Interferon-Stimulated Gene Expression as a Preferred Biomarker for Disease Activity in Aicardi–Goutières Syndrome

Subjects and ethics statement

We report on 3 AGS patients. Two siblings, Patient 1 and Patient 2, who have mutations in RNASEH2A. The unaffected mother and brother of Patients 1 and 2 with the RNASEH2A mutations are carriers for a c.158C>G (p.Pro53Arg) mutation in the RNASEH2A gene (AGS4), while the unaffected father is a carrier for a c.872G>A (p.Arg291His) mutation in the same gene. Both Patients 1 and 2 are compound heterozygotes for the mutations. Patient 3 is homozygous for a c.1411-2A>G (r.spl?) ^* mutation in the SAMHD1 gene (AGS5). Genetic analysis of the unaffected parents revealed heterozygosity for the SAMHD1 mutation in both parents.

Blood samples were obtained between February 2012 and September 2015. In addition, samples were also collected from the patients' unaffected family members. This study was approved by the Research Ethics Boards of The Hospital for Sick Children and the University Health Network (Toronto, ON, Canada). Signed consent was obtained from all participants.

Cells and reagents

Human lung adenocarcinoma epithelial A549 cells (ATCC, Manassas, VA) were maintained in RPMI-1640 with sodium bicarbonate and l-glutamine (Sigma-Aldrich, St. Louis, MO), supplemented with 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin (Invitrogen, Waltham, MA). Human IFN-β-1a (specific activity 1.2 × 10⁷ U/mL; Avonex) was provided by Darren P. Baker (BiogenIdec, Cambridge, MA). Tofacitinib citrate was purchased from Sigma-Aldrich.

RNA extraction and cDNA synthesis

Three milliliters of blood was drawn from patients and their unaffected family members following standard clinical methods into Tempus Blood RNA Tubes (Applied Biosystems, Waltham, MA) and processed using the Tempus Spin RNA Isolation Reagent Kit (Applied Biosystems) following the manufacturer's protocol. For tofacitinib-treated or tofacitinib-untreated samples, RNA from leukocytes was extracted using the RNeasy Mini Kit (Qiagen, Netherlands) according to the manufacturer's protocol. 1.5 × 10⁷ A549 cells were treated overnight with 1 × 10³ U/mL IFN-β-1a and RNA was also extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. cDNA was generated using 1 μg of patient RNA or A549 cell RNA, random primers, and M-MLV reverse transcriptase (Invitrogen) according to the manufacturer's protocol.

Quantitative real-time polymerase chain reaction

qPCR was performed using LightCycler FastStart DNA Master SYBR Green PLUS I (Roche, Germany) and a LightCycler (Roche) according to the manufacturer's protocol and as previously described (Rogers and others 2012). Primers for HPRT1 [forward (5′ TCCTCCTCTGCTCCGCCACC 3′), reverse (5′ TCACTAATCACGACGCCAGGGCT 3′)], ISG15 [forward (5′ GCGGCTGAGAGGCAGCGAAC 3′), reverse (5′ TGCCCGCCAGCATCTTCACC 3′)], RSAD2 [forward (5′ GCCAAAACATCCTTTGTGCT 3′), reverse (5′ TGGCTCTCCACCTGAAAAGT 3′)], and IFI27 [forward (5′ ATCAGCAGTGACCAGTGTGG 3′), reverse (5′ GCCACAACTCCTCCAATCAC 3′)] were synthesized by ACGT Corporation (Toronto, ON, Canada). Standard curves for each gene were generated using cDNA from IFN-β-1a treated A549 cells. Data were analyzed using LightCycler Data Analysis Software (Roche).

AGS patient histories

The 2 siblings, Patients 1 and 2, both aged 18 months at symptom onset, presented with a 4- to 6-week history of hemiparesis following a febrile episode associated with rash. In both siblings, initial magnetic resonance imaging (MRI) showed multifocal confluent white matter abnormalities (Fig. 1). Patient 1, a male, did not experience further neurological events. His younger sister, Patient 2, had a second episode at 4 months postonset, characterized by sialorrhea, decreased axial tone, recurrent fevers, and had progression of the white matter lesions on her MRI.

OPEN IN VIEWER

FIG. 1.

Brain MRIs for Patient 1 and Patient 2. Serial Axial T2 FLAIR images spanning onset and resolution of abnormalities. MRI, magnetic resonance imaging.

In both siblings MRI abnormalities regressed over time, yet, for Patient 2 worsened significantly at the time of an acute exacerbation and continued to show extensive T2 bright signal for several years after the initial acute event. Regression of the lesions occurred in conjunction with improvement of neurologic status (Fig. 1), but both have significant residual motor deficits, with severe cognitive impairment also present in Patient 2. For Patient 2, we conducted repeated rheumatological and inflammatory testing that revealed a modest elevation of WBCs and fluctuations in ESR, generally within normal range (Fig. 2A). Notably, at the time of the second febrile episode, ESR was within normal range. CRP levels and platelet numbers were consistently within normal range for Patient 2.

OPEN IN VIEWER

FIG. 2.

Standard blood markers for inflammation do not reflect persistent disease in AGS patients. Peripheral blood WBC (■) and platelet counts (♦), ESR (△), and CRP (◯) measurements were recorded over time for (A) Patient 2 and (B) Patient 3. The normal range for each readout is indicated in the inset. AGS, Aicardi–Goutières syndrome; CRP, C-reactive protein; ESR, erythrocyte sedimentation rate; WBC, white blood cell.

Patient 3, presented at 1 year of age with chilblains, subsequently developed oral ulcers and arthritis at 9 years of age. Examination showed microcephaly, small stature, and developmental delay. MRI scans, performed at ages 12 years 9 months and 13 years 8 months, were unremarkable (data not shown). His polyarthritis was treated with etanercept, methotrexate, and intra-articular corticosteroids with excellent response, but severe chilblains persisted and led to tissue loss over the pinnae. His blood testing on therapy did show evidence for elevated ESR, but not CRP, with no significant effects on WBC or platelet counts while on immunosuppressive therapy (Fig. 2B).

AGS patients exhibit elevated peripheral blood ISG expression

Blood samples were collected from Patient 2 at 11, 16, 19, and 24 months postonset of AGS symptoms (Fig. 3A). At those times, we also obtained blood samples from Patient 1 (10 years 5 months–11 years 6 months postonset) and the siblings' unaffected mother and brother. By 10 years 5 months the gross MRI abnormalities in Patient 1 had regressed, with some residual abnormalities. MRI abnormalities in Patient 2 worsened and subsequently showed slow resolution over years (Fig. 1). When tested 11 months after the first onset of symptoms, Patient 2 exhibited ∼3.3-, 5.9-, and 7.3-fold higher levels of ISG15, RSAD2, and IFI27 expression, respectively, in her peripheral blood in comparison to her unaffected mother and brother, despite symptom resolution and no elevation in ESR, CRP, WBC, or platelets.

OPEN IN VIEWER

FIG. 3.

Elevated peripheral blood ISG expression in AGS patients. (A) Peripheral blood ISG expression levels for Patient 1 and Patient 2. Blood was collected from Patient 1 (■), his younger AGS-affected sister, Patient 2 (●), unaffected brother (□), and unaffected mother (◯) at the indicated times postonset for Patient 2. (B) Peripheral blood was collected from Patient 3 (■) and his unaffected mother (◯) and father (□) at 18 years postonset. RNA was extracted from whole peripheral blood, cDNA was synthesized, and qPCR was performed to quantify the relative expression of 3 ISGs associated with IFN-inducible inflammatory responses: ISG15, RSAD2, and IFI27. Expression was normalized relative to the housekeeping gene HPRT1 and standard curves generated for each gene using cDNA from IFN-β-1a-treated human A549 cells. IFN, interferon; ISG, IFN-stimulated gene; qPCR, quantitative real-time polymerase chain reaction.

Longitudinal evaluation of ISG expression in samples showed ongoing evidence for higher ISG expression in Patient 2, compared with Patient 1 and their unaffected mother. During this time period (11–24 months postsymptom onset), Patient 2 experienced occasional febrile episodes, but did not experience any new neurological events or new MRI lesions (Fig. 1). She continued to have severe neurological impairment. Interestingly, ISG expression levels decreased at 19 months postsymptom onset in Patient 2, the most significant decrease for IFI27 expression (36-fold), although still 3.3-fold greater than in the peripheral blood of the unaffected mother.

For Patient 3, we collected a blood sample at 18 years postonset of symptoms. At this time he continued to demonstrate chilblain lesions on his extremities and complained of 15–30 min of early morning stiffness and had flexion contractures of both fourth fingers, but no active arthritis. In comparison to his unaffected parents, Patient 3 had 6.5-fold greater ISG15 expression and more than 10-fold greater RSAD2 and IFI27 expression (Fig. 3B). As mentioned, only elevated ESR was observed, despite being on immunosuppressive therapy (Fig. 2B).