Preclinical Assessment of Mutant Human TRIM5α as an Anti-HIV-1 Transgene

Abstract

Current HIV-1 gene therapy approaches aim at stopping the viral life cycle at its earliest steps, such as entry or immediate postentry events. Among the most widely adopted strategies are CCR5 downregulation/knockout and the use of broadly neutralizing antibodies. However, the long-term efficacy and side effects are still unclear. TRIM5α is an interferon-stimulated restriction factor that can intercept incoming retroviruses within one hour of cytosolic entry and potently inhibit the infectivity of restriction-sensitive viruses. The human TRIM5α (TRIM5α_hu) generally does not efficiently target HIV-1, but point mutations in its capsid-binding domain can confer anti-HIV-1 activity. Although the mechanisms by which TRIM5α_hu mutants inhibit HIV-1 are relatively well understood, their characterization as potential transgenes for gene therapy is lacking. Additionally, previous reports of general immune activation by overexpression of TRIM5α have hindered its broad adoption as a potential transgene. Here we demonstrate the ability of the R332G-R335G TRIM5α_hu mutant to efficiently restrict highly divergent HIV-1 strains, including Group O, as well as clinical isolates bearing cytotoxic T lymphocyte escape mutations. R332G-R335G TRIM5α_hu efficiently protected human lymphocytes against HIV-1 infection, even when expressed at relatively low levels following lentiviral transduction. Most importantly, under these conditions Rhesus macaque TRIM5α (TRIM5α_Rh) and TRIM5α_hu (wild-type or mutated) had no major effects on the NF-κB pathway. Transgenic TRIM5α did not modulate the kinetics of IκBα, JunB, and TNFAIP3 expression following TNF-α treatment. Finally, we show that human lymphocytes expressing R332G-R335G TRIM5α_hu have clear survival advantages over unmodified parental cells in the presence of pathogenic, replication-competent HIV-1. These results support the relevance of R332G-R335G and other mutants of TRIM5α_hu as candidate effectors for HIV-1 gene therapy.

Introduction

Recent advances in gene therapy have renewed scientists' interest in permanently inhibiting HIV-1 infections. Recent clinical studies have aimed at impeding viral entry by disrupting expression of the coreceptor CCR5 using RNA interference, ribozymes, or direct knockout of the CCR5 locus.^1
–3 Although this strategy is promising for early phases of HIV-1 infection, the common switch to CXCR4 tropism in late/mature HIV-1 infections reduces the effectiveness of CCR5 knockdown.⁴ A logical alternative approach to downregulating expression of a necessary cellular cofactor for HIV-1 replication would be to transduce cells with specialized innate immunity effectors that are natural inhibitors of HIV-1 replication. One such candidate is the retroviral restriction factor TRIM5α, which acts in the immediate postentry, preintegration window.^5,6 TRIM5α and the related TRIMCyp (TRIM5-CypA) bind to the N-terminal domain of the viral capsid proteins (CA-NTD) that form the outer surface of the viral core.^6

–12 This interaction blocks the progression of the viral life cycle at several steps,^{11,13

–20} while also promoting innate immune signaling.^21,22 However, the range of viruses restricted by TRIM5α varies greatly in a species-specific manner. For example, the human ortholog of TRIM5α (TRIM5α_hu) only moderately restricts HIV-1 (<2-fold), whereas its Rhesus monkey counterpart (TRIM5α_Rh) is highly active against HIV-1 (50–100-fold).^5,23,24 Studies have shown that overexpressed TRIM5α_Rh is dominant over the endogenously expressed protein in human hematopoietic progenitor cells and other human cell types, and effectively blocks HIV-1 replication.^5,23,25,26 Therefore, strategies that engineer the anti-HIV-1 properties of TRIM5α_Rh into TRIM5α_hu may be therapeutically valuable.

Replacing regions within the CA-targeting domain, called PRYSPRY, of TRIM5α_hu with the corresponding sequences from its Rhesus ortholog has resulted in human/rhesus chimeric TRIM5α proteins that can efficiently restrict HIV-1 when transduced into human cells.²⁷ Modeling studies and genetic screens have also led to the identification of point mutations in the variable region 1 (v1) of the TRIM5α_hu PRYSPRY domain that allow it to target HIV-1 for restriction.^23,28
–30 We previously described the R332G-R335G TRIM5α_hu mutant as especially efficient at restricting HIV-1. In particular, this double mutant had significantly superior anti-HIV-1 activity compared with the previously described single mutation at position 332.^23,29,31 One major limitation of gene therapy applications is the immune response that often results from introducing foreign proteins into humans.^32
–34 Because the TRIM5α_hu mutants differ only slightly from the endogenous form of TRIM5α_hu, they are not expected to be immunogenic, thus making them strong candidates for gene therapy applications compared with simian orthologs.

Cytotoxic T lymphocyte (CTL) escape mutations often lead to a fitness cost on viral replication.^35

–38 Some mutations occurring in CA increase the virus susceptibility to TRIM5α_hu ³⁹ and may be partially responsible for the control of HIV-1 viremia in HLA B*27 and B*57 individuals.^39,40 It is possible that isolates bearing such CTL-escape mutations might be poorly sensitive to restriction by TRIM5α_hu mutants. Along these lines, it is not known whether HIV-1 strains sharply divergent from the few clade B strains used in the vast majority of TRIM5α studies so far would be restricted by TRIM5α_hu mutants. Other common caveats in TRIM5α preclinical studies include the fact that very strong transgene promoters are frequently employed and that there is often a high number of integration events per cell following retroviral or lentiviral vector-mediated transduction. Finally, activation of the nuclear factor kappa-light-chain-enhancer of activated B-cells (NF-κB)/activator protein-1 (AP-1) pathway can result from TRIM5α overexpression,^21,41,42 leading to challenges in developing TRIM5α for anti-HIV gene therapy. Here we demonstrate the antiviral potential of the R332G-R335G mutant of TRIM5α_hu against highly divergent viral strains as well as CTL-escape capsid mutants. We show that this mutant efficiently inhibits HIV-1 propagation in human lymphocytes following lentiviral transduction of R332G-R335G TRIM5α_hu at a low multiplicity of infection (MOI) and using a relatively weak promoter. Importantly, we show that unlike TRIM5α transfection, stable gammaretroviral vector or lentiviral vector-mediated transduction of R332G-R335G TRIM5α_hu does not activate innate immune pathways. Finally, T lymphocytes stably expressing R332G-R335G TRIM5α_hu possess a survival advantage in the presence of HIV-1 even when the modified cells are present in relatively low numbers.

Materials and Methods

Plasmid DNAs

pMIP-TRIM5α_hu and pMIP-TRIM5α_Rh are gammaretroviral vectors that express C-terminal FLAG-tagged versions of the wild-type (WT) or mutant proteins along with puromycin as a selection marker. These constructs have been described before.^25,43 Versions of these vectors expressing green fluorescent protein (GFP) in place of puromycin were constructed by transferring the TRIM5α sequence into pMIG⁴⁴ using Xho1 and EcoR1. pNL4-3 encodes a fully replication-competent clone of HIV-1.⁴⁵ pCMV-Δ8.91-based gag-pol expressing vectors were a kind gift from Greg Towers and Yasuhiro Ikeda.⁹ pNL4-3XCS-based proviral vectors containing the Renilla luciferase gene in place of nef, which includes a 580 bp deletion in env and code for NL4-3, NRC1, NRC2, or NRC10 gag-pol, were a kind gift from Allan Hance.⁴⁶ pMD-G and pTRIP_CMV-GFP have been described previously.^47,48

To produce lentiviral vectors expressing TRIM5α, we first digested pHIV7⁴⁹ with BamHI and DraII and inserted a multiple cloning site generated by PCR using pHIV7 as the template and the following ODNs: HIV_reinsert_fw (5′-CGCGACTCTAGATCATGGATCCTCCGGACTGCACTCTAGATAGGTCACCACCGTCGACTAGCCGTACCT), and HIV_reinsert_rev (5′-ACTATAGGGCGAATTGGGTACC). The resulting plasmid, called pHIV7-empty, was digested with Kpn2I and Eco91I. A PCR fragment containing the CMV-intron (premiR30)-GFP-partial polyA cassette from pSM30-GFP⁵⁰ was generated with the primers HIV8miR30_fw (5′-TATTCGCACTGGATACGATCCGGATGATTCTGTGGATAACCGT) and HIV8miR30_rev (5′-AATATCCTCCTTAGTTCCGGTGACCTAGAATGCAGTGAAAAAAATG). This fragment was ligated into pHIV7-empty to generate pHIV8-C-A. A codon-optimized 31-amino-acid-long 2A sequence based on Donnelly et al.⁵¹ (now referred to as 2A31D) was inserted between the intron and EGFP coding sequences; 2A31D contains an AgeI site, start codon, flag tag, and two inverted BsmBI sites, to allow flush attachment of an upstream protein to the 2A31D sequence without codon frame change. This was achieved by ligation of overlapping ODNs and subsequent PCR amplification, yielding a double-stranded fragment of the following sequence: 5′-ATCCACCGGTCGCCACCatgGACTACAAGGACGACGATGAGCAGGAGACGGAAGCCACAGACGTCTCCGTGACCGAGCTGCTGTACCGCATGAAGCGCGCCGAGACCTACTGCCCCCGCCCCCTGCTGGCCATCCACCCCACCGAGGCCCGCCACAAGCAGAAGATCGTGGCCCCCGTGAAGCAGACCCTGAACTTCGACCTGCTGAAGCTGGCCGGCGACGTGGAGAGCAACCCCGGCCCCGTGAGCAAGGGCGAGGAGCTGTTCACCGGG. This fragment was then used in a fusion PCR using the reverse primer ODN 2A-EGFP_rev (5′-AAAGTCCCGGACGTAGCCTTCGGGCATGGCGG). The resulting DNA fragment was then digested with AgeI and PfoI and cloned into pHIV8-C-A to generate pHIV8-C-2A31D-A. Subsequently, the CMV promoter driving transgene expression was replaced with the short human EF1α promoter (EFS promoter) with an added MCS region by fusion PCR. For this, we first generated a long reverse primer by fusion PCR, using pHIV8-C-A as a template and the primer ODNs EFS_brdg_(fw 5′-GCCGCCAGAACACAGGTGCATGCTTAATTAAATTTAAATTTAATACTAGAAGCTTTATTGCGGTAGTTTATCAC) and Intron_rev (5′-TTGCTCACCATGGTGGC). This fragment was used as the reverse primer in a fusion PCR using pLV-tTRKRAB⁵² as a template and EFS_fw (5′-ATATATTCCGGAGGCTCCGGTGCCCGT) as the upstream primer. The resulting fragment and pHIV8-C-2A31D-A were digested with Kpn2I and NheI and ligated to generate pHIV8-ES-2A31D-A. Afterward, the woodchuck hepatitis regulatory element (WPRE) was introduced into the 3′ UTR by PCR, using pHIV7-GFP⁴⁹ as a template and the primers wpreO_fw (5′-ATATCGGCCGCATCAAGCTGGGCTGCAGG) and wpreO_rev (5′-TATAGGTGACCATCGATGCGGGGAGGC). The PCR product was digested with BsteII and EagI and ligated to pHIV8-ES-2A31D-A, which had been cut with the same enzymes to generate pHIV8-ES-2A31D-W.

TRIM5α variants were amplified by PCR from the corresponding pMIP constructs, using the primer ODNs 2A-TRIM5a (5′- ATCCACCGGTCGCCACCATGGCTTCTGGAATCCTGG) and 2A-hT5-fus_rev (5′- GCATATTCGGTCACGGAGACGTCTGTGGCTTCCGTCTCTTCACAGAGCTTGGTGAGCACAGAGT) for human variants and 2A-rT5-fus_rev (5′- GCATATTCGGTCACGGAGACGTCTGTGGCTTCCGTCTCTTCACAAAGCTGGGTGAGCACAGAGT) for the rhesus variant. This PCR step also removed the Start codon-FLAG sequence present upstream of TRIM5α in the pMIP constructs. The PCR products were digested with AgeI and BsmBI and cloned into pHIV8-ES-2A31D-W, which had been cut with the same enzymes. The resulting constructs, named pHIV8-ES-T5a(x)-2A31D-W, were used as transgene lentiviral vector plasmids.

Cell lines

Human rhabdomyosarcoma TE671 cells, human embryonic kidney (HEK) 293T cells, and Crandell–Rees feline kidney (CRFK) cells were maintained in Dulbecco's modified Eagle's medium (Gibco) supplemented with 2 mM L-glutamine, 10% fetal bovine serum (Gibco), and 1% penicillin/streptomycin (Thermo Scientific) at 37°C in 5% CO₂. The human T-cell lines Sup-T1 and CEM.NKR-CCR5⁵³ were maintained at a density between 5×10⁵ and 2×10⁶ cells per ml in RPMI (Corning) that was supplemented with 2 mM L-glutamine, 10% fetal bovine serum, and 1% penicillin/streptomycin at 37°C in 5% CO₂. All cell culture reagents were obtained from Hyclone (Thermo Scientific).

Generation of stably transduced cells

TE671 and Sup-T1 cells stably expressing TRIM5α and puromycin N-acetyl-transferase were produced by using pMIP-based retroviral vectors and then maintained in puromycin as described before.^31,54 To generate CEM.NKR-CCR5 cells stably transduced with lentiviral vectors expressing TRIM5α, we produced vector particles as previously described⁴⁹ with the following adjustments. HEK293T cells (20–25 million) were seeded in 150 mm plates in 15 ml of medium. Eighteen hours later, the medium was replaced and cells were then transfected with 35 μg of pCMV-G, 25 μg of pCMV-rev, 25 μg of pCHGP, and 35 μg of the pHIV8-ES-T5a(x)-2A31D-W construct using 374.4 μl of CaCl₂ in 3 ml total volume. Twenty-five hours postseeding, the medium was replaced and virus particles were collected 24 hr later and purified by ultracentrifugation. CEM.NKR-CCR5 cells were transduced at a density of 10⁵ cells per ml in the presence of 8 μg/ml of polybrene (EMD Millipore), using an MOI of 0.5 as determined by titering the concentrated vector on HEK293T cells. GFP-positive cells were sorted by fluorescence-activated cell sorting (FACS) 25 days later, and gag-pol PCR confirmed that the cells did not carry replication-competent HIV-1.

Production of HIV-1 vectors and viruses

HIV-1-based vectors were produced through transient transfection of HEK293T cells and collected as previously described.^29,31,54 To produce Gag variant HIV-1_TRIP-CMV-GFP, the cells were cotransfected with pTRIP_CMV-GFP, the respective pCMV-Δ8.91 vector, and pMD-G. To generate the gag variants of HIV-1_NL-Luc, the cells were cotransfected with the respective pNL4-3XCS vector and pMD-G. HIV-1_NL43 was produced by transfection of pNL4-3. HIV-1 IIIB was amplified by passage in stimulated peripheral blood mononuclear cells and was titered by end-point dilution in MAGI cells, as described before.⁵⁵

Single-cycle infection assays

For viral challenges with HIV-1_TRIP-CMV-GFP, cells were plated in 24-well plates at 50,000 cells per well and infected the next day with the appropriate HIV-1 vectors at an MOI of 0.1, as normalized by titering the viral stocks in feline CRFK cells. Two days postinfection, the cells were trypsinized and fixed in 1–2% formaldehyde in a PBS solution. The percentage of GFP-positive cells was then determined by analyzing 10,000–20,000 cells with an FC500 MPL cytometer (Beckman Coulter) using the CXP software (Beckman Coulter). For viral challenges with HIV-1_NL-Luc, CRFK, and TE671 cells were plated in 24-well plates at 50,000 cells per well and infected the next day with 100 μl of the appropriate HIV-1 vectors, a dose that resulted in measurable luciferase activity in all tested conditions. Two days postinfection, the cells were washed once with PBS and lysed in 100 μl of Glo Lysis Buffer (Promega) following the manufacturer's recommendations. Relative light units were measured using the Renilla-Glo Luciferase Assay System (Promega) according to the manufacturer's instructions and read in a Biotek Synergy HT plate reader.

Replication-competent HIV-1 infection assays and p24 ELISA

In total, 10⁶ CEM.NKR-CCR5 cells were seeded in 1 ml of medium in a 12-well plate and challenged with HIV-1 virus IIIB (NIH AIDS Reagent Program #398; MOI 0.01). After 24 hr, the cells were washed three times with PBS. Subsequently, 0.5–1 ml of the cell suspension was removed every 3 or 4 days and the cell density was readjusted with fresh medium to a volume of 1.5–2 ml. On days 8, 15, and 22, aliquots of the cell suspensions were subjected to low-speed centrifugation (7 min at 250× g) and the supernatants were then used for CAp24 ELISA. CAp24 ELISA was performed using the Alliance kit (Perkin Elmer) according to the manufacturer's instructions. For the experiment with HIV-1 NL4-3, Sup-T1 cells transduced with various pMIG-TRIM5α constructs were infected with 15 μl of virus, a dose previously determined to lead to peak infection in about 12 days.²³ Cells were then maintained in culture at a density between 5×10⁵ and 2×10⁶ cells per ml and aliquots were analyzed by FACS for GFP expression at different time points.

NF-κB stimulation assay

TE671 cells stably expressing FLAG-tagged R332G-R335G TRIM5α_Hu or WT TRIM5α_Rh or transduced with empty vector were plated in 12-well plates at a cell density leading to 80% confluent cells at the time of transfection. TE671 cells stably expressing R332G-R335G TRIM5α_Hu or WT TRIM5α_Rh were transfected with 0.6 μg of the NF-κB luciferase reporter construct (pCEP4-NF-κB-Luc) or the activation-deficient mutant of the reporter construct (pCEP4-ΔNF-κB-Luc). TE671 cells transduced with the empty vector control were cotransfected with R332G-R335G TRIM5α_Hu or WT TRIM5α_Rh (2 μg) and the NF-κB luciferase reporter construct (0.6 μg). As a control, TE671 cells transduced with empty vector were cotransfected with R332G-R335G TRIM5α_Hu (2 μg) and ΔNF-κB-Luc (0.6 μg). The cells were lysed with RIPA buffer 48 hr posttransfection and assessed for luciferase activity using the BrightGlow Luciferase kit (Promega). Luminescence was measured with a Synergy HT multidetection microplate reader (BioTek) and analyzed using the Gen5 software (BioTek). The cellular lysates prepared to quantify luciferase activity were also used to analyze TRIM5α_Rh expression. Specifically, the three lysates from each triplicate transfection were pooled and analyzed by Western blotting using a rabbit anti-FLAG antibody (Cell Signaling; 1: 2000). Actin was used as a loading control and was detected with mouse anti-actin HRP (Sigma; 1:20,000).

Tumor necrosis factor-α stimulation

For IκBα protein kinetics, CEM.NKR-CCR5 cells were collected unstimulated, after stimulation with TNF-α (10 ng/ml; PeproTech, Rocky Hill, NJ) for 30 min and after a drug-free recovery phase of 2 hr. For the analysis of NF-κB- and AP-1-regulated target genes by RT-PCR, cells were collected unstimulated, after stimulation with TNF-α (10 ng/ml) for 4 and 8 hr, and after a recovery phase of 16 hr following 8 hr of TNF-α stimulation.

RT-qPCR

Total RNA from 5×10⁶ CEM.NKR-CCR5 cells was purified using STAT60 (TEL-TEST) according to the manufacturer's protocols and 7 μg of RNA was digested with 1 μl of Turbo DNase in a 25 μl total volume (AM1907; Ambion). Afterward, 2.4 μg of RNA was reverse transcribed in 46 μl (3.26 ng/μl random hexamers, 0.43 mM dNTP, 10 nM DTT, 1.74 U/μl RNAsin, and 8.7 U/μl MMLV-RT [#28025-013, Invitrogen]) for 10 min at 25°C followed by 15 min at 37°C, and the reaction was stopped by heat inactivation for 15 min at 70°C. qPCR was performed in 20 μl with 25 ng cDNA for detection of GAPDH (200 ng for other target genes) with IQ Sybr Green Supermix (170-8882; Biorad) and 0.5 μM of primer pairs. Primer ODN pairs were as follows: human GAPDH, forward (5′-CCACTCCTCCACCTTTGAC) and reverse (5′-ACCCTGTTGCTGTAGCCA); human and rhesus TRIM5α, forward (5′-AGACATTCTGAAAAGCCTTACGAA) and reverse (5′-ATCAGGAGCTCGAAACACTCTC); EGFP, forward (5′-ATCATGGCCGACAAGCAGAAGAAC) and reverse (5′-GTACAGCTCGTCCATGCCGAGAGT)⁵⁶; human FasL, forward (5′-TAAAACCGTTTGCTGGGGC) and reverse (5′-CTCAGCTCCTTTTTTTCAGGGG); JunB, forward (5′-GGACGATCTGCACAAGATGA) and reverse (5′-GGGAGTAGCTGCTGAGGTTG); human TNFAIP3, forward (5′-CCCTCATCGACAGAAACA) and reverse (5′-GAACGCCCCACATGTACT); all were provided by IDT. PCRs were performed in 96-well plates (HSP9601; Biorad) using the following settings: 95°C for 9 min, 40× (30 sec at 95°C, 1 min at 59°C, 30 sec at 72°C), and 72°C for 5 min.

Results

Targeting of highly divergent HIV-1 CA constructs by R332G-R335G TRIM5α_hu

In order to assess the sensitivity of diverse HIV-1 isolates to mutated human TRIM5α, we first generated a series of HIV-1 vectors carrying gag from 12 different strains in an otherwise isogenic context.⁹ The vesicular stomatitis virus G-pseudotyped, GFP-expressing HIV-1 vectors were produced by transient transfection as previously described.^23,54 Strain names, sequence accession numbers, subtypes or clades, and cellular tropism of the HIV-1 isolates used in this study are summarized in Supplementary Table S1 (Supplementary Data are available online at www.liebertpub.com/hum). The panel of HIV-1 isolates used in this study includes representatives of different group M subtypes (B, C, D, and H) and one evolutionary distant strain from group O. Also, some are known to be macrophage-tropic (CCR5-tropic), while others are T-cell-tropic (CXCR4-tropic). Sequence alignments of the isolates show multiple variations in the N-terminal domain of CA, that is, the TRIM5α sensitivity determinant (not shown). In particular, some of the strains present mutations at positions known to modulate HIV-1 sensitivity to either Rhesus or human TRIM5α, such as Val86, Iso91, and Gly116.^31,57,58

To analyze the sensitivity of these gag variants to restriction by either TRIM5α_Rh or R332G-R335G TRIM5α_hu, we stably expressed them in human TE671 cells, whereas cells stably transduced with WT TRIM5α_hu were used as nonrestrictive controls. As shown in Fig. 1A, all viruses tested were susceptible to restriction by both TRIM5α_Rh and R332G-R335G TRIM5α_hu. Although the efficiency of restriction varied slightly from strain to strain, R332G-R335G TRIM5α_hu inhibited all HIV-1 strains by more than 10-fold, with the exception of 93BR029 (3.4-fold). In addition, the pattern of restriction by TRIM5α_Rh was similar to that of R332G-R335G TRIM5α_hu, supporting the idea that they interact with HIV-1 CA in a similar fashion. TRIM5α_Rh-mediated inhibition was only ∼2-times more efficient than the inhibition mediated by R332G-R335G TRIM5α_hu in this assay, demonstrating the potency of the TRIM5α_hu mutant approach.

Figure 1.

Restriction of highly divergent HIV-1 capsids and of cytotoxic T lymphocyte escape mutants in human cells expressing R332G-R335G TRIM5α_hu. (A) TE671 cells were transduced with WT TRIM5α_hu (black bars), R332G-R335G TRIM5α_hu (dark gray bars), or TRIM5α_Rh (light gray bars) expressed from a gammaretroviral vector. Cells were then infected at a single MOI with 12 different GFP-encoding HIV-1 viral vectors. The percentage of infected cells was determined two days postinfection by fluorescence-activated cell sorting. Shown are the mean and standard deviation of three independent infections. (B) TE671 cells expressing the same TRIM5α cDNAs as in (A) were infected with a single dose of the wild-type (WT) or capsid (CA)-mutated HIV-1_NL-Luc vectors. As an additional nonrestrictive control, feline CRFK cells that do not express any TRIM5α were infected with the same amounts of virus (textured black bars). Two days postinfection, cells were lysed and the luciferase activity was measured. Relative light unit (RLU) values in TE671 cells are all normalized relative to the value obtained for the NL-Luc control in the cells expressing WT TRIM5α_hu. Similarly, RLU values in CRFK cells are normalized to the value obtained for NL-Luc in CRFK cells. Shown are the mean and standard deviation of three independent infections for WT TRIM5α_hu (black bars), R332G-R335G TRIM5α_hu (dark gray bars), or TRIM5α_Rh (light gray bars). p-Values were determined by the one-way ANOVA test followed by Turkey's multiple comparison test. ns, nonsignificant; **p<0.01; ***p<0.001; ****p<0.0001.

Restriction of HIV-1 bearing CTL escape mutations

Next we tested NRC1, NRC2, and NRC10 isolates, which bear gag mutations that allow for CTL escape but increase sensitivity to endogenous TRIM5α_hu, for their sensitivity to restriction by the same TRIM5α variants. For this, we used a different set of vectors based on pNL-Luc, a pNL4-3 derivative that contains a deletion in env and encodes Renilla luciferase in place of nef. The gag and protease sequences of pNL-Luc were replaced with sequences from isolates bearing CTL-escape mutations, yielding the constructs NRC1, NRC2, and NRC10.³⁹ It was previously established that, compared with NL-Luc, the increase in sensitivity to TRIM5α_hu was greatest for NRC10, less so for NRC2, and weak for NRC1.³⁹ NRC10-VMG is a lab-generated mutant of NRC10 in which three of the mutations that are known to increase sensitivity to TRIM5α_hu (V86A, M96I, and G116A) are reverted back to the WT sequence. We measured the infectivity of the various HIV-1 vectors generated in both feline CRFK cells, which do not express any known TRIM5α ortholog, and in human TE671 cells transduced with the various TRIM5α cDNAs (Fig. 1B). The data gathered in CRFK cells allow us to quantify the TRIM5α-independent decrease in viral fitness stemming from the CTL-escape mutations in gag. NRC1 and NRC2 showed slightly decreased infectivity in these cells (<2- and ∼2-fold, respectively), whereas infectivity of NRC10 and NRC10-VMG was significantly lower than that of the control NL-Luc (5.5- and 14-fold, respectively). NRC1 had the same restriction pattern as NL4-3, although the former was slightly less sensitive to R332G-R335G TRIM5α_hu.

As previously observed by Battivelli et al.,³⁹ NRC2 and NRC10 showed marked increases in sensitivity to TRIM5α_hu. Specifically, infectivity of NRC2 and NRC10 in TE671 cells expressing TRIM5α_hu was reduced 13-fold and 58-fold, respectively, compared with their respective CRFK controls. Restriction of these two variants by R332G-R335G TRIM5α_hu and TRIM5α_Rh was also efficient. In particular, NRC2 and NRC10 were restricted 30-fold and 125-fold by R332G-R335G TRIM5α_hu, respectively, whereas the NL-Luc control was restricted slightly more than 10-fold. As expected, the NRC10-VMG revertant showed decreased sensitivity to all three TRIM5α variants when compared with NRC10. In summary, some CTL-escape HIV-1 gag mutants are markedly more sensitive to restriction by R332G-R335G TRIM5α_hu than TRIM5α_hu.

Survival advantage of lymphocytes expressing HIV-1-restrictive TRIM5α variants

The previous experiments used replication-incompetent vectors that can only complete the early stages of infection. Typical HIV-1 spreading assays performed in our earlier studies^23,29,31 also do not faithfully represent the situation of in vivo gene therapy protocols, in which only a minority of the cells are protected by the presence of the antiviral transgenes. We designed experimental conditions that allowed a minority of human lymphocytic TRIM5α-expressing Sup-T1 cells to expand because of their resistance to HIV-1-mediated killing. For this experiment, we mixed cells stably expressing various restrictive or nonrestrictive TRIM5α variants with parental cells at an approximate ratio of 1:99 (Table 1). The transduced cells also expressed GFP, allowing for convenient quantification by FACS. We then infected the various cocultures with a single dose of NL4-3⁴⁵ that results in a replication peak at about 2 weeks postinfection as measured by reverse transcriptase assay.²³ For the first two time points at which we performed FACS, the proportion of GFP-positive cells was close to 1% in all cultures, as expected. However, HIV-1 spread very efficiently in all cultures, and there were too few surviving cells for us to perform cytometry between days 11 and 18 postinfection. We nonetheless maintained these cells, and more than a month after the beginning of the experiment, recovery was sufficient for us to analyze the proportion of GFP-expressing cells in all cultures.

Table 1.

Survival advantage of Sup-T1 cells expressing TRIM5α variants following HIV-1 infection

	Days postinfection
Transgene	4	7	11	14	18	33	39
Vector^a	0.8	1.1				<0.1	0.2
TRIM5α_hu WT	0.8	0.8				0.1	<0.1
TRIM5α_hu R332G	1.4	1.3				18.9	24.1
TRIM5α_hu R332G-R335G	0.9	1.3	Very high cell mortality ^b			71.6	64.8
TRIM5α_Rh	0.5	0.5				89.5	86.6

Mixed cultures containing ∼1% of cells transduced with MIG-TRIM5α and 99% of unmodified parental Sup-T1 cells were infected with the pathogenic NL4-3 strain of HIV-1. Cells were maintained in culture for 39 days postinfection, and a fraction of each culture was collected at various times for flow cytometry analysis. Data show the percentage of cells expressing GFP, which is translated from the same mRNA as TRIM5α.

Vector refers to the “empty” MIG expressing only GFP.

Around the peak of HIV-1 propagation, the mortality rate in the various cultures was too high to collect enough cells for flow cytometry analysis.

The results were strikingly different depending on whether the initial mixed culture contained cells expressing HIV-1-restrictive TRIM5α or not. In the nonrestrictive controls, that is, the cells transduced with WT TRIM5α_hu or with the “empty” MIG vector, we could barely detect any cells expressing GFP, showing a total lack of survival advantage of the transduced cells. Although it is not clear how the GFP-negative cells survived the infection in our experiment, such phenomena have been linked to the absence of positive cellular factors such as the transcription factor NF-κB.⁵⁹ In all other cases, the proportion of GFP-expressing cells had markedly increased, ranging from ∼20% (cells expressing R332G TRIM5α_hu) to close to 90% (cells expressing TRIM5α_Rh). In addition, the percentage of GFP-positive cells was proportional to the level of protection conferred by the respective TRIM5α variants: TRIM5α_Rh>R332G-R335G TRIM5α_hu>R332G TRIM5α_hu.^23,29,31 Although the exact proportion of TRIM5α-expressing cells that survived HIV-1 infection in the first 4 weeks of infection is not known, this experiment suggests that R332G-R335G TRIM5α_hu can confer protection not only against HIV-1 infection but also against cytopathic effects stemming from the active spread of the virus in the unmodified cells.

Lack of detectable NF-κB activation in TE671 cells stably expressing TRIM5α

TRIM5α overexpression by transient transfection can activate the transcription factors NF-κB and AP-1,^{21,22,41,42,60} and in some cases results in type I interferon production.^21,60 However, it was not known whether stable overexpression of TRIM5α following retroviral transduction constitutively activates these pathways, which could result in unregulated inflammation. To investigate this possibility, we used cells that were stably transduced with R332G-R335G TRIM5α_hu or TRIM5α_Rh. In parallel, we used control cells, which we transiently transfected with the vector plasmids encoding R332G-R335G TRIM5α_hu or TRIM5α_Rh. To assess NF-κB activation, we transfected the cells with a construct expressing luciferase under the control of an NF-κB-inducible promoter, as described previously.^41,42 Two days posttransfection, luciferase activity and TRIM5α expression levels were assessed (Fig. 2). Basal NF-κB activity was detectable in control cells transfected with the NF-κB-luc construct, as compared with cells transfected with the control plasmid bearing a deletion in the NF-κB binding domain (an ∼3-fold increase). NF-κB activation levels were statistically indistinguishable in cells stably transduced with R332G-R335G TRIM5α_hu or with TRIM5α_Rh compared with the control cells (Fig. 2, top panel). However, when the control cells were transiently transfected with the TRIM5α-expressing retroviral vector plasmids, we observed a large increase (∼10-fold) in NF-κB activation levels. This result suggests that expression of TRIM5α by transient transfection, but not following stable transduction, stimulates NF-κB (see Discussion). Interestingly, levels of TRIM5α expression in the transfected cells were similar to those in the stably transduced cells, as judged in a Western blotting analysis (Fig. 2, bottom panel). It is possible, however, that a minor fraction of the transiently transfected cells express very high levels of TRIM5α, and that NF-κB activation occurs mostly in this subset of cells.

Figure 2.

Activation of the NF-κB pathway by transient transfection of Rhesus or human TRIM5α but not by their stable transduction. TE671 cells stably expressing FLAG-tagged R332G-R335G TRIM5α_hu, WT TRIM5α_Rh, or control cells (CTL) were transfected in triplicate with a plasmid expressing luciferase from an NF-κB-dependent promoter, or with the control plasmid (“ΔNFκB-Luc”) bearing a mutation in the NF-κB binding site. Empty vector-transduced cells were also cotransfected with pMIP plasmids expressing FLAG-tagged TRIM5α_Rh or R332G-R335G TRIM5α_hu. Two days later, cells were lysed and luciferase activity was quantified (top panel). p-Values were determined by the one-way ANOVA test followed by Turkey's multiple comparison test. ns, nonstatistically significant. Lysates were also analyzed by Western blotting using an antibody against FLAG to detect exogenous TRIM5α expression and a loading control antibody against actin (bottom panels).

Stable expression of TRIM5α from a lentiviral vector with predominantly single integration

We next tested the anti-HIV-1 and innate immune activation properties of TRIM5α_hu mutants, using a vector system in which TRIM5α expression is relatively low and cell-to-cell variation is minimal. For this experiment, we designed a lentiviral vector plasmid, pHIV8-ES-2A31D, to express TRIM5α and GFP under control of the short human EF1α promoter. GFP translation was possible because of the presence of a ribosome-skipping 2A domain C-terminal of TRIM5α. We transduced T lymphocytic CEM-based CEM.NKR-CCR5 cells⁵³ with the “empty” lentiviral vector, expressing only GFP, or with a vector that also expresses TRIM5α (Supplementary Fig. S1). In addition to TRIM5α_Rh, WT TRIM5α_hu, and R332G-R335G TRIM5α_hu, we also tested the single mutant R332G TRIM5α_hu in this novel experimental model. To demonstrate comparable transduction and expression rates, GFP fluorescence intensity was analyzed (Supplementary Fig. S1A, B). Results show that transduction levels and GFP expression levels were similar across the various TRIM5α-expressing constructs at both time points tested. Cells transduced with the “empty” vehicle showed higher levels of GFP expression, which is probably because of the smaller size of the GFP-only transgene cassette. In addition, analysis of the GFP expression profiles of the GFP-positive cells after FACS sorting at day 29 postinfection showed the presence of a single peak when cells were transduced with one of the TRIM5α-expressing vectors, suggesting that most cells had only one copy of the integrated vector (Supplementary Fig. S1A).

In contrast, two or more peaks were apparent for cells transduced with the empty vector. Although the basis for this observation is unclear, it is unlikely to result from multiple integration events because less than 5% of the transduced cells were GFP positive (not shown). In order to determine the levels of transgenic TRIM5α expression relative to endogenous TRIM5α_hu, we quantified total TRIM5α mRNA using SybrGreen RT-PCR (Supplementary Fig. S1C, D). The primers used in this experiment can amplify WT or mutant TRIM5α_hu sequences, as well as TRIM5α_Rh (see Materials and Methods). Using this approach, we determined that transduction with the empty vector had no impact on endogenous TRIM5α mRNA expression levels, whereas transduction with the various TRIM5α-expressing vectors resulted in an ∼6-fold to ∼12-fold increase in mRNA levels (Supplementary Fig. S1C, D). It is unclear why about two times less TRIM5α mRNA was detected in cells transduced with R332G-R335G TRIM5α_hu compared with cells transduced with TRIM5α_hu or TRIM5α_Rh (Supplementary Fig. S1D), even though GFP expression levels were similar (Supplementary Fig. S1B). A likely possibility is that the long half-life of GFP⁶¹ masked differences in protein translation levels. The TRIM5α protein, on the other hand, has a notoriously short half-life of about 40 min.⁶² It cannot be excluded, however, that the mutations affected reverse transcription or PCR to some degree, by decreasing access to the random hexamers used in the reverse transcription step or the specific primers used in the PCR step. In addition, mutations in this PRYSPRY region have been shown to modulate protein stability.⁶³ In conclusion, transgenic TRIM5α was moderately overexpressed, consistent with predominantly single integration events in our experimental system, with the R332G-R335G variant possibly being expressed at slightly lower steady-state levels.

TAK1 is not activated in TRIM5α-transduced cells

Loss-of-function experiments have demonstrated that transforming growth factor-activated kinase 1 (TAK1) is important for the activation of NF-κB following overexpression of TRIM5α^21,60 or Bst2/Tetherin,^64,65 or treatment with the proinflammatory cytokine TNF-α.⁶⁶ The TAK1 kinase complex, which comprises TAK1 as well as TAK1-binding proteins 1 and 2 (TAB1 and TAB2), is activated by K63-linked polyubiquitin chains that are catalyzed by the E3 proteins TRAF6⁶⁷ and TRIM5α.^21,41 TAK1 phosphorylates IκB kinase (IKK), which in turn phosphorylates IκBα, leading to NF-κB activation.^67,68 TAK1 is central to many innate immune pathways, including those downstream of innate sensors of the Toll-like receptor (TLR) and retinoic acid-inducible gene 1 (RIG-I) families.⁶⁸ TAK1 stimulatory functions require phosphorylation at Ser412.^69,70 We used Western blotting to analyze the total and Ser412-phosphorylated forms of TAK1 in stably transduced CEM.NKR-CCR5 cells (Fig. 3A). Quantification from three independent experiments showed that stable overexpression of the various TRIM5α variants used did not significantly modulate total levels of TAK1, compared with the untransduced cells (Fig. 3B). Levels of Ser412-phosphorylated TAK1 were slightly higher in cells transduced with WT and R332G TRIM5α_hu, compared with the other cell lines, but this effect did not reach statistical significance (Fig. 3B). In conclusion, the results from this experiment support a model where the levels of TAK1 are unaltered in cells stably overexpressing TRIM5α.

Figure 3.

Stable TRIM5α transduction does not affect TAK1 expression levels or its Ser412 phosphorylation. (A) CEM.NKR-CCR5 cells stably transduced with the indicated TRIM5α variants expressed from the HIV8-ES-2A31D lentiviral vector, or stably transduced with the “empty” vector expressing only GFP (vector) were sorted for GFP expression. After sorting, cells were subjected to Western blotting analysis using antibodies against TAK1 and Ser412-phosphorylated TAK1. Blots were re-analyzed using a GAPDH antibody as a loading control. Untransduced, unsorted parental cells (UT) were used as a control. A representative blot is shown. (B) Gel densitometry analysis. Values obtained were normalized to those for GAPDH and then to the value obtained for untransduced cells for both TAK1 (black bars) and Ser412-phosphorylated TAK1 (gray bars). Shown are means from three independent experiments, with the standard error of the mean (SEM).

No effect of transgenic TRIM5α on IκBα kinetics following TNF-α treatment

Although TRIM5α transduction did not appear to significantly modulate TAK1 activation levels, there was still a possibility that it could modulate the kinetics of the NF-κB/AP-1 pathway. To test this, we treated the various CEM.NKR-CCR5 cell lines with TNF-α and then analyzed kinetics of IκBα and of NF-κB-dependent gene expression. IκBα binds to NF-κB in the cytoplasm, preventing its nuclear translocation and transcriptional activity.⁷¹ TNF-α causes the phosphorylation and degradation of IκBα,⁷² allowing NF-κB to reach the nucleus, where it can potentially activate hundreds of genes.^73,74 Among these are IκBα, leading to a negative feedback loop that contributes to ending the effects of TNF-α.^75,76 By controlling the duration of NF-κB activation, the negative feedback loop indirectly controls NF-κB transcriptional activity profiles as well.^73,77 Therefore, we used an experimental setting that would allow us to study both the activation and recovery phases. We observed that, as expected, TNF-α stimulation resulted in a significant decrease in IκBα levels after 30 min of treatment (Fig. 4A). Upon repeated experiments, we found that stable transduction with WT or mutant TRIM5α_hu or with TRIM5α_Rh expressing transgenes did not alter the capacity of TNF-α to downregulate IκBα expression (Fig. 4B). Gel densitometry analyses showed that, on average, IκBα expression was reduced ∼2-fold as a result of the treatment. After 2 hr of posttreatment recovery, IκBα expression returned to normal or slightly elevated levels. One exception was the untransduced cells, in which IκBα expression was about three times higher compared with pretreatment levels. This result could derive from the fact that IκBα pretreatment levels are higher in cells transduced with the lentiviral vectors used (encoding TRIM5α or not) than in untransduced cells (see Fig. 4A). It is possible that low levels of innate activation are induced by the lentiviral transduction itself, independent of TRIM5α expression.⁷⁸ In conclusion, the downregulation/recovery profiles seen in cells transduced with the various TRIM5α variants were similar to the controls, further supporting the assertion that the TRIM5α variants do not affect NF-κB activation.

Figure 4.

TRIM5α transduction has no significant impact on the kinetics of IκBα protein levels or on the regulation of the AP-1/NF-kB pathway. Sorted, stably transduced CEM.NKR-CCR5 cells expressing the indicated TRIM5α variants or transduced with the vector expressing GFP only (“vector”) were subjected to TNF-α treatment for 30 min. An aliquot of each culture was then lysed for protein analysis, while the remainder was kept in culture for 2 additional hours in the absence of TNF-α. (A) Representative Western blot analyses of IκBα expression levels before stimulation (initial), after TNF-α stimulation (TNFa), and 2 hr after TNF-α removal (recovery). The protein lysates were also analyzed using an antibody against α-tubulin as a loading control. (B) IκBα protein expression levels after normalization to α-tubulin and baseline level. Shown are means from 3–4 independent experiments, with the SEM. UT are untransduced, unsorted control cells. (C, D) RT-qPCR analysis of NF-κB-regulated genes TNFAIP3 (C) and JunB (D). Total mRNAs were prepared at baseline (0 hr), after 4 or 8 hr of TNF-α treatment, and after 8 hr of TNF-α treatment followed by 16 hr in drug-free medium. Gray filled circles, untransfected cells; black filled squares, vector only; gray inverted triangles, R332G-R335G TRIM5α_hu; gray triangles, R332G TRIM5α_hu; black triangles, WT TRIM5α_hu; black unfilled circles, TRIM5α_Rh. Shown are fold changes relative to untransduced cells at baseline and after normalization to values obtained for GAPDH. Shown are the means from three independent experiments with SEM.

No effect of TRIM5α on the kinetics of expression of genes relevant to the NF-κB and AP-1 pathways

Treatment with TNF-α activates the AP-1 transcriptional complex through mechanisms that are both independent of and dependent on NF-κB.⁷⁹ Because TRIM5α overexpression can activate both NF-κB and AP-1,^21,41 we investigated whether stably transduced TRIM5α would modulate TNF-α-induced expression of factors relevant to both pathways. We treated the various CEM.NKR-CCR5 cell lines with TNF-α for 4 or 8 hr and then maintained an aliquot of each culture for 16 additional hours in the absence of the drug. qRT-PCR was performed to analyze mRNA expression levels for tumor necrosis factor, alpha-induced protein 3 (TNFAIP3, also known as A20) (Fig. 4C), and JunB (Fig. 4D). Transcription of TNFAIP3 is stimulated by NF-κB, and TNFAIP3 negatively regulates the NF-κB pathway, by using an IκBα-independent mechanism.⁸⁰ Transcription of JunB, a component found in some AP-1 complexes, is stimulated by both NF-κB and AP-1, and JunB regulates AP-1 activity.^81,82 We observed an ∼2- to ∼2.5-fold increase in TNFAIP3 mRNA levels after 4 or 8 hr of treatment with TNF-α in most cell lines (Fig. 4C). In cells stably expressing R332G-R335G TRIM5α_hu, activation seemed at first glance more efficient than in the cells transduced with the other TRIM5α variants or with the empty vector (Fig. 4C). However, the effects seen with this TRIM5α variant were not significantly different from the results obtained with the other variants. Expression levels returned to normal by 16 hr after the end of TNF-α treatment (Fig. 4C). JunB showed delayed activation kinetics compared with TNFAIP3. In most cell lines analyzed, higher JunB mRNA levels were found after 8 hr in presence of TNF-α but not after 4 hr (Fig. 4D). In some cell lines analyzed, JunB levels were still higher than normal 16 hr after drug withdrawal (Fig. 4D). We observed some variation among the various cell lines tested, but these effects were not statistically significant. Likewise, the JunB activation profiles were similar in cells stably expressing TRIM5α and in untransduced or empty vector-transduced cells (Fig. 4D). In summary, stable transduction with TRIM5α_hu (WT or mutant) or TRIM5α_Rh had no major impact on the capacity of TNF-α to downregulate IκBα or upregulate NF-κB/AP-1-dependent genes.

R332G-R335G TRIM5α_hu strongly restricts HIV-1 IIIB spreading in CEM.NKR-CCR5 cells

Finally, we analyzed how efficiently R332G-R335G TRIM5α_hu inhibits HIV-1 over multiple rounds of replication. For this, we infected the various CEM.NKR-CCR5 lines generated with IIIB, a highly pathogenic strain of HIV-1.⁸³ p24 CA in supernatants was quantified by ELISA at days 8, 15, and 22 postinfection (Fig. 5). As expected, the HIV-1 levels in control, empty vector-transduced cells increased markedly between days 8 and 15, and then between days 15 and 22. Signs of cell death were visible at day 15 and most cells were dead at day 22 (not shown). Compared with these control cells, transduction of WT TRIM5α_hu had no effect on HIV-1 propagation, as expected. At all three time points, HIV-1 amounts in the supernatants of cells overexpressing WT TRIM5α_hu were similar to the control cells, or even higher (Fig. 5). Transduction of R332G TRIM5α_hu decreased HIV-1 replication levels by approximately 10-fold, as seen on days 8 and 15. However, HIV-1 spread efficiently in these cells; by day 22, most cells had died and the amount of virus detected in the supernatants was similar to that of the control. In contrast, cells stably expressing R332G-R335G TRIM5α_hu or TRIM5α_Rh were highly resistant to the spreading of HIV-1 infection. At all time points analyzed, CAp24 levels were lower by several orders of magnitude in these two cell lines, compared with the empty vector-transduced cells or compared with the cells stably transduced with WT TRIM5α_hu (Fig. 5). Interestingly, CAp24 levels were highest at day 15 for R332G-R335G TRIM5α_hu, and then decreased by day 22. This opens the possibility that virus replication was slowed by R332G-R335G TRIM5α_hu, allowing uninfected cells to outgrow infected cells. In summary, R332G-R335G TRIM5α_hu and TRIM5α_Rh but not R332G TRIM5α_hu very efficiently restricted the spreading of HIV-1 infection in CEM cells.

Figure 5.

Different TRIM5α variants show markedly different potency of HIV-1 restriction in propagation assays. CEM.NKR-CCR5 cells stably transduced with the indicated TRIM5α variants, or transduced with the empty parental vector as a control (vector), and sorted for GFP expression, were infected with HIV-1 IIIB (MOI 0.01). CAp24 ELISA was performed on supernatants at days 8, 15, and 22. Shown are relative p24 amounts in 2–3 independent experiments, normalized to the value obtained for the vector control at day 8 (×100).

Discussion

Currently, there is only one proven long-term effective treatment against HIV infection. This functional cure is achieved through gene therapy, more precisely through replacement of the WT HIV-1 coreceptor CCR5 with a naturally occurring deletion.⁸⁴ Although CCR5 loss-of-function approaches are promising because of the stable endogenous sequence, the virus usually exhibits a switch from CCR5 affinity early in the infection to CXCR4 in the late or mature phase of infection.⁴ The possible use of CXCR4 deletion to overcome the therapeutic obstacle has been studied.⁸⁵ However, unlike CCR5, CXCR4 is crucial for several immune functions that have no redundant mechanisms.⁸⁶ Other common attempts to inhibit HIV-1 via gene therapy have included combinatorial vectors that aim at the virus through RNAi, ribozymes, or other approaches.^87,88 Although RNAi is highly potent, it usually acts at the late stages of the infection, cannot completely prevent viral release, and is often rendered inefficient by mutational escape of the virus.^89,90 Approaches that also use initial cellular entry restriction have therefore become very interesting to the HIV-1 gene therapy community. Although overexpression of peptides that block virus fusion via interaction with the gp41 pocket has been proposed,^91,92 mutational escape can occur as well^93,94 and the immunogenicity of gp41-derived peptides remains to be tested. Restriction factors such as TRIM5α are thought to play important roles in protecting against nonhost retroviruses and limiting cross-species transmission.^95

–98 We and others have previously shown that point mutations in the PRYSPRY domain of the human TRIM5α protein can increase restriction of lab-adapted HIV-1 viral strains.^{23,28,30,99,100} Because those constructs differ only slightly from their endogenous counterpart, they would probably not be immunogenic, thus making them interesting candidates for therapeutic treatment of HIV-1. However, it was not yet known whether these TRIM5α mutants would target CA from clinical isolates of HIV-1. Our results show that all strains from a diverse panel of HIV-1 variants are potently restricted by R332G-R335G TRIM5α_hu and by TRIM5α_rh.

CTL escape mutations were previously shown to increase sensitivity to TRIM5α_hu.^39,46 Specifically, mutations in the NRC10 strain affect the CypA-binding loop of CA (V86A and M96I), which is known to play an important role in TRIM5α-mediated restriction.^{20,101
–103} In addition, the residue at position 86 was already shown to play a crucial role in the sensitivity to both TRIM5α_Rh ^57,58 and TRIM5α_hu mutants.³¹ Our results show that the effects of CTL escape mutations on TRIM5α sensitivity can also be extended to a more restrictive human TRIM5α variant like R332G-R335G. This suggests that the highly restrictive TRIM5α variants used in gene therapy applications could help control the rate at which CTL escape mutations appear, and make it more difficult for the virus to escape both host immune responses and transgene-mediated inhibition at the same time.

Unregulated immune activation by transgenic, overexpressed TRIM5α was, potentially, a major impediment to the development of TRIM5α_hu mutants as anti-HIV-1 transgenes. This concern was first raised several years ago, when it was demonstrated that transfecting TRIM5α could activate NF-κB and AP-1 through the activation of TAK1 and the generation of K63-linked ubiquitin chains.^21,41,42,60 Most of these previous experiments were done by transfecting HEK293 cells, however. Here we confirm that NF-κB can be activated by transfecting TRIM5α into TE671 cells as well. Importantly however, we could not detect any NF-κB activation in these cells when TRIM5α was expressed through stable gammaretroviral vector-mediated transduction rather than through transient transfection. NF-κB activation in transient transfection conditions might result from very high levels of TRIM5α expression in a fraction of the cells. In addition, DNA transfection itself causes an innate immune response mediated by IFI16 and NF-κB.^104,105 Furthermore, stable lentiviral vector-mediated transduction of TRIM5α in lymphocytes did not lead to any major change in TAK1 activation or in the dynamics of the NF-κB pathway following TNF-α treatment. Altogether, our results strongly suggest that stable transduction of TRIM5α does not activate or modulate this immunity pathway. Pertel et al. also reported that NF-κB could be activated upon interaction between TRIM5α and an incoming restriction-sensitive virus.²¹ Although we have not attempted to reproduce this observation in this study, it should be pointed out that this effect, if present, would contribute to the specific (virus-triggered) TRIM5α antiviral activity and thus would be desirable.

R332G-R335G TRIM5α_hu was significantly more efficient than the single mutant R332G at inhibiting HIV-1 spreading infection and at increasing the survival of gene-modified cells. These results confirm our previously published data obtained in single-cycle infection experiments using HIV-1 vectors^23,29,31 or in spreading infection of a different HIV-1 strain (NL4-3) in a different T-cell line (Sup-T1).^23,31 Collectively, our data also show that, in lymphocytes, R332G-R335G TRIM5α_hu restricts HIV-1 about as efficiently as TRIM5α_Rh does. We also note that, the two mutations being located close to one another, it should be feasible to introduce them both simultaneously into the human genome, through the use of recently developed genome-editing methods such as those based on clustered regularly interspersed, short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (CRISPR-Cas9).^106,107

Footnotes

Acknowledgments

We thank Greg Towers (University College London, UK), Yasuhiro Ikeda (Mayo Clinic, MN), and Allan Hance (INSERM, Paris, France) for sharing plasmids. We are also grateful to Haitang Li and Kathleen Riopel for technical help, and to Mélodie B. Plourde and Natacha Mérindol for helping with redaction of the article. The following reagents were obtained through the NIH AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: CEM.NKR-CCR5 (cat # 4376, contributed by Alexandra Trkola) and HIV-1 IIIB (cat # 398, contributed by Robert Gallo). This work was supported by the Canadian Institutes of Health Research Operating grant MOP-102712 (L.B.), National Institutes of Health grant 5R1A1042552 (J.J.R.), and California Institute of Regenerative Medicine grant TB1-01176 (J.J.R.). M.V. was supported by an FRQS Master's Training Award.

Author Disclosure

Lionel Berthoux and Quang Toan Pham are co-owners of a U.S. patent (8,623,815 B2) covering antiviral applications of TRIM5α_hu Arg335 mutations. No competing financial interests exist for the other authors.

References

Holt

, Wang

, Kim

, et al. Human hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5 control HIV-1 in vivo . Nat Biotechnol, 2010; 28:839–847.

Tebas

, Stein

, Tang

, et al. Gene editing of CCR5 in autologous CD4 T cells of persons infected with HIV. N Engl J Med, 2014; 370:901–910.

Chung

, Rossi

, Jung

. Current progress and challenges in HIV gene therapy. Future Virol, 2011; 6:1319–1328.

Esbjornsson

, Mansson

, Martinez-Arias

, et al. Frequent CXCR4 tropism of HIV-1 subtype a and CRF02_AG during late-stage disease—indication of an evolving epidemic in West Africa. Retrovirology, 2010; 7:23.

Stremlau

, Owens

, Perron

, et al. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature, 2004; 427:848–853.

Owens

, Yang

, Gottlinger

, et al. Human and simian immunodeficiency virus capsid proteins are major viral determinants of early, postentry replication blocks in simian cells. J Virol, 2003; 77:726–731.

Cowan

, Hatziioannou

, Cunningham

, et al. Cellular inhibitors with Fv1-like activity restrict human and simian immunodeficiency virus tropism. Proc Natl Acad Sci USA, 2002; 99:11914–11919.

Forshey

, Shi

, Aiken

. Structural requirements for recognition of the human immunodeficiency virus type 1 core during host restriction in owl monkey cells. J Virol, 2005; 79:869–875.

Ikeda

, Ylinen

, Kahar-Bador

, et al. Influence of gag on human immunodeficiency virus type 1 species-specific tropism. J Virol, 2004; 78:11816–11822.

10.

Shi

, Aiken

. Saturation of TRIM5 alpha-mediated restriction of HIV-1 infection depends on the stability of the incoming viral capsid. Virology, 2006; 350:493–500.

11.

Stremlau

, Perron

, Lee

, et al. Specific recognition and accelerated uncoating of retroviral capsids by the TRIM5alpha restriction factor. Proc Natl Acad Sci USA, 2006; 103:5514–5519.

12.

Perez-Caballero

, Hatziioannou

, Zhang

, et al. Restriction of human immunodeficiency virus type 1 by TRIM-CypA occurs with rapid kinetics and independently of cytoplasmic bodies, ubiquitin, and proteasome activity. J Virol, 2005; 79:15567–15572.

13.

Campbell

, Perez

, Anderson

, et al. Visualization of a proteasome-independent intermediate during restriction of HIV-1 by rhesus TRIM5alpha. J Cell Biol, 2008; 180:549–561.

14.

Black

, Aiken

. TRIM5alpha disrupts the structure of assembled HIV-1 capsid complexes in vitro . J Virol, 2010; 84:6564–6569.

15.

Perron

, Stremlau

, Lee

, et al. The human TRIM5alpha restriction factor mediates accelerated uncoating of the N-tropic murine leukemia virus capsid. J Virol, 2007; 81:2138–2148.

16.

Zhao

, Ke

, Vu

, et al. Rhesus TRIM5α disrupts the HIV-1 capsid at the inter-hexamer interfaces. PLoS Pathog, 2011; 7:e1002009.

17.

Anderson

, Campbell

, Wu

, et al. Proteasome inhibition reveals that a functional preintegration complex intermediate can be generated during restriction by diverse TRIM5 proteins. J Virol, 2006; 80:9754–9760.

18.

Diaz-Griffero

, Li

, Javanbakht

, et al. Rapid turnover and polyubiquitylation of the retroviral restriction factor TRIM5. Virology, 2006; 349:300–315.

19.

Rold

, Aiken

. Proteasomal degradation of TRIM5alpha during retrovirus restriction. PLoS Pathog, 2008; 4:e1000074.

20.

Berthoux

, Sebastian

, Sokolskaja

, et al. Lv1 inhibition of human immunodeficiency virus type 1 is counteracted by factors that stimulate synthesis or nuclear translocation of viral cDNA. J Virol, 2004; 78:11739–11750.

21.

Pertel

, Hausmann

, Morger

, et al. TRIM5 is an innate immune sensor for the retrovirus capsid lattice. Nature, 2011; 472:361–365.

22.

Tareen

, Emerman

. TRIM5 takes on pattern recognition. Cell Host Microbe, 2011; 9:349–350.

23.

Pham

, Bouchard

, Grutter

, et al. Generation of human TRIM5alpha mutants with high HIV-1 restriction activity. Gene Ther, 2010; 17:859–871.

24.

Yap

, Nisole

, Lynch

, et al. TRIM5alpha protein restricts both HIV-1 and murine leukemia virus. Proc Natl Acad Sci USA, 2004; 101:10786–10791.

25.

Berthoux

, Sebastian

, Sayah

, et al. Disruption of human TRIM5alpha antiviral activity by nonhuman primate orthologues. J Virol, 2005; 79:7883–7888.

26.

Anderson

, Akkina

. TRIM5alpha(rh) expression restricts HIV-1 infection in lentiviral vector-transduced CD34(+)-cell-derived macrophages. Mol Ther, 2005; 12:687–696.

27.

Kambal

, Mitchell

, Cary

, et al. Generation of HIV-1 resistant and functional macrophages from hematopoietic stem cell-derived induced pluripotent stem cells. Mol Ther, 2011; 19:584–593.

28.

Yap

, Nisole

, Stoye

. A single amino acid change in the SPRY domain of human Trim5alpha leads to HIV-1 restriction. Curr Biol, 2005; 15:73–78.

29.

Pham

, Veillette

, Brandariz-Nunez

, et al. A novel aminoacid determinant of HIV-1 restriction in the TRIM5α variable 1 region isolated in a random mutagenic screen. Virus Res, 2013; 173:306–314.

30.

, Li

, Stremlau

, et al. Removal of arginine 332 allows human TRIM5alpha to bind human immunodeficiency virus capsids and to restrict infection. J Virol, 2006; 80:6738–6744.

31.

Veillette

, Bichel

, Pawlica

, et al. The V86m mutation in HIV-1 capsid confers resistance to TRIM5α by abrogation of cyclophilin A-dependent restriction and enhancement of viral nuclear import. Retrovirology, 2013; 10:25.

32.

Lamers

, Willemsen

, Van Elzakker

, et al. Immune responses to transgene and retroviral vector in patients treated with ex vivo-engineered T cells. Blood, 2011; 117:72–82.

33.

Tripathy

, Black

, Goldwasser

, et al. Immune responses to transgene-encoded proteins limit the stability of gene expression after injection of replication-defective adenovirus vectors. Nat Med, 1996; 2:545–550.

34.

Yin

, Takahashi

, Ebisuura

, et al. Removal of transgene-expressing cells by a specific immune response induced by sustained transgene expression. J Gene Med, 2014; 16:97–106.

35.

Troyer

, Mcnevin

, Liu

, et al. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog, 2009; 5:e1000365.

36.

Friedrich

, Dodds

, Yant

, et al. Reversion of CTL escape-variant immunodeficiency viruses in vivo . Nat Med, 2004; 10:275–281.

37.

Liu

, Mcnevin

, Zhao

, et al. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol, 2007; 81:12179–12188.

38.

Martinez-Picado

, Prado

, Fry

, et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol, 2006; 80:3617–3623.

39.

Battivelli

, Migraine

, Lecossier

, et al. Gag cytotoxic T lymphocyte escape mutations can increase sensitivity of HIV-1 to human TRIM5alpha, linking intrinsic and acquired immunity. J Virol, 2011; 85:11846–11854.

40.

Granier

, Battivelli

, Lecuroux

, et al. Pressure from TRIM5α contributes to control of HIV-1 replication by individuals expressing protective HLA-B alleles. J Virol, 2013; 87:10368–10380.

41.

Nepveu-Traversy

, Berthoux

. The conserved sumoylation consensus site in TRIM5α modulates its immune activation functions. Virus Res, 2014; 184:30–38.

42.

Tareen

, Emerman

. Human Trim5α has additional activities that are uncoupled from retroviral capsid recognition. Virology, 2011; 409:113–120.

43.

Sebastian

, Sokolskaja

, Luban

. Arsenic counteracts human immunodeficiency virus type 1 restriction by various TRIM5 orthologues in a cell type-dependent manner. J Virol, 2006; 80:2051–2054.

44.

Van Parijs

, Refaeli

, Lord

, et al. Uncoupling IL-2 signals that regulate T cell proliferation, survival, and Fas-mediated activation-induced cell death. Immunity, 1999; 11:281–288.

45.

Adachi

, Gendelman

, Koenig

, et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J Virol, 1986; 59:284–291.

46.

Battivelli

, Lecossier

, Matsuoka

, et al. Strain-specific differences in the impact of human TRIM5alpha, different TRIM5alpha alleles, and the inhibition of capsid-cyclophilin A interactions on the infectivity of HIV-1. J Virol, 2010; 84:11010–11019.

47.

Zennou

, Petit

, Guetard

, et al. HIV-1 genome nuclear import is mediated by a central DNA flap. Cell, 2000; 101:173–185.

48.

Zufferey

, Nagy

, Mandel

, et al. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo . Nat Biotechnol, 1997; 15:871–875.

49.

, Bauer

, Michienzi

, et al. Inhibition of HIV-1 infection by lentiviral vectors expressing Pol III-promoted anti-HIV RNAs. Mol Ther, 2003; 8:196–206.

50.

, Yonekubo

, Zeng

, et al. Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J, 2006; 273:5421–5427.

51.

Donnelly

, Hughes

, Luke

, et al. The ‘cleavage’ activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring ‘2A-like’ sequences. J Gen Virol, 2001; 82:1027–1041.

52.

Wiznerowicz

, Trono

. Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference. J Virol, 2003; 77:8957–8961.

53.

Trkola

, Matthews

, Gordon

, et al. A cell line-based neutralization assay for primary human immunodeficiency virus type 1 isolates that use either the CCR5 or the CXCR4 coreceptor. J Virol, 1999; 73:8966–8974.

54.

Bérubé

, Bouchard

, Berthoux

Both TRIM5alpha and TRIMCyp have only weak antiviral activity in canine D17 cells. Retrovirology, 2007; 4:68.

55.

Kimpton

, Emerman

. Detection of replication-competent and pseudotyped human immunodeficiency virus with a sensitive cell line on the basis of activation of an integrated beta-galactosidase gene. J Virol, 1992; 66:2232–2239.

56.

Godbey

, Zhang

, Chang

. The importance of and a method for including transfection efficiency into real-time PCR data analyses. Biotechnol Bioeng, 2008; 100:765–772.

57.

Pacheco

, Finzi

, Stremlau

, et al. Adaptation of HIV-1 to cells expressing rhesus monkey TRIM5α. Virology, 2010; 408:204–212.

58.

Soll

, Wilson

, Kutluay

, et al. Assisted evolution enables HIV-1 to overcome a high TRIM5α-imposed genetic barrier to rhesus macaque tropism. PLoS Pathog, 2013; 9:e1003667.

59.

Qian

, Bours

, Manischewitz

, et al. Chemically selected subclones of the CEM cell line demonstrate resistance to HIV-1 infection resulting from a selective loss of NF-kappa B DNA binding proteins. J Immunol, 1994; 152:4183–4191.

60.

Uchil

, Hinz

, Siegel

, et al. TRIM protein-mediated regulation of inflammatory and innate immune signaling and its association with antiretroviral activity. J Virol, 2013; 87:257–272.

61.

Corish

, Tyler-Smith

. Attenuation of green fluorescent protein half-life in mammalian cells. Protein Eng, 1999; 12:1035–1040.

62.

Diaz-Griffero

, Kar

, Perron

, et al. Modulation of retroviral restriction and proteasome inhibitor-resistant turnover by changes in the TRIM5alpha B-box 2 domain. J Virol, 2007; 81:10362–10378.

63.

Richardson

, Guo

, Xin

, et al. Stabilized human TRIM5α protects human T cells from HIV-1 infection. Mol Ther, 2014; 22:1084–1095.

64.

Galao

, Le Tortorec

, Pickering

, et al. Innate sensing of HIV-1 assembly by tetherin induces NFκB-dependent proinflammatory responses. Cell Host Microbe, 2012; 12:633–644.

65.

Tokarev

, Suarez

, Kwan

, et al. Stimulation of NF-κB activity by the HIV restriction factor BST2. J Virol, 2013; 87:2046–2057.

66.

Hofer-Warbinek

, Schmid

, Stehlik

, et al. Activation of NF-kappa B by XIAP, the X chromosome-linked inhibitor of apoptosis, in endothelial cells involves TAK1. J Biol Chem, 2000; 275:22064–22068.

67.

Wang

, Deng

, Hong

, et al. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature, 2001; 412:346–351.

68.

Chen

. Ubiquitination in signaling to and activation of IKK. Immunol Rev, 2012; 246:95–106.

69.

, Ouyang

, Lin

, et al. Phosphatase holoenzyme PP1/GADD34 negatively regulates TLR response by inhibiting TAK1 serine 412 phosphorylation. J Immunol, 2014; 192:2846–2856.

70.

Kobayashi

, Mizoguchi

, Take

, et al. Prostaglandin E2 enhances osteoclastic differentiation of precursor cells through protein kinase A-dependent phosphorylation of TAK1. J Biol Chem, 2005; 280:11395–11403.

71.

Scott

, Fujita

, Liou

, et al. The p65 subunit of NF-kappa B regulates I kappa B by two distinct mechanisms. Genes Dev, 1993; 7:1266–1276.

72.

Hoffmann

, Baltimore

. Circuitry of nuclear factor kappaB signaling. Immunol Rev, 2006; 210:171–186.

73.

Tian

, Nowak

, Brasier

. A TNF-induced gene expression program under oscillatory NF-kappaB control. BMC Genomics, 2005; 6:137.

74.

Pahl

. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene, 1999; 18:6853–6866.

75.

Hoffmann

, Levchenko

, Scott

, et al. The IkappaB-NF-kappaB signaling module: temporal control and selective gene activation. Science, 2002; 298:1241–1245.

76.

Werner

, Kearns

, Zadorozhnaya

, et al. Encoding NF-kappaB temporal control in response to TNF: distinct roles for the negative regulators IkappaBalpha and A20. Genes Dev, 2008; 22:2093–2101.

77.

Saccani

, Pantano

, Natoli

. Two waves of nuclear factor kappaB recruitment to target promoters. J Exp Med, 2001; 193:1351–1359.

78.

Rossetti

, Gregori

, Hauben

, et al. HIV-1-derived lentiviral vectors directly activate plasmacytoid dendritic cells, which in turn induce the maturation of myeloid dendritic cells. Hum Gene Ther, 2011; 22:177–188.

79.

Fujioka

, Niu

, Schmidt

, et al. NF-kappaB and AP-1 connection: mechanism of NF-kappaB-dependent regulation of AP-1 activity. Mol Cell Biol, 2004; 24:7806–7819.

80.

Heyninck

, De Valck

, Vanden Berghe

, et al. The zinc finger protein A20 inhibits TNF-induced NF-kappaB-dependent gene expression by interfering with an RIP- or TRAF2-mediated transactivation signal and directly binds to a novel NF-kappaB-inhibiting protein ABIN. J Cell Biol, 1999; 145:1471–1482.

81.

Schutte

, Viallet

, Nau

, et al. jun-B inhibits and c-fos stimulates the transforming and trans-activating activities of c-jun. Cell, 1989; 59:987–997.

82.

Shaulian

, Karin

. AP-1 in cell proliferation and survival. Oncogene, 2001; 20:2390–2400.

83.

Popovic

, Sarngadharan

, Read

, et al. Detection, isolation, and continuous production of cytopathic retroviruses (HTLV-III) from patients with AIDS and pre-AIDS. Science, 1984; 224:497–500.

84.

Hutter

, Nowak

, Mossner

, et al. Long-term control of HIV by CCR5 Delta32/Delta32 stem-cell transplantation. N Engl J Med, 2009; 360:692–698.

85.

Wilen

, Wang

, Tilton

, et al. Engineering HIV-resistant human CD4+ T cells with CXCR4-specific zinc-finger nucleases. PLoS Pathog, 2011; 7:e1002020.

86.

Vagima

, Lapid

, Kollet

, et al. Pathways implicated in stem cell migration: the SDF-1/CXCR4 axis. Methods Mol Biol, 2011; 750:277–289.

87.

Anderson

, Li

, Palmer

, et al. Safety and efficacy of a lentiviral vector containing three anti-HIV genes—CCR5 ribozyme, tat-rev siRNA, and TAR decoy—in SCID-hu mouse-derived T cells. Mol Ther, 2007; 15:1182–1188.

88.

Ter Brake

, Berkhout

. Lentiviral vectors that carry anti-HIV shRNAs: problems and solutions. J Gene Med, 2007; 9:743–750.

89.

Boden

, Pusch

, Lee

, et al. Human immunodeficiency virus type 1 escape from RNA interference. J Virol, 2003; 77:11531–11535.

90.

Berkhout

, Das

. HIV-1 escape from RNAi antivirals: yet another Houdini action?. Mol Ther Nucleic Acids, 2012; 1:e26.

91.

Eckert

, Malashkevich

, Hong

, et al. Inhibiting HIV-1 entry: discovery of D-peptide inhibitors that target the gp41 coiled-coil pocket. Cell, 1999; 99:103–115.

92.

Egelhofer

, Brandenburg

, Martinius

, et al. Inhibition of human immunodeficiency virus type 1 entry in cells expressing gp41-derived peptides. J Virol, 2004; 78:568–575.

93.

Hermann

, Egerer

, Brauer

, et al. Mutations in gp120 contribute to the resistance of human immunodeficiency virus type 1 to membrane-anchored C-peptide maC46. J Virol, 2009; 83:4844–4853.

94.

, Lu

, Cai

, et al. Mutations of Gln64 in the HIV-1 gp41 N-terminal heptad repeat render viruses resistant to peptide HIV fusion inhibitors targeting the gp41 pocket. J Virol, 2012; 86:589–593.

95.

Cullen

. Role and mechanism of action of the APOBEC3 family of antiretroviral resistance factors. J Virol, 2006; 80:1067–1076.

96.

Mariani

, Chen

, Schrofelbauer

, et al. Species-specific exclusion of APOBEC3g from HIV-1 virions by Vif. Cell, 2003; 114:21–31.

97.

Kirmaier

, Wu

, Newman

, et al. TRIM5 suppresses cross-species transmission of a primate immunodeficiency virus and selects for emergence of resistant variants in the new species. PLoS Biol, 2010; 8:e1000462.

98.

Hatziioannou

, Cowan

, Bieniasz

. Capsid-dependent and -independent postentry restriction of primate lentivirus tropism in rodent cells. J Virol, 2004; 78:1006–1011.

99.

Stremlau

, Perron

, Welikala

, et al. Species-specific variation in the B30.2(SPRY) domain of TRIM5alpha determines the potency of human immunodeficiency virus restriction. J Virol, 2005; 79:3139–3145.

100.

Maillard

, Reynard

, Serhan

, et al. Interfering residues narrow the spectrum of MLV restriction by human TRIM5alpha. PLoS Pathog, 2007; 3:e200.

101.

Berthoux

, Sebastian

, Sokolskaja

, et al. Cyclophilin A is required for TRIM5{alpha}-mediated resistance to HIV-1 in Old World monkey cells. Proc Natl Acad Sci USA, 2005; 102:14849–14853.

102.

Keckesova

, Ylinen

, Towers

. Cyclophilin A renders human immunodeficiency virus type 1 sensitive to Old World monkey but not human TRIM5 alpha antiviral activity. J Virol, 2006; 80:4683–4690.

103.

Stremlau

, Song

, Javanbakht

, et al. Cyclophilin A: an auxiliary but not necessary cofactor for TRIM5alpha restriction of HIV-1. Virology, 2006; 351:112–120.

104.

Orzalli

, Conwell

, Berrios

, et al. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA. Proc Natl Acad Sci USA, 2013; 110:E4492–E4501.

105.

Caposio

, Gugliesi

, Zannetti

, et al. A novel role of the interferon-inducible protein IFI16 as inducer of proinflammatory molecules in endothelial cells. J Biol Chem, 2007; 282:33515–33529.

106.

Hsu

, Lander

, Zhang

. Development and applications of CRISPR-Cas9 for genome engineering. Cell, 2014; 157:1262–1278.

107.

Yin

, Xue

, Chen

, et al. Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nat Biotechnol, 2014; 32:551–553.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

1.05 MB

Preclinical Assessment of Mutant Human TRIM5α as an Anti-HIV-1 Transgene

Abstract

Introduction

Materials and Methods

Plasmid DNAs

Cell lines

Generation of stably transduced cells

Production of HIV-1 vectors and viruses

Single-cycle infection assays

Replication-competent HIV-1 infection assays and p24 ELISA

NF-κB stimulation assay

Tumor necrosis factor-α stimulation

RT-qPCR

Results

Targeting of highly divergent HIV-1 CA constructs by R332G-R335G TRIM5αhu

Restriction of HIV-1 bearing CTL escape mutations

Survival advantage of lymphocytes expressing HIV-1-restrictive TRIM5α variants

Lack of detectable NF-κB activation in TE671 cells stably expressing TRIM5α

Stable expression of TRIM5α from a lentiviral vector with predominantly single integration

TAK1 is not activated in TRIM5α-transduced cells

No effect of transgenic TRIM5α on IκBα kinetics following TNF-α treatment

No effect of TRIM5α on the kinetics of expression of genes relevant to the NF-κB and AP-1 pathways

R332G-R335G TRIM5αhu strongly restricts HIV-1 IIIB spreading in CEM.NKR-CCR5 cells

Discussion

Footnotes

Acknowledgments

Author Disclosure

References

Supplementary Material

Targeting of highly divergent HIV-1 CA constructs by R332G-R335G TRIM5α_hu

R332G-R335G TRIM5α_hu strongly restricts HIV-1 IIIB spreading in CEM.NKR-CCR5 cells