Suppression of the Production of Transforming Growth Factor β1,Interleukin-10,and Vascular Endothelial Growth Factor in the B16F10 Cells by Ganoderma lucidum Polysaccharides

Abstract

Transforming growth factor β (TGF-β), interleukin-10 (IL-10), and vascular endothelial growth factor (VEGF) are three of the commonly studied cytokines playing an important role in tumor initiation and progression. Besides their promotional effects on tumor progression, the three cytokines have immunosuppressive effects that facilitate tumor initiation and progression as well. Ganoderma lucidum polysaccharides (Gl-PS) with multiple bioactivities may have the effect on B16F10 melanoma cells to induce stronger antitumor immune response that has been demonstrated. Gl-PS may have the suppressive effects on the production of these three cytokines, which has yet to be demonstrated. In this study, we tested these effects of Gl-PS by incubating Gl-PS with malignant tumor cells such as B16F10 cells, a melanoma cell line, and LA795 cells, a lung carcinoma cell line. RT-qPCR and enzyme-linked immunosorbent assay showed that the production of TGF-β1, IL-10, and VEGF in B16F10 melanoma cells and LA795 lung carcinoma cells was suppressed by Gl-PS at both mRNA and protein levels, suggesting that the suppression on production of TGF-β, IL-10, and VEGF in B16F10 melanoma cells and LA795 lung carcinoma cells by Gl-PS may contribute to the therapy on melanoma and lung carcinoma along with the induction of stronger antitumor immune response.

Introduction

Cancer is the second leading cause of death in the world after cardiovascular diseases (Di Domenico and others 2011). To understand the causes of cancer, many factors are currently studied (Drabsch ten Dijke 2011), including lifestyle, environmental, genetic, and biological factors. Among them, three of the commonly studied cytokines produced by cancer cells, transforming growth factor β (TGF-β), interleukin-10 (IL-10), and vascular endothelial growth factor (VEGF), play an important role in tumor initiation and progression. Besides the direct promotional effects on tumor progression, the three cytokines have immunosuppressive effects that facilitate tumor initiation and progression as well (Frumento and others 2006). The immunosuppression induced by tumor cells may play an important role in tumor evasion from the attack of the immune system in the host although the host immune system has the potential to control tumor initiation and progression (Whiteside 2006). Suppression on the production of the three cytokines in tumor cells may contribute to tumor control. We suppose that Ganoderma lucidum polysaccharides (Gl-PS), besides its multiple bioactivities that have been demonstrated (Lin 2005), may possess the effects to suppress the production of the three cytokines in tumor cells.

G. lucidum (Fr.) Krast (Ganodermataceae) is a well-known medicinal mushroom widely used for centuries in China to promote longevity and improve vigor without significant adverse effects (Chan and others 2008). The Gl-PS is one of the main effective components isolated from G. lucidum (Fr.) Krast (Ganodermataceae). As with many natural products with immunomodulatory and antitumor effects (Selvaduray and others 2010; Geldenhuys and others 2011; Kour and others 2011; Mishra and others 2011; M Ller and others 2011; Murphy and others 2011, 2012; Manca and others 2012), Gl-PS has been extensively studied in recent decades. It has been demonstrated that Gl-PS has various biological activities, including immunomodulatory and antitumor effects (Cao and Lin 2002, 2003; Lin and Zhang 2004; Zhu and Lin 2005; Zhu and others 2007; Li and others 2008; Sun and others 2011). It is widely believed that the antitumor effects of Gl-PS are primarily achieved by boosting host immune function (Lin 2005; Lin and Zhang 2004).

Besides, Gl-PS may also act on tumor cells to improve the antitumor immunity. Our previous studies demonstrated that Gl-PS promoted B16F10 cells to activate lymphocytes (Sun and others 2011b) and induced stronger cytotoxicity in CTLs with granzyme B and porforin by acting on B16F10 cells (Sun and others 2012a), while the enhanced MHC class I and costimulatory molecules on B16F10 cells (Sun and others 2012b) and the antagonism against the suppression on lymphocytes as well as macrophages caused by culture supernatants of B16F10 melanoma cells (Sun and others 2011c, 2013; Lu and others 2013) may partially explain the promoting effects of Gl-PS on B16F10 cells to activate lymphocytes and induce stronger cytotoxicity in CTLs. Considering that the TGF-β, IL-10, and VEGF have immunosuppressive activity, we hypothesize that Gl-PS may also suppress the production of TGF-β, IL-10, and VEGF in the B16F10 cells, which has yet to be demonstrated. The present study was designed to detect the suppressive effects of Gl-PS on the production of TGF-β, IL-10, and VEGF in the B16F10 cells.

Materials and Methods

Preparation of Gl-PS

The preparation of Gl-PS was described previously (Sun and others 2011c). After isolation from a boiling water extract of Gl, ethanol precipitation, dialysis, and Sevag deproteination were processed for Gl-PS preparation. The prepared Gl-PS was a polysaccharide peptide with a molecular weight of 584,900, and the ratio of polysaccharides-to-peptides was 93.51:6.49. The D-rhamnose, D-xylose, D-fructose, D-galactose, D-mannose, and D-glucose were contained in the polysaccharides, with a molar ratio of 0.793:0.964:2.944:0.167:0.389:7.94, and linked together by β-glycosidic linkages. The peptides consisted of 16 kinds of amino acids. The Gl-PS was dissolved in serum-free RPMI-1640 medium (Gibco BRL, Gaithersburg, MD), then filtered through a 0.22-μm filter, and stored at 4°C. Gl-PS was further diluted to the indicated final concentration (0.2, 0.8, 3.2, or 12.8 μg/mL), and fetal bovine serum (FBS) was supplemented to 10% of the final concentration before each assay.

Cell culture

Mouse B16F10 melanoma cells (H-2^b) were grown at 37°C in a humidified atmosphere containing 5% CO₂ in RPMI 1640 medium supplemented with 10% FBS, penicillin (100 IU/mL), and streptomycin (100 μg/mL). After 4 h of culture for adherence, B16F10 cells in 6-well culture plates (2×10⁵ cells/well at the start) were treated with Gl-PS by replacement of the medium with a medium containing Gl-PS in the indicated concentration and cultured for a further 48 h. RPMI 1640 medium instead of Gl-PS was used as a control. To identify that the effects of Gl-PS are not unique to B16F10 cells but more general findings, another carcinoma cell line, LA795 mouse lung carcinoma cell line, was used to detect the production of the three cytokines with enzyme-linked immunosorbent assay (ELISA). The LA795 cells were placed into 96-well culture plates (1×10⁵ cells/well at the start) and the Gl-PS was supplemented in indicated final concentrations. The LA795 cells were cultured for 48 h and then the culture supernatants were collected for ELISA.

Enzyme-linked immunosorbent assay

ELISA was also performed for its more quantitative potential. It was performed with ELISA kits (NeoBioscience, Shenzhen, China) according to the manufacturer's instructions. In brief, microtiter plates were, respectively, coated with specific antibodies to capture TGF-β1, IL-10, or VEGF in the cell culture supernatants of B16F10 or LA795 cells. A second-layer antibody was then added. Cytokine concentrations were determined with a standard curve derived from known amounts of the relevant cytokine using absorbance readings at 450 nm on a spectrophotometer (Bio-Rad, Hercules, CA). To improve the reliability, the experiments for ELISA, identical to RT-qPCR, were performed three separate times with three paralleled wells in each time, and the means of the three paralleled wells in each separate ELISA were calculated, respectively. The data from the three separate assays were collected together for statistical analysis.

RT-qPCR analysis for determination of gene-specific mRNA expression

Total RNA was extracted from Gl-PS-treated B16F10 cells using the TriZol reagent (Invitrogen, Carlsbad, CA). Isolated RNA (5 μg) was reverse transcribed (RT) into cDNA using M-MLV First strand kit (Invitrogen). Q-PCR (Real-Time PCR) was performed using TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) on SLAN Real-Time PCR Detection System (Shanghai Hongshi Medical Technology Co., Ltd, Shanghai, China). The PCR primer sequences used were as follows: TGF-β1, forward 5′- CCTGAGTGGCTGTCTTTTGAC -3′ and reverse 5′- GTGGAGTTTGTTATCTTTGCTGTC -3′; IL-10, forward 5′- GGGAAGAGAAACCAGGGAGAT -3′ and reverse 5′- TGCTACAAAGGCAGACAAACAA -3′; VEGF, forward 5′- AGTCTGTGCTCTGGGATTTGAT -3′ and reverse 5′- GCTCTTGATACCTCTTTCGTCTG -3′; β-actin, forward 5′- AAGCCCTGGATGAAGAAACAG -3′ and reverse 5′- TGGGAACCAATCTCGTAGTGTC -3′. The expression of β-actin was used as a control for normalizing mRNA expression results. Reactions were carried out on the Real-Time PCR detection system and were subjected to initial 30-s denaturation at 94°C followed by 45 cycles at 94°C for 5 s and 51°C for 20 s as well as 72°C for 10 s for detection of TGF-β1 mRNA in B16F10 cells or 30-s denaturation at 94°C followed by 45 cycles at 94°C for 5 s and 52°C for 20 s as well as 72°C for 10 s for detection of TGF-β1 mRNA in LA795 cells, and 30-s denaturation at 94°C followed by 45 cycles at 94°C for 5 s and 50°C for 20 s as well as 72°C for 10 s for detection of IL-10 mRNA in both cells, as well as 30-s denaturation at 94°C followed by 45 cycles at 94°C for 5 s and 53°C for 20 s as well as 72°C for 10 s for detection of VEGF mRNA in both cells. When calculating for ΔCt values, geometric means of Ct values of the reference genes were used. To improve the reliability as well, the data from the RT-qPCR assays were collected and calculated identically to ELISA for statistical analysis.

Statistical analysis

The results are expressed as the mean (±SD) of the three-time experiments, and statistical comparison between the experimental groups versus the control was performed using one-way ANOVA followed by the Dunnett t-test. P<0.05 was considered statistically significant.

Results

Suppression of Gl-PS on the production of TGF-β in B16F10 cells

TGF-β plays a crucial role in the progression of cancer as well as in immunosuppression. The RT-qPCR revealed that the level of TGF-β mRNA in B16F10 cells was statistically suppressed by Gl-PS in the concentrations of 0.2, 0.8, 3.2, and 12.8 μg/mL when compared with the control (all P<0.05; Fig. 1A). The ELISA showed that the TGF-β peptide was suppressed statistically by Gl-PS in the concentrations of 0.2, 0.8, 3.2 and 12.8 μg/mL as well when compared with the control (all P<0.05; Fig. 2A).

FIG. 1.

The mRNA of TGF-β1, IL-10, and VEGF in B16F10 cells treated with Gl-PS. B16F10 cells were incubated with Gl-PS for 48 h in three separate tests, and the mRNA extracted from the B16F10 cells with TRIzol reagent was tested with real-time RT-PCR (RT-qPCR) assay. Error bars indicate standard deviation of the mean. Asterisks indicate Dunnett t-test P<0.05 compared with the control after one-way ANOVA. (A) The TGF-β1 mRNA in B16F10 cells. (B) The IL-10 mRNA in B16F10 cells. (C) The VEGF mRNA in B16F10 cells. Gl-PS, Ganoderma lucidum polysaccharides; IL-10, interleukin-10; TGF-β1, transforming growth factor β; VEGF, vascular endothelial growth factor.

FIG. 2.

The level of TGF-β1, IL-10, and VEGF in B16F10 cell culture supernatant (B16F10-CS) treated with Gl-PS. B16F10 cells were incubated with Gl-PS for 48 h in three separate tests, and the B16F10-CS was tested with ELISA. Error bars indicate standard deviation of the mean. Asterisks indicate Dunnett t-test P<0.05 compared with the control after one-way ANOVA. (A) The level of TGF-β1 in B16F10-CS. (B) The level of IL-10 in B16F10-CS. (C) The level of VEGF in B16F10-CS. ELISA, enzyme-linked immunosorbent assay.

Suppression of Gl-PS on the production of IL-10 in B16F10 cells

IL-10 is a multifunctional anti-inflammatory cytokine that downregulates cell-mediated immune responses and cytotoxic inflammatory responses, and therefore may play a crucial role in the immunosuppression that facilitates cancer progression. It was shown that the level of IL-10 mRNA in B16F10 cells was suppressed by Gl-PS in the concentrations of 0.8, 3.2, and 12.8 μg/mL with statistical significance according to RT-qPCR assay (all P<0.05; Fig. 1B), while the ELISA showed that the IL-10 protein was suppressed statistically by Gl-PS in the concentrations of 0.8, 3.2, and 12.8 μg/mL when compared with the control (P<0.05; Fig. 2B) as well.

Suppression of Gl-PS on the production of VEGF in B16F10 cells

VEGF is a cytokine closely associated with cancer progression as well. The level of VEGF mRNA in B16F10 cells was suppressed by Gl-PS in the concentrations of 0.2, 0.8, 3.2, and 12.8 μg/mL with statistical significance according to RT-qPCR assay (P<0.05; Fig. 1C), while the ELISA showed that the VEGF protein was suppressed statistically by Gl-PS in the concentrations of 0.8, 3.2, and 12.8 μg/mL when compared with the control (P<0.05; Fig. 2C).

Effects of glycogen type II on the production of the cytokines in B16F10 cells

Considering that the effects of Gl-PS could be because of nonspecific actions of polysaccharides in general when applied to cells in culture at these concentrations, we also studied the effects of glycogen type II (Sigma, St. Louis, MO) (in the identical concentration with Gl-PS) on the production of the three cytokines in B16F10 cells with RT-qPCR and ELISA. There was no statistical suppression on the production of the three cytokines by glycogen type II (Figs. 3 and 4), which was different from Gl-PS, for which all of the three cytokines were suppressed, indicating that different polysaccharides had different effects other than nonspecific actions of polysaccharides in general.

FIG. 3.

The mRNA of TGF-β1, IL-10, and VEGF in B16F10 cells treated with glycogen type II. B16F10 cells were incubated with glycogen type II for 48 h in three separate tests, and the mRNA extracted from the B16F10 cells with TRIzol reagent was tested with RT-qPCR assay. Error bars indicate standard deviation of the mean. There was no statistical significance according to Dunnett t-test (P<0.05) compared with the control after one-way ANOVA. (A) The TGF-β1 mRNA in B16F10 cells. (B) The IL-10 mRNA in B16F10 cells. (C) The VEGF mRNA in B16F10 cells.

FIG. 4.

The level of TGF-β1, IL-10, and VEGF in B16F10 cell culture supernatant (B16F10-CS) treated with glycogen type II. B16F10 cells were incubated with glycogen type II for 48 h in three separate tests, and the B16F10-CS was tested with ELISA. Error bars indicate standard deviation of the mean. There was no statistical significance according to Dunnett t-test (P<0.05) compared with the control after one-way ANOVA. (A) The level of TGF-β1 in B16F10-CS. (B) The level of IL-10 in B16F10-CS. (C) The level of VEGF in B16F10-CS.

Effects of Gl-PS on the production of the cytokines in LA795 cells

To identify that the effects of Gl-PS on the production of the three cytokines are more general findings instead of unique to B16F10 cells only, another cancer cell line, LA795 mouse lung carcinoma cell line, was used for RT-qPCR and ELISA. The results similar to Gl-PS were shown (Figs. 5 and 6), indicating the more general findings instead of unique to B16F10 cells.

FIG. 5.

The mRNA of TGF-β1, IL-10, and VEGF in LA795 cells treated with Gl-PS. LA795 cells were incubated with Gl-PS for 48 h in three separate tests, and the mRNA extracted from the LA795 cells with TRIzol reagent was tested with RT-qPCR assay. Error bars indicate standard deviation of the mean. Asterisks indicate Dunnett t-test P<0.05 compared with the control after one-way ANOVA. (A) The TGF-β1 mRNA in LA795 cells. (B) The IL-10 mRNA in LA795 cells. (C) The VEGF mRNA in LA795 cells.

FIG. 6.

The level of TGF-β1, IL-10, and VEGF in LA795 cell culture supernatant (LA795-CS) treated with Gl-PS. LA795 cells were incubated with Gl-PS for 48 h in three separate tests, and the LA795-CS was tested with ELISA. Error bars indicate standard deviation of the mean. Asterisks indicate Dunnett t-test P<0.05 compared with the control after one-way ANOVA. (A) The level of TGF-β1 in LA795-CS. (B) The level of IL-10 in LA795-CS. (C) The level of VEGF in LA795-CS.

Effects of glycogen type II on the production of the cytokines in LA795 cells

To identify that the effects of glycogen type II on the production of the three cytokines in LA795 cells similar to B16F10 cells, in which no suppression on the production of the three cytokines by glycogen type II was shown, glycogen type II was used on LA795 cells for RT-qPCR and ELISA. The results similar to B16F10 cells were shown (data not shown), indicating that besides the B16F10 cells, there was no suppression by glycogen type II on the production of the three cytokines in LA795 cells as well.

Discussion

Although the immune system is capable of mounting immune responses to cancer, it is not always effective in preventing and/or controlling tumor growth. The mechanisms of tumor escaping from immune recognition/destruction are likely to be multifactorial (Ahmad and others 2004). The blockage or inhibition of the host's immune response may partially consist of the evasion mechanisms. The immune suppression occurs with tumor immune tolerance at both a molecular and cellular level gradually and locally, then progresses, and finally spreads to the whole organism (Zou 2005). TGF-β, IL-10, and VEGF are three of the commonly studied cytokines produced by cancer cells and account for part of the immunosuppressive strategies in cancer (Evans and others 2006).

The TGF-β family of cytokines encompasses a number of versatile polypeptide growth factors regulating a multitude of cellular processes in almost every aspect of cellular function, including proliferation, differentiation, apoptosis, migration and adhesion, and inappropriate signaling by these factors, therefore, is closely linked to cancer and other diseases (Zhang 2011). Although the promoter regions of genes encoding three mammalian TGF-β (TGF-β1, 2, 3) show little similarity in sequence, their protein products are functionally very similar (Kaminska and others 2005). TGF-β supports tumor progression (Drabsch ten Dijke 2011) by stimulating the transdifferentiation of epithelial cancer cells into migratory mesenchymal cells (Miyazono 2009), by promoting cell invasion, and dissemination to distant sites (Massagué 2008), enhancing angiogenesis (ten Dijke and others 2008), and mediating immune evasion of tumor cells (Flavell and others 2010). Two distinct effects of TGF-β to ultimately favor tumor progression are inhibition of T-cell proliferation and repression of the cytotoxic gene program in T cells (Thomas and Massagué 2005). TGF-β represses transcription of genes encoding multiple key proteins, such as perforin, granzymes, and cytotoxins, resulting in marked and direct suppression on the cytotoxicity of CTLs (Thomas and Massagué 2005; Trapani 2005). T-cell-specific blockade of TGF-β signaling leads to the generation of tumor-specific CTLs capable of eradicating tumors in mice challenged with EL-4 thymoma or B16-F10 melanoma tumor cells (Gorelik and Flavell 2001). Therefore, suppression on the TGF-β production in tumor cells may inhibit its promotional effects on tumor progression and suppressive effects on immune responses against tumor, facilitating inhibition of tumor progression. In this study, the level of TGF-β1 mRNA as well as the TGF-β1 peptide in B16F10 cells was suppressed by Gl-PS, implying the effects of Gl-PS to control tumor progression in this way.

IL-10 is an important tumor-growth-favorable and immunoregulatory cytokine produced by many cell populations. Many malignant diseases overexpress IL-10, including basal cell and squamous carcinoma (Kim and others 1995), colorectal cancer (Ordemann and others 2002), renal cell carcinoma (Wittke and others 1999), and melanoma (Nemunaitis and others 2001). IL-10 can favor tumor growth in vitro by stimulating cell proliferation and inhibiting cell apoptosis (Alas and others 2001; Sredni and others 2004). High systemic levels of IL-10 correlate with poor clinical outcome of some cancer patients (Chau and others 2000; Nemunaitis and others 2001). IL-10 is first recognized for its ability to inhibit activation and effector function of T cells, monocytes, and macrophages (Moore and others 2001), and the main biological function of IL-10 seems to be the limitation and termination of inflammatory responses and the regulation of differentiation and proliferation of several immune cells such as T cells, B cells, natural killer cells, antigen-presenting cells, mast cells, and granulocytes (Asadullah and others 2003). IL-10 inhibits T cell proliferation and cytokine production as well as monocyte/macrophage costimulatory molecule expression (de Waal Malefyt and others 1991), and facilitates induction of type 1 regulatory T cells, which suppress immune responses in vivo and in vitro (Gregori and others 2010). Taken together, as an immunomodulatory cytokine that is frequently upregulated in various types of cancer, with the effect that directly affects the function of antigen-presenting cells by inhibiting the expression of MHC and costimulatory molecules, downregulates the expression of Th1 cytokines, and induces T-regulatory responses, which in turn induces immune suppression or tolerance, the presence of IL-10 in advanced metastases and the positive correlation between serum IL-10 levels and progression of disease indicates a critical role of IL-10 in the tumor progression (Sato and others 2011). Therefore, suppression on IL-10 production may be a logical approach to enhance an antitumor immune response. In this study, the Gl-PS showed the suppressive effects on IL-10 mRNA transcription and the IL-10 production in certain concentrations, implying the benefit for cancer control.

VEGF is another important cytokine that plays an important role in endothelial cell proliferation and the process of angiogenesis, which are essential for tumor development (Fidler 1991). Besides its important role as pivotal angiogenic factors for tumor vascularization that is important for invasion and metastasis of tumor, VEGF also induces immune suppression as well (reviewed in Evans and others 2006). VEGF inhibits DC maturation (Oyama and others 1998) and function (Laxmanan and others 2005), induces DC apoptosis, and alters DC immunophenotypic profile (Della Porta and others 2005). It interferes with the development of T cells from early hematopoietic progenitor cells (Ohm and others 2003), correlates with reduced levels of the antitumor cytokine IL-12 (Lissoni and others 2001), and is associated with an increase in the production of immature myeloid cells (Gabrilovich and others 1999). In combination with chemotherapy, Bevacizumab, a humanized monoclonal antibody that inhibits VEGF, can now be used as a first-line therapy for the treatment of patients with metastatic colorectal cancer (Ellis 2005) as it improves survival (Mulcahy and Benson 2005). Its antitumor activity is most likely because of its antiangiogenesis effect (Wang and others 2004); however, exposure to anti-VEGF blocking antibodies reverses the inhibitory effect on DC, improving both their function and numbers (Gabrilovich and others 1999; Della Porta and others 2005). In this study, the VEGF mRNA transcription and the VEGF production were suppressed by Gl-PS in certain concentrations, implying its benefit for cancer control as well.

It has not been found what level of Gl-PS in patients ingesting this mushroom may be reached. In this study, the concentrations of Gl-PS in cell culture model were chosen according to some of the previous studies in which the same concentrations were used (Cao and Lin 2002, 2003). In addition, there are studies using the Gl-PS concentrations within or over this study in vitro that showed bioactivity similar to the study in vivo, implying that the concentration used in this study may be achieved in the body by administration in vivo (Zhang and Lin 2004; Chen and others 2011).

Although a study using tissue culture model such as this study is useful and beneficial to improve the scientific knowledge and may encourage relevant research for practice, many additional relevant studies such as the in vivo studies, including clinical trials, and pharmacokinetic studies, in which whether the levels of Gl-PS in patients ingesting these mushroom reach the concentrations that were used to treat these cultured cells will be revealed, are important and valuable, which may be performed in the future.

Footnotes

Acknowledgment

The authors thank Prof. Shuqian Lin of the Fuzhou Institute of Green Valley Bio-Pharm Technology for providing the Gl-PS.

Author Disclosure Statement

The authors declare that they have no conflicts of interest to disclose.

References

Ahmad

, Rees

, Ali

. 2004. Escape from immunotherapy: possible mechanisms that influence tumor regression/progression. Cancer Immunol Immunother, 53(10):844–854.

Alas

, Emmanouilides

, Bonavida

. 2001. Inhibition of interleukin 10 by rituximab results in down-regulation of bcl-2 and sensitization of B-cell non-Hodgkin's lymphoma to apoptosis. Clin Cancer Res, 7(3):709–723.

Asadullah

, Sterry

, Volk

. 2003. Interleukin-10 therapy—review of a new approach. Pharmacol Rev, 55(2):241–269.

Cao

, Lin

. 2002. Regulation on maturation and function of dendritic cells by Ganoderma lucidum polysaccharides. Immunol Lett, 83(3):163–169.

Cao

, Lin

. 2003. Regulatory effect of Ganoderma lucidum polysaccharides on cytotoxic T-lymphocytes induced by dendritic cells in vitro . Acta Pharmacol Sin, 24(4):321–326.

Chan

, Cheung

, Law

, Lau

, Chan

. 2008. Ganoderma lucidum polysaccharides can induce human monocytic leukemia cells into dendritic cells with immuno-stimulatory function. J Hematol Oncol, 1:9.

Chau

, Wu

, Lui

, Chang

, Kao

, Wu

, King

, Loong

, Hsia

, Chi

. 2000. Serum interleukin-10 but not interleukin-6 is related to clinical outcome in patients with resectable hepatocellular carcinoma. Ann Surg, 231(4):552–558.

Chen

, Lin

, Li

. 2011. Ganoderma lucidum polysaccharides reduce methotrexate-induced small intestinal damage in mice via induction of epithelial cell proliferation and migration. Acta Pharmacol Sin, 32(12):1505–1512.

Della Porta

, Danova

, Rigolin

, Brugnatelli

, Rovati

, Tronconi

, Fraulini

, Russo Rossi

, Riccardi

, Castoldi

. 2005. Dendritic cells and vascular endothelial growth factor in colorectal cancer: correlations with clinicobiological findings. Oncology, 68(2–3):276–284.

10.

de Waal Malefyt

, Haanen

, Spits

, Roncarolo

, te Velde

, Figdor

, Johnson

, Kastelein

, Yssel

, de Vries

. 1991. Interleukin 10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. J Exp Med, 174(4):915–924.

11.

Di Domenico

, Ricciardi

, Fusco

, Pierantoni

. 2011. Anti-VEGF therapy in breast and lung mouse models of cancers. J Biomed Biotechnol, 2011:947928.

12.

Drabsch

, ten Dijke

. 2011. TGF-β signaling in breast cancer cell invasion and bone metastasis. J Mammary Gland Biol Neoplasia, 16(2):97–108.

13.

Ellis

. 2005. Bevacizumab. Nat Rev Drug Discov Suppl:S8–S9.

14.

Evans

, Dalgleish

, Kumar

. 2006. Review article: immune suppression and colorectal cancer. Aliment Pharmacol Ther, 24(8):1163–1177.

15.

Fidler

. 1991. Cancer metastasis. Br Med Bull, 47(1):157–177.

16.

Flavell

, Sanjabi

, Wrzesinski

, Licona-Limón

. 2010. The polarization of immune cells in the tumour environment by TGFbeta. Nat Rev Immunol, 10(8):554–567.

17.

Frumento

, Piazza

, Di Carlo

, Ferrini

. 2006. Targeting tumor-related immunosuppression for cancer immunotherapy. Endocr Metab Immune Disord Drug Targets, 6(3):233–237.

18.

Gabrilovich

, Ishida

, Nadaf

, Ohm

, Carbone

. 1999. Antibodies to vascular endothelial growth factor enhance the efficacy of cancer immunotherapy by improving endogenous dendritic cell function. Clin Cancer Res, 5(10):2963–2970.

19.

Geldenhuys

, Mbimba

, Bui

, Harrison

, Sutariya

. 2011. Brain-targeted delivery of paclitaxel using glutathione-coated nanoparticles for brain cancers. J Drug Target, 19(9):837–845.

20.

Gorelik

, Flavell

. 2001. Immune-mediated eradication of tumors through the blockade of transforming growth factor-beta signaling in T cells. Nat Med, 7(10):1118–1122.

21.

Gregori

, Tomasoni

, Pacciani

, Scirpoli

, Battaglia

, Magnani

, Hauben

, Roncarolo

. 2010. Differentiation of type 1 T regulatory cells (Tr1) by tolerogenic DC-10 requires the IL-10-dependent ILT4/HLA-G pathway. Blood, 116(6):935–944.

22.

Kaminska

, Wesolowska

, Danilkiewicz

. 2005. TGF beta signalling and its role in tumour pathogenesis. Acta Biochim Pol, 52(2):329–337.

23.

Kim

, Modlin

, Moy

, Dubinett

, McHugh

, Nickoloff

, Uyemura

. 1995. IL-10 production in cutaneous basal and squamous cell carcinomas. A mechanism for evading the local T cell immune response. J Immunol, 155(4):2240–2247.

24.

Kour

, Sangwan

, Khan

, Koul

, Sharma

, Kitchlu

, Bani

. 2011. Alcoholic extract of Cicer microphyllum augments Th1 immune response in normal and chronically stressed Swiss albino mice. J Pharm Pharmacol, 63:267–277.

25.

Laxmanan

, Robertson

, Wang

, Lau

, Briscoe

, Mukhopadhyay

. 2005. Vascular endothelial growth factor impairs the functional ability of dendritic cells through Id pathways. Biochem Biophys Res Commun, 334(1):193–198.

26.

, Zhang

, Wei

, Liu

, Lin

. 2008. Reversal effect of Ganoderma lucidum polysaccharide on multidrug resistance in K562/ADM cell line. Acta Pharmacol Sin, 29(5):620–627.

27.

Lin

. 2005. Cellular and molecular mechanisms of immuno-modulation by Ganoderma lucidum . J Pharmacol Sci, 99(2):144–153.

28.

Lin

, Zhang

. 2004. Anti-tumor and immunoregulatory activities of Ganoderma lucidum and its possible mechanisms. Acta Pharmacol Sin, 25(11):1387–1395.

29.

Lissoni

, Malugani

, Bonfanti

, Bucovec

, Secondino

, Brivio

, Ferrari-Bravo

, Ferrante

, Vigoré

, Rovelli

, Mandalà

, Viviani

, Fumagalli

, Gardani

. 2001. Abnormally enhanced blood concentrations of vascular endothelial growth factor (VEGF) in metastatic cancer patients and their relation to circulating dendritic cells, IL-12 and endothelin-1. J Biol Regul Homeost Agents, 15(2):140–144.

30.

, Sun

, Lin

, Duan

, Ge

, Xing

, Lan

, Yang

, Li

. 2014. Antagonism by Ganoderma lucidum polysaccharides against the suppression by culture supernatants of B16F10 melanoma cells on macrophage. Phytother Res, 28(2):200–206.

31.

Manca

, Peixoto

, Malaga

, Guilhot

, Kaplan

. 2012. Modulation of the cytokine response in human monocytes by mycobacterium leprae phenolic glycolipid-1. J Interferon Cytokine Res, 32(1):27–33.

32.

Massagué

. 2008. TGFbeta in cancer. Cell, 134(2):215–230.

33.

Mishra

, Tiwari

, Vaidya

, Agrawal

, Vyas

. 2011. Lectin anchored PLGA nanoparticles for oral mucosal immunization against hepatitis B. J Drug Target, 19:67–78.

34.

Miyazono

. 2009. Transforming growth factor-beta signaling in epithelial-mesenchymal transition and progression of cancer. Proc Jpn Acad Ser B Phys Biol Sci, 85(8):314–323.

35.

Møller

, Fink

, Sangild

, Fr Ki

. 2011. Colostrum and amniotic fluid from different species exhibit similar immunomodulating effects in bacterium-stimulated dendritic cells. J Interferon Cytokine Res, 31(11):813–823.

36.

Moore

, de Waal Malefyt

, Coffman

, O'Garra

. 2001. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol, 19:683–765.

37.

Mulcahy

, Benson

3rd.

2005. Bevacizumab in the treatment of colorectal cancer. Expert Opin Biol Ther, 5(7):997–1005.

38.

Murphy

, Davis

, Brown

, Carmichael

, Ghaffar

, Mayer

. 2012. Effects of oat β-glucan on the macrophage cytokine response to herpes simplex virus 1 infection in vitro. J Interferon Cytokine Res, 32(8):362–367.

39.

Murphy

, Davis

, McClellan

, Gordon

, Carmichael

. 2011. Curcumin's effect on intestinal inflammation and tumorigenesis in the ApcMin/+ mouse. J Interferon Cytokine Res, 31(2):219–226.

40.

Nemunaitis

, Fong

, Shabe

, Martineau

, Ando

. 2001. Comparison of serum interleukin-10 (IL-10) levels between normal volunteers and patients with advanced melanoma. Cancer Invest, 19(3):239–247.

41.

Ohm

, Gabrilovich

, Sempowski

, Kisseleva

, Parman

, Nadaf

, Carbone

. 2003. VEGF inhibits T-cell development and may contribute to tumor-induced immune. Blood, 101(12):4878–4886.

42.

Ordemann

, Jacobi

, Braumann

, Schwenk

, Volk

, Müller

. 2002. Immunomodulatory changes in patients with colorectal cancer. Int J Colorectal Dis, 17(1):37–41.

43.

Oyama

, Ran

, Ishida

, Nadaf

, Kerr

, Carbone

, Gabrilovich

. 1998. Vascular endothelial growth factor affects dendritic cell maturation through the inhibition of nuclear factor-kappa B activation in hemopoietic progenitor cells. J Immunol, 160(3):1224–1232.

44.

Sato

, Terai

, Tamura

, Alexeev

, Mastrangelo

, Selvan

. 2011. Interleukin 10 in the tumor microenvironment: a target for anticancer immunotherapy. Immunol Res, 51(2–3):170–182.

45.

Selvaduray

, Radhakrishnan

, Kutty

, Nesaretnam

. 2010. Palm tocotrienols inhibit proliferation of murine mammary cancer cells and induce expression of interleukin-24 mRNA. J Interferon Cytokine Res, 30(12):909–916.

46.

Sredni

, Weil

, Khomenok

, Lebenthal

, Teitz

, Mardor

, Ram

, Orenstein

, Kershenovich

, Michowiz

, Cohen

, Rappaport

, Freidkin

, Albeck

, Longo

, Kalechman

. 2004. Ammonium trichloro(dioxoethylene-o,o′)tellurate (AS101) sensitizes tumors to chemotherapy by inhibiting the tumor interleukin 10 autocrine loop. Cancer Res, 64(5):1843–1852.

47.

Sun

, Chen

, Lin

, Qin

, Zhang

, Yang

, Ma

, Ye

, Li

. 2011a. Effects of Ganoderma lucidum polysaccharides on IEC-6 cell proliferation, migration and morphology of differentiation benefiting intestinal epithelium healing in vitro . J Pharm Pharmacol, 63(12):1595–1603.

48.

Sun

, Lin

, Duan

, Lu

, Ge

, Li

, Xing

, Lan

, Jiang

, Yang

, Li

. 2013. Ganoderma lucidum polysaccharides counteract inhibition on CD71 and FasL expression by culture supernatant of B16F10 cells upon lymphocyte activation. Exp Ther Med, 5(3):1117–1122.

49.

Sun

, Lin

, Duan

, Lu

, Ge

, Li

, Xing

, Song

, Jia

, Li

. 2012b. Enhanced MHC class I and costimulatory molecules on B16F10 cells by Ganoderma lucidum polysaccharides. J Drug Target, 20(7):582–592.

50.

Sun

, Lin

, Duan

, Lu

, Ge

, Li

, Xing

, Jia

, Lan

, Li

. 2011c. Ganoderma lucidum polysaccharides antagonize the suppression on lymphocytes induced by culture supernatants of B16F10 melanoma cells. J Pharm Pharmacol, 63(5):725–735.

51.

Sun

, Lin

, Duan

, Lu

, Ge

, Song

, Li

, Xing

, Yang

, Li

. 2012a. Stronger cytotoxicity in CTLs with granzyme B and porforin was induced by Ganoderma lucidum polysaccharides acting on B16F10 cells. Biomed Prev Nutr, 2:113–118.

52.

Sun

, Lin

, Li

, Lu

, Duan

, Ge

, Song

, Xing

, Li

. 2011b. Promoting effects of Ganoderma lucidum polysaccharides on B16F10 cells to activate lymphocytes. Basic Clin Pharmacol Toxicol, 108(3):149–154.

53.

ten Dijke

, Goumans

, Pardali

. 2008. Endoglin in angiogenesis and vascular diseases. Angiogenesis, 11(1):79–89.

54.

Thomas

, Massagué

. 2005. TGF-beta directly targets cytotoxic T cell functions during tumor evasion of immune surveillance. Cancer Cell, 8(5):369–380.

55.

Trapani

. 2005. The dual adverse effects of TGF-beta secretion on tumor progression. Cancer Cell, 8(5):349–350.

56.

Wang

, Fei

, Vanderlaan

, Song

. 2004. Biological activity of bevacizumab, a humanized anti-VEGF antibody in vitro . Angiogenesis, 7(4):335–345.

57.

Whiteside

. 2006. Immune suppression in cancer: effects on immune cells, mechanisms and future therapeutic intervention. Semin Cancer Biol, 16(1):3–15.

58.

Wittke

, Hoffmann

, Buer

, Dallmann

, Oevermann

, Sel

, Wandert

, Ganser

, Atzpodien

. 1999. Interleukin 10 (IL-10): an immunosuppressive factor and independent predictor in patients with metastatic renal cell carcinoma. Br J Cancer, 79(7–8):1182–1184.

59.

Zhang

, Lin

. 2004. Hypoglycemic effect of Ganoderma lucidum polysaccharides. Acta Pharmacol Sin, 25(2):191–195.

60.

Zhang

. 2011. A special issue on TGF-β signaling and biology. Cell Biosci, 1:39.

61.

Zhu

, Chen

, Lin

. 2007. Ganoderma lucidum polysaccharides enhance the function of immunological effector cells in immunosuppressed mice. J Ethnopharmacol, 111(2):219–226.

62.

Zhu

, Lin

. 2005. Effects of Ganoderma lucidum polysaccharides on proliferation and cytotoxicity of cytokine-induced killer cells. Acta Pharmacol Sin, 26(9):1130–1137.

63.

Zou

. 2005. Immunosuppressive networks in the tumour environment and their therapeutic relevance. Nat Rev Cancer, 5(4):263–274.