based healthy controls with no history of cancer who were referred to the Aras clinic at Imam Khomeini Hospital of Ardabil, Iran. This sample size provided approximately 83% power to detect an odds ratio (OR) of 1.5 at the 0.05 significance level for SNPs with a minor allele frequency of 0.30 in controls. The local Ethical Committee of Ardabil University of Medical Sciences approved the study protocol (IR.ARUMS.REC.1398.492) and written informed consent was obtained from all subjects. A standardized proforma was developed and used for collecting demographic information, clinical data, and relevant medical history from all study participants. This proforma included fields for age, gender, family history of GC, and other known risk factors for GC. The same proforma was used for both cases and controls to ensure consistency in data collection. Inclusion criteria for the GC group were histologically confirmed diagnosis of GC, age ≥18 years, and no prior history of other malignancies. Control subjects were selected from the same geographical area and matched for age (±1 years) and gender. Exclusion criteria for both groups included previous history of any cancer, severe chronic diseases that could affect genetic profiles (e.g., autoimmune disorders, severe liver, or kidney disease), inability to provide informed consent, and familial cancer syndromes. Additionally, controls with any history of gastric ulcers, chronic gastritis, or other significant gastrointestinal disorders were excluded to minimize the risk of including individuals with precancerous conditions. All participants provided written informed consent before enrollment in the study. Based on tumor origin, GC diagnoses were categorized as cardia and noncardia (Bramer, 1988). According to the morphological features of tumor, patients are classified into two histological types: intestinal and diffuse (Lauren, 1965).

Genomic DNA extraction and genotyping

Peripheral blood samples (2 mL) were obtained from each participant. Genomic DNA was subsequently extracted from whole blood using the method described by Saremi et al. (Ali et al., 2008), with minor modifications.

The amplification refractory mutation system (ARMS) offers a simple and rapid approach for detecting SNPs and small nucleotide deletions/insertions. In this study, we employed the tetra-primer ARMS technique to determine ANRIL polymorphism. The primers used for genotyping the ANRIL gene SNPs (rs1333049, rs496892, rs2383207, and rs2151280) were designed specifically for this study using the Oligo 7 software (Molecular Biology Insights, Inc., Colorado Springs, CO). The primer sequences were carefully optimized to ensure specificity for the target regions and to avoid potential cross-reactivity with other genomic regions. All primer sequences were verified using BLAST to confirm their uniqueness to the target regions. The final primer sequences and their specific annealing temperatures are provided in Table 1. Two allele-specific primers targeting the complementary strands of the polymorphic site were designed for co-amplification of both mutant and wild-type alleles in a single polymerase chain reaction (PCR). Amplification was carried out using a commercially available master mix (Taq DNA Polymerase 2× Master Mix RED, Ampliqon, Denmark) following the manufacturer’s protocol.

Table 1.

Sequence and Annealing Temperature of Primers

Polymorphisms	Sequence (5′ → 3′)	Annealing temperature (°C)
rs2151280
FO	GGTGCCTCTATGATAGGTGGTAG	53°C
RO	TGTCAAATCAGTCTTGCTGCCT
FI	GGTCCTGATAGTAGCTTGTTGCG
RI	CTCGATGGCCCTCAAACGT
rs2383207
FO	AACAAGTACATGGGGTAGCAA	52°C
RO	AGTTGATCATGTCCAATGTCATTTG
FI	TCCTGTTCGGATCCCTCCA
RI	GCTGAAAATAGTAAATAATCATGCTTAACC
rs496892
FO	AAGACTTTAGGGGGCCATCGTT	54°C
RO	GCAGACAGAACCTTAGCAGCACA
FI	CTCCAGCTGGGTGCTCGT
RI	GCAGGCACCCCTGAATACG
rs1333049
FO	ATACCCGAAGTAGAGCTGCAAAG	56°C
RO	CTGGCAGATCTTGGAATATCTGCTTAT
FI	CCTCATACTAACCATATGATCAACAGATC
RI	CCTCTGCGAGTGGCTGCTTATC

To detect polymorphisms of ANRIL rs2151280 and rs2383207, a 25-μL PCR reaction mixture was prepared, containing 1 μL of template DNA (approximately 90 ng/μL), 1 μL of each primer (10 pmol/μL), 12.5 μL of master mix, and 7.5 μL of nuclease-free water. Identical PCR conditions were employed for rs496892, except that 0.8 μL of DMSO and 6.7 μL of water were substituted. PCR amplification was performed under the following conditions: initial denaturation at 95°C for 5 min, followed by 30 cycles consisting of denaturation at 95°C for 60 s, annealing at specific temperatures listed in Table 1, and extension at 72°C with varying durations (30 s for rs2151280, rs1333049, and rs496892; 60 s for rs2383207). A final extension step at 72°C for 10 min completed the program on a Bio-Rad thermocycler (USA). The amplified products were separated by electrophoresis on a 2% agarose gel containing 1 μL of DNA Safe Stain (Cat. No.: EP5082).

Statistical analysis

Adherence to Hardy-Weinberg equilibrium (HWE) for each SNP was assessed using the Chi-square test in SPSS 25.0 (SPSS Inc., Chicago, IL) after calculating expected genotype frequencies and comparing them to observed frequencies. Associations between ANRIL genotypes and GC risk were assessed by calculating ORs and 95% confidence intervals (CIs) under four inheritance models: recessive, dominant, codominant, and over-dominant. The chi-square test was used to compare genotype distributions between cases and controls in SPSS 25.0. Haplotype frequencies for ANRIL were calculated using Haploview software. Statistical significance was set at p < 0.05.

Results

Demographic data

The study group consists of 250 histopathologically confirmed cases with GC (age: 62.14 ± 8.43) and 210 healthy controls (61.21 ± 9.51). The demographic data for the two groups is presented in Table 2. There were no significant differences in age, body mass index, or smoking history between the cases and control groups.

Table 2.

The Demographic Data for the Two Groups

Participant characteristics	Case	Control
Age	62.14 ± 8.43	61.21 ± 9.51
Sex
Male	135	130
Female	115	80
Tumor origin
Cardia	105 (50.00%)
Cardia and noncardia	29 (13.81%)
Noncardia	76 (36.19%)
TNM Stage
I	2 (0.95%)
II	10 (4.75%)
III	91 (43.30%)
IV	107 (51.00%)

Frequencies of polymorphisms in gastric cancer compared to controls

The frequencies of ANRIL alleles in all the mentioned groups have been found to conform to the assumption of HWE (p > 0.05), indicating a random distribution. The genotypes and inheritance models of the four ANRIL SNPs in GC patients and controls are presented in Table 3. As shown in the table, the rs2383207 variant displays no significant difference in allele or genotype frequencies between GC patients and normal individuals. However, the rs1333049 SNP has been demonstrated to be linked with GC risk in codominant, dominant, and over-dominant inheritance models. Similarly, the rs496892 showed associations with GC in codominant, dominant, and recessive models. Furthermore, rs2151280 exhibited associations with GC in codominant and recessive models. Furthermore, haplotype analysis of SNPs rs496892, rs2151280, rs2383207, and rs1333049 revealed significant associations between specific haplotypes within the ANRIL gene and increased GC risk. Compared to the control group, the frequencies of TTCG, TCTC, and TTTC haplotypes were significantly higher in the GC group. Conversely, CCTC and TTCC haplotypes exhibited a lower prevalence in cancer patients compared to controls. The detailed distribution of ANRIL haplotype frequencies in both patients and control groups is presented in Table 4.

Table 3.

Association Analysis of ANRIL Polymorphisms with Gastric Cancer

				Co-dominant		Dominant	Recessive	Over-dominant
	N (%)			Or (95% Cl) p value		Or (95% Cl) p value	Or (95% Cl) p value	Or (95% Cl) p value
rs1333049 C > G	CC	CG	GG	CC vs GG	CC vs CG	CG+GG vs CC	GG vs CG+CC	CG vs GG+CC
Controls	145 (70.0)	57 (26.2)	8 (3.8)	1.53 (0.59-3.93)0.370	2.13 (1.43-3.17)0.000	2.05 (1.40-3.02)0.000	1.16 (0.45-2.98)0.751	2.07 (1.40-3.07)0.000
Cases	130 (54.0)	109 (41.6)	11 (4.4)	1.53 (0.59-3.93)0.370	2.13 (1.43-3.17)0.000	2.05 (1.40-3.02)0.000	1.16 (0.45-2.98)0.751	2.07 (1.40-3.07)0.000
rs496892 C > T	CC	CT	TT	CC vs TT	CC vs CT	CT+TT vs CC	TT vs CT+CC	CT vs TT+CC
Controls	80 (38.1)	94 (44.8)	36 (17.1)	1.94 (1.15-3.26)0.012	1.36 (0.89-2.06)0.151	1.52 (1.03-2.24)0.035	1.62 (1.02-2.57)0.036	1.05 (0.72-1.52)0.791
Cases	72 (28.8)	115 (46.0)	63 (25.2)	1.94 (1.15-3.26)0.012	1.36 (0.89-2.06)0.151	1.52 (1.03-2.24)0.035	1.62 (1.02-2.57)0.036	1.05 (0.72-1.52)0.791
rs2383207 T > C	TT	CT	CC	TT vs CC	TT vs CT	CT+CC vs TT	CC vs CT+TT	CT vs CC+TT
Controls	89 (42.4)	95 (45.2)	26 (12.4)	0.75 (0.39-1.44)0.395	1.32 (0.89-1.95)0.162	1.20 (0.82-1.74)0.339	0.64 (0.35-1.19)0.160	1.39 (0.96-2.02)0.074
Cases	95 (39)	134 (51.7)	21 (9.3)	0.75 (0.39-1.44)0.395	1.32 (0.89-1.95)0.162	1.20 (0.82-1.74)0.339	0.64 (0.35-1.19)0.160	1.39 (0.96-2.02)0.074
rs2151280 C > T	CC	CT	TT	CC vs TT	CC vs CT	CT+TT vs CC	TT vs CT+CC	CT vs CC+TT
Controls	87 (41.4)	102 (48.6)	21 (10.0)	2.14 (1.17-3.90)0.012	1.21 (0.81-1.80)0.340	1.37 (0.094-2.00)0.101	1.92 (1.10-3.35)0.020	0.99 (0.68-1.43)0.971
Cases	85 (34.0)	121 (48.4)	44 (17.6)	2.14 (1.17-3.90)0.012	1.21 (0.81-1.80)0.340	1.37 (0.094-2.00)0.101	1.92 (1.10-3.35)0.020	0.99 (0.68-1.43)0.971

Table 4.

Haplotype Frequencies in Both Patient and Control Groups

rs496892	rs2151280	rs2383207	rs1333049	Cancer	Control	Cancer vs control
rs496892	rs2151280	rs2383207	rs1333049	Cancer	Control	Or (CI 95%)	p value
C	C	T	C	130 (0.518)	127 (0.605)	0.67 (0.46-0.98)	0.038
T	T	C	G	65 (0.262)	37 (0.174)	1.64 (1.04-2.59)	0.031
T	T	C	C	22 (0.090)	35 (0.164)	0.48 (0.27-0.85)	0.011
T	C	T	C	16 (0.064)	9 (0.040)	1.52 (0.66-3.53)	0.319
T	T	T	C	17 (0.066)	2 (0.005)	7.58 (1.73-33.23)	0.002

Discussion

In the current study, we demonstrated correlations between some ANRIL genetic variations and the propensity for developing GC within a population of Iranian individuals. ANRIL was identified as an oncogene involved in several tumors, such as GC, lung cancer, hepatocellular carcinoma, and esophageal squamous cell carcinoma. Inhibition of ANRIL suppresses cancer cell proliferation, migration, and invasion (Li et al., 2016). Conversely, ANRIL is overexpressed in several different malignancies, such as liver, lung, prostate, colorectal, gastric, and brain (Du et al., 2023; Liu et al., 2021; Zhao et al., 2018). It has been demonstrated that some polymorphisms in this gene are more prevalent and linked to the development of neurofibromas (Pasmant et al., 2011), prostate cancer (Taheri et al., 2017), and aggressive forms of breast cancer (Royds et al., 2015). We have shown that in rs1333049, C/G genotype is associated with the risk of GC. ANRIL rs1333049 is an intergene variant in the cyclin-dependent kinase inhibitor 2A/B (CDKN2A/B) and has been linked to an increased likelihood of developing coronary artery disease (CAD) (Kaur et al., 2020), myocardial infarction (Shakhtshneider et al., 2019), and lung cancer (Chen et al., 2021a). Studies have shown that the rs1333049 polymorphism is a marker of the risk of cardiovascular diseases. The polymorphism has been found to modify the dynamics of vascular smooth muscle cell proliferation, which can lead to the advancement of cardio and cerebrovascular disease (Kaur et al., 2020). The rs1333049 polymorphism has also been associated with increased arterial stiffness, particularly in subjects with metabolic syndrome (Phababpha et al., 2013). Motterle et al. found that the GG genotype of the ANRIL variant at rs1333049 was associated with the highest expression of ANRIL in vascular smooth muscle cells (Motterle et al., 2012). Therefore, it is reasonable to hypothesize that this genotype may also lead to an elevated level of ANRIL in GC tissues. A subsequent investigation involving 120 patients with GC revealed a significant association between elevated ANRIL expression in these tumors and a more advanced tumor stage, a larger tumor size, and an increased risk of tumor recurrence. This suggests that high ANRIL levels could accelerate tumor growth and negatively impact the prognosis of GC patients (Li et al., 2020).

Besides, rs496892 T/T genotype has been shown to be associated with GC in the assessed population. Regarding the genetic models performed for this SNP, the dominant and recessive models showed 1.52-1.62-fold increased risk, respectively, toward GC (OR = 1.52; CI = 1.03-2.24; p = 0.035; and OR = 1.62; CI = 1.02-2.57; p = 0.036). Earlier studies have primarily focused on the association between the rs496892 polymorphism and both periodontitis and CAD. A study in 2022 conducted a meta-analysis to examine the link between ANRIL gene polymorphisms and periodontitis. The results showed that the polymorphism at position rs496892 was connected to the susceptibility of periodontitis in the entire population using allele contrast and dominant models (Ozturk and Ada, 2022). Studies have indicated that the rs496892 polymorphism is linked to CAD in various populations. For instance, a study conducted on the South Indian population found that rs496892 polymorphism played a significant role in the progression of CAD (Mangalarapu et al., 2019). To the best of our knowledge, this is the first study to examine how rs496892 affects cancer and it shows that having the T/T genotype increases the risk of developing GC by 1.94 times.

The rs2383207 polymorphism, located on chromosome 9p21.3, has been the subject of research in the context of CAD and atherosclerosis. A meta-analysis and observational studies have indicated that the ANRIL rs2383207 polymorphism is associated with an increased risk of CAD. The presence of this polymorphism has been linked to a significantly higher risk of CAD, as evidenced by the findings of the meta-analysis and observational studies (Wang et al., 2016). Research has also focused on the association between the CDKN2B-AS rs2383207 polymorphism and susceptibility to atherosclerosis. The meta-analysis aimed to estimate the associations between this polymorphism and atherosclerosis susceptibility, indicating a specific interest in its potential role in this condition (Timofeeva et al., 2022).

The relationship between rs2151280 polymorphisms and cancer is complex and currently under active research. While some studies suggest associations, definitive conclusions still require further investigation. Li et al.\ (2020) explored the association between the ANRIL rs2151280 polymorphism and overall survival in adult patients with hematological malignancies undergoing allogeneic hematopoietic stem cell transplantation. Notably, patients with the rs2151280 TT genotype exhibited significantly poorer overall survival. The authors propose that this association stems from ANRIL’s transcriptional suppression of the entire ARF-INK4 gene locus (Aguilo et al., 2011; Meseure et al., 2016; Pasmant et al., 2007). Prior research suggests that rs2151280 TT leads to elevated ANRIL expression in peripheral blood mononuclear cells (PBMCs) in multiple myeloma patients. This increased ANRIL expression, in turn, downregulates mRNA levels of p15, p16, and ARF in PBMCs (Poi et al., 2017). Consequently, individuals homozygous for the rs2151280 TT genotype may have reduced ARF expression, potentially compromising p53-mediated apoptosis in hematological malignancies. Similarly, lower p16 and p15 expression could impair pRB-mediated cell cycle control, potentially promoting tumor progression or relapse (Lin et al., 2015; Poi et al., 2017).

Conclusion

There are several SNPs in the ANRIL gene and investigating their potential impacts might provide valuable insights into the role of this gene in GC. The present study demonstrated the correlation between certain ANRIL polymorphisms and susceptibility to GC. This observation supports the notion that understanding the role of SNPs can be highly valuable in the fields of diagnosis, therapy, and, particularly, the advancement of personalized medicine.

Nevertheless, the limited sample size constrains the applicability of our findings to broader groups. In addition, the research participants were selected from a specific geographic region and were of a homogeneous racial background, which may have introduced bias in the selection process and restricted the generalizability of the findings to other groups. Subsequent studies with larger sample sizes are essential to validate these findings and clarify the precise contribution of ANRIL polymorphisms to the risk of GC.

Authors' Contribution

S.H. performed experiments and wrote the manuscript. F.P. designed experiments. M.M. and A.Y. helped with the experimentation. A.F. designed and directed experiments, analyzed data and revised the manuscript. All authors read and approved the final manuscript.

Ethical Approval

The study protocol was approved by the local Ethical Committee of Ardabil University of Medical Sciences IR.ARUMS.REC.1398.492. Written informed consent was obtained from all participants.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

Funding Information

The present study was supported by School of Medicine (Grant number: 1002431), Ardabil University of Medical Sciences (ARUMS), Ardabil, Iran.

References

Aguilo

, Zhou

, Walsh

. Long noncoding RNA, polycomb, and the ghosts haunting INK4b-ARF-INK4a expression. Cancer Res, 2011; 71(16):5365-5369; doi: 10.1158/0008-5472.CAN-10-4379

Ali

, Mahnaz

, Mahmood

. Rapid genomic DNA extraction (RGDE). Forensic Science International: Genetics, 2008; 1(1):63-65.

Bramer

. International statistical classification of diseases and related health problems. Tenth revision. World Health Stat Q, 1988; 41(1):32-36.

Carninci

, Kasukawa

, Katayama

, et al. RIKEN Genome Exploration Research Group and Genome Science Group (Genome Network Project Core Group). The transcriptional landscape of the mammalian genome. Science, 2005; 309(5740):1559-1563; doi: 10.1126/science.1112014

Chen

, Chen

, Yin

, et al. Non-coding RNA polymorphisms (rs2910164 and rs1333049) associated with prognosis of lung cancer under platinum-based chemotherapy. Front Pharmacol, 2021a;12:709528; doi: 10.3389/fphar.2021.709528

Chen

, Zhang

, Xi

, et al. Recent advances in the diagnosis, staging, treatment, and prognosis of advanced gastric cancer: A literature review. Front Med (Lausanne), 2021b;8:744839; doi: 10.3389/fmed.2021.744839

Deng

, Zhou

, Li

, et al. Impact of four lncRNA polymorphisms (rs2151280, rs7763881, rs1136410, and rs3787016) on glioma risk and prognosis: A case-control study. Mol Carcinog, 2019; 58(12):2218-2229; doi: 10.1002/mc.23110

, Zhang

, Liu

, et al. LncRNA ANRIL promotes HR repair through regulating PARP1 expression by sponging miR-7-5p in lung cancer. BMC Cancer, 2023; 23(1):130; doi: 10.1186/s12885-023-10593-z

Ghafouri-Fard

, Shoorei

, Anamag

, et al. The role of non-coding RNAs in controlling cell cycle related proteins in cancer cells. Front Oncol, 2020; 10:608975; doi: 10.3389/fonc.2020.608975

10.

Gong

, Yin

, Li

, et al. Association of well-characterized lung cancer lncRNA polymorphisms with lung cancer susceptibility and platinum-based chemotherapy response. Tumour Biol, 2016; 37(6):8349-8358; doi: 10.1007/s13277-015-4497-5

11.

Hombach

, Kretz

. Non-coding RNAs: Classification, biology and functioning. Adv Exp Med Biol, 2016; 937:3-17; doi: 10.1007/978-3-319-42059-2_1

12.

Iacobucci

, Sazzini

, Garagnani

, et al. A polymorphism in the chromosome 9p21 ANRIL locus is associated to Philadelphia positive acute lymphoblastic leukemia. Leuk Res, 2011; 35(8):1052-1059; doi: 10.1016/j.leukres.2011.02.020

13.

Iwu

, Iwu-Jaja

. Gastric cancer epidemiology: Current trend and future direction. Digestion, 2023; 3(3):256-268.

14.

Kangarlouei

, Irani

, Noormohammadi

, et al. ANRIL and ANRASSF1 long noncoding RNAs are upregulated in gastric cancer. J Cell Biochem, 2019; 120(8):12544-12548; doi: 10.1002/jcb.28520

15.

Kaur

, Singh

, Reddy

. ANRIL rs1333049 C/G polymorphism and coronary artery disease in a North Indian population—Gender and age specific associations. Genet Mol Biol, 2020; 43(1):e20190024; doi: 10.1590/1678-4685-GMB-2019-0024

16.

Khorshidi

, Taheri

, Noroozi

, et al. ANRIL genetic variants in Iranian breast cancer patients. Cell J, 2017; 19(Suppl 1):72-78; doi: 10.22074/cellj.2017.4496

17.

Kotake

, Nakagawa

, Kitagawa

, et al. Long non-coding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15INK4B tumor suppressor gene. Oncogene, 2011; 30(16):1956-1962.

18.

Lauren

. The two histological main types of gastric carcinoma: Diffuse and so‐called intestinal‐type carcinoma: An attempt at a histo‐clinical classification. Acta Pathologica Microbiologica Scandinavica, 1965; 64(1):31-49.

19.

, Seligson

, Zhang

, et al. Association of ANRIL polymorphism with overall survival in adult patients with hematologic malignancies after allogeneic hematopoietic stem cell transplantation. Anticancer Res, 2020; 40(10):5707-5713; doi: 10.21873/anticanres.14585

20.

, Yu

, Shen

. ANRIL: A pivotal tumor suppressor long non-coding RNA in human cancers. Tumour Biol, 2016; 37(5):5657-5661; doi: 10.1007/s13277-016-4808-5

21.

Lin

, Gu

, Chen

, et al. Increased expression of the long non-coding RNA ANRIL promotes lung cancer cell metastasis and correlates with poor prognosis. Diagn Pathol, 2015; 10:14; doi: 10.1186/s13000-015-0247-7

22.

Liu

, Chen

, Huang

, et al. Long non-coding RNA ANRIL promotes homologous recombination-mediated DNA repair by maintaining ATR protein stability to enhance cancer resistance. Mol Cancer, 2021; 20(1):94; doi: 10.1186/s12943-021-01382-y

23.

Liu

, Zhao

, Li

, et al. Raman spectroscopy: A novel technology for gastric cancer diagnosis. Front Bioeng Biotechnol, 2022; 10:856591; doi: 10.3389/fbioe.2022.856591

24.

Mangalarapu

, Vinukonda

, Komaravalli

, et al. Association of CDKN2BAS gene polymorphism with periodontitis and coronary artery disease from South Indian population. Gene, 2019; 710:324-332; doi: 10.1016/j.gene.2019.06.002

25.

Maruei-Milan

, Heidari

, Aryan

, et al. Long non-coding RNA ANRIL polymorphisms in papillary thyroid cancer and its severity. Br J Biomed Sci, 2021; 78(2):58-62; doi: 10.1080/09674845.2020.1829853

26.

Mercer

, Dinger

, Mattick

. Long non-coding RNAs: Insights into functions. Nat Rev Genet, 2009; 10(3):155-159.

27.

Meseure

, Vacher

, Alsibai

, et al. Expression of ANRIL-polycomb complexes-CDKN2A/B/ARF genes in breast tumors: Identification of a two-gene (EZH2/CBX7) signature with independent prognostic value. Mol Cancer Res, 2016; 14(7):623-633; doi: 10.1158/1541-7786.MCR-15-0418

28.

Motterle

, Pu

, Wood

, et al. Functional analyses of coronary artery disease associated variation on chromosome 9p21 in vascular smooth muscle cells. Hum Mol Genet, 2012; 21(18):4021-4029; doi: 10.1093/hmg/dds224

29.

Ozturk

, Ada

. The roles of ANRIL polymorphisms in periodontitis: A systematic review and meta-analysis. Clin Oral Investig, 2022; 26(2):1121-1135; doi: 10.1007/s00784-021-04257-0

30.

Pasmant

, Laurendeau

, Heron

, et al. Characterization of a germ-line deletion, including the entire INK4/ARF locus, in a melanoma-neural system tumor family: Identification of ANRIL, an antisense noncoding RNA whose expression coclusters with ARF. Cancer Res, 2007; 67(8):3963-3969; doi: 10.1158/0008-5472.CAN-06-2004

31.

Pasmant

, Sabbagh

, Masliah-Planchon

, et al. NF France Network. Role of noncoding RNA ANRIL in genesis of plexiform neurofibromas in neurofibromatosis type 1. J Natl Cancer Inst, 2011; 103(22):1713-1722; doi: 10.1093/jnci/djr416

32.

Petkevicius

, Streleckiene

, Balciute

, et al. Association of long non-coding RNA Polymorphisms with gastric cancer and atrophic gastritis. Genes (Basel), 2020; 11(12); doi: 10.3390/genes11121505

33.

Phababpha

, Kukongviriyapan

, Pakdeechote

, et al. Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors. Cardiovasc Diabetol, 2013; 12(1):93; doi: 10.1186/1475-2840-12-93

34.

Poi

, Li

, Sborov

, et al. Polymorphism in ANRIL is associated with relapse in patients with multiple myeloma after autologous stem cell transplant. Mol Carcinog, 2017; 56(7):1722-1732.

35.

Royds

, Pilbrow

, Ahn

, et al. The rs11515 polymorphism is more frequent and associated with aggressive breast tumors with increased ANRIL and decreased p16 (INK4a) expression. Front Oncol, 2015; 5:306; doi: 10.3389/fonc.2015.00306

36.

Shakhtshneider

, Orlov

, Semaev

, et al. Analysis of polymorphism rs1333049 (Located at 9P21.3) in the white population of Western Siberia and associations with clinical and biochemical markers. Biomolecules, 2019; 9(7); doi: 10.3390/biom9070290

37.

Smyth

, Nilsson

, Grabsch

, et al. Gastric cancer. Lancet, 2020; 396(10251):635-648.

38.

Taheri

, Pouresmaeili

, Omrani

, et al. Association of ANRIL gene polymorphisms with prostate cancer and benign prostatic hyperplasia in an Iranian population. Biomark Med, 2017; 11(5):413-422; doi: 10.2217/bmm-2016-0378

39.

Tano

, Akimitsu

. Long non-coding RNAs in cancer progression. Front Genet, 2012; 3:219; doi: 10.3389/fgene.2012.00219

40.

Timofeeva

, Sherchkova

, Shkurat

. Polymorphism rs2383207 of CDKN2B-AS and susceptibility to atherosclerosis: A mini review. Noncoding RNA, 2022; 8(6); doi: 10.3390/ncrna8060078

41.

Wan

, Ding

, Chen

, et al. The functional sites of miRNAs and lncRNAs in gastric carcinogenesis. Tumour Biol, 2015; 36(2):521-532; doi: 10.1007/s13277-015-3136-5

42.

Wang

, Dong

, Yang

. ANRIL rs2383207 polymorphism and Coronary Artery Disease (CAD) risk: A meta-analysis with observational studies. Cell Mol Biol (Noisy-le-Grand), 2016; 62(12):6-10; doi: 10.14715/cmb/2016.62.12.2

43.

Xiao

, Ji

, Li

, et al. Application of artificial intelligence in early gastric cancer diagnosis. Digestion, 2022; 103(1):69-75; doi: 10.1159/000519601

44.

, Zeng

, Xu

, et al. Circular RNAs as diagnostic biomarkers for gastric cancer: A comprehensive update from emerging functions to clinical significances. Front Genet, 2022; 13:1037120; doi: 10.3389/fgene.2022.1037120

45.

Yap

, Li

, Munoz-Cabello

, et al. Molecular interplay of the noncoding RNA ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcriptional silencing of INK4a. Mol Cell, 2010; 38(5):662-674; doi: 10.1016/j.molcel.2010.03.021

46.

Zhang

, Kong

, Yin

, et al. Long noncoding RNA ANRIL indicates a poor prognosis of gastric cancer and promotes tumor growth by epigenetically silencing of miR-99a/miR-449a. Oncotarget, 2014; 5(8):2276-2292; doi: 10.18632/oncotarget.1902

47.

Zhao

, Lu

, Yang

, et al. Overexpression of lncRNA ANRIL promoted the proliferation and migration of prostate cancer cells via regulating let-7a/TGF-beta1/Smad signaling pathway. Cancer Biomark, 2018; 21(3):613-620; doi: 10.3233/CBM-170683

48.

Zhu

, Zhu

, Tian

, et al. A functional variant rs1537373 in 9p21.3 region is associated with pancreatic cancer risk. Mol Carcinog, 2019; 58(5):760-766; doi: 10.1002/mc.22968