Tryptophan Supplements Promote Pregnancy Success in Mice Challenged with Pseudorabies Virus (PRV) by Regulating the Expression of Systemic Cytokines,Immunoglobulins,PRV-Specific Protein Profiles,and Toll-Like Receptors

Abstract

Tryptophan (Trp) plays an important role in regulating the maternal immune response, a key determinant of the success or failure of pregnancy, but whether Trp supplements can prevent a pseudorabies virus (PRV)-induced failure of pregnancy remains unknown. This study examined the effect of three dietary Trp levels (0.25%, 0.35%, and 0.5%) on the immunity and reproduction of PRV-challenged pregnant mice. PRV challenge resulted in decreased live embryo numbers, live litter sizes, and serum progesterone and interleukin (IL)-10 concentrations, but increased the levels of serum immunoglobulins (Igs) (PRV-specific antibody [IgG, IgA, and IgM]) and IL-1β. Live embryo numbers, live litter sizes, serum progesterone concentration, and IgG and PRV-specific antibody levels on day 9 of pregnancy were all increased dose-dependently by Trp inclusion in the diet of PRV-challenged mice. Increased Trp levels in PRV-challenged mice promoted the up-regulation of uterine and embryonic indoleamine 2,3-dioxygenase expression, but attenuated the up-regulation of uterine and embryonic Toll-like receptor (TLR) 3 and TLR9 expression and increased serum interferon-γ concentration. Collectively, Trp supplements might improve reproductive performance of PRV-challenged pregnant mice by down-regulating TLR expression and pro-inflammatory cytokine synthesis, by up-regulating PRV-specific antibody and immunoglobulin synthesis, and by elevating the concentrations of anti-inflammatory cytokines and progesterone.

Introduction

T he embryo's tissues are half foreign to the mother, yet, unlike a mismatched organ transplant, the embryo is not normally rejected. Researchers have begun to reveal how the maternal immune system reacts to implanted embryos and how the placenta protects itself from immune attack. It has been established that the maternal immune response, particularly the balance of T-helper (Th) 1/Th2 cytokines, plays a key role in determining the success or failure of pregnancy.^1,2 Th2-type response molecules such as interleukin (IL)-4 and IL-10 promote successful fetal outcome, whereas a Th1-type response such as interferon-γ (IFN-γ) and IL-1β causes inflammation and induces abortion.³ Thus, a Th1/Th2 balance that leans toward the Th2 response is considered to be beneficial for supporting pregnancy.

Invading pathogens such as pseudorabies virus (PRV) have been demonstrated to be potent factors that initiate the innate immune response by activating the signaling of Toll-like receptors (TLRs) such as TLR3 and TLR9 and lead to increased synthesis of Th1-type cytokines.⁴ PRV-induced abortion or the birth of dead or weakened piglets has been implicated in susceptible sows.⁵ Furthermore, PRV, as an α-herpesvirus originating from blood or semen, might come into contact with preimplantation embryos and as such may represent a sanitary risk for the international trade in porcine embryos.⁵

Growing evidence indicates that, in addition to protein synthesis, some amino acids such as tryptophan (Trp) are also involved in the regulation of immune responses.⁶ An increased Trp requirement during viral infection has been observed.⁷ One possible explanation is that Trp is important in maintaining the circulating concentrations of immunoglobulins (Igs) such as IgM.^8,9 Further studies have revealed that the catabolites of Trp produced by indoleamine 2,3-dioxygenase (IDO), a key enzyme for degrading Trp outside the liver, can act directly on maternal immune cells.¹⁰ It has been shown that catabolites of Trp, including kynurenine, 3-hydroxykynurenine, and 3-hydroxyanthranilic acid, induce apoptosis in Th1 cells, but not in Th2 cells.¹¹ This implies a positive role of Trp or its catabolites in shifting the Th1/Th2 balance toward a Th2 response, which is more beneficial for pregnancy.

As mentioned above, adequate Trp intake for animals challenged with pathogens might increase pregnancy success by promoting immune protein synthesis both via Trp directly and also by eliciting a Th2-mediated immune response bias by Trp catabolites. Therefore, here we investigated the effects of dietary Trp level on the immunity and reproduction of pregnant mice challenged with PRV. Our aims were to determine whether Trp dietary supplements could improve reproductive performance of PRV-challenged mice as measured by live embryo numbers, live litter sizes, and fetal survival. We also tested whether this treatment would attenuate the initial inflammatory responses (as measured by mRNA levels of IDO, TLR3, and TLR9), promote the production of serum PRV-specific antibodies, enhance the Ig response, and regulate Th1/Th2 cytokine production.

Materials And Methods

Animals and experimental treatments

All procedures outlined in this experiment were approved by the Animal Care and Use Committee of the Animal Nutrition Institute, Sichuan Agricultural University, Ya'an, China. All experiments involving animals followed the national guidelines for animal usage in research. The basal diet (Table 1) containing 0.2% l-Trp was formulated based on the national standard GB 14924.3-2001 diet. Crystalline Trp (Sigma-Aldrich, St. Louis, MO, USA) (98%) was premixed with bean meal and then added to the basal diet at concentrations of 0.05%, 0.15%, and 0.3%, to form three experimental diets containing Trp at 0.25%, 0.35%, and 0.5% of the total diet, respectively. The 0.25% Trp diet was used as a positive control that met nutritional requirements for mice during growth and pregnancy, as recommended for GB 14924.3-2001. Twenty-one-day-old, pathogen-free Swiss mice (n=182; 132 female, 50 male) (weighing 34±5.5 g) obtained from the Sichuan Academy of Medical Sciences–Sichuan Provincial People's Hospital Experimental Animal Research Institute [with license SCXK (Chuan) 2004-15] were fed one of the three experimental diets. Each experimental group contained 44 female mice. After a 3-week adaptation period to the experimental diets, one male mouse per cage was housed together with three female mice in the same cage to complete mating. The females were examined each morning for the presence of a seminal plug in the vagina. Detection of a plug was designated embryonic day 0 of gestation, and plug-positive females were considered “pregnant.” Immediately after the first observation of a plug, the male mice were removed, and 25, 27, and 27 female mice in the 0.25%, 0.35% and 0.5% Trp groups, respectively, were intraperitoneally injected with 0.5 mL of PRV solution to deliver PRV at 3.5×10³ plaque-forming units/g of body weight. The PRV (SA215 attenuated strain) used in this study was deficient in glycoprotein-E/glycoprotein-I/thymidine kinase and was constructed by the Biotechnology Center of Sichuan Agricultural University. The remaining mice in each Trp group were given an equal volume of phosphate-buffered saline (PBS) at the same time points of pregnancy and served as controls. PRV- and PBS-injected mice were housed separately in temperature-controlled and ventilated animal rooms under a 12/12-hour light/dark cycle. All the mice had free access to water at all times. Mice were offered diets according to the procedure previously described,¹² to ensure equal food consumption among groups.

Table 1.

Ingredients and Chemical Composition of the Basal Diet (on a Percentage as Fed Basis)

Component	Content
Ingredient (%)
Corn	42.92
Soybean meal	15.6
Fish meal	7.5
Corn gluten meal	4.3
Soybean oil	11.5
Gelatinized starch	7.5
CaCO₃	0.9
CaHPO₄	1.5
Fiber	2.8
Minerals premix^a	3.5
Vitamin premix^b	0.2
Antioxidant (ethoxyquin)	0.02
Choline (choline chloride 50%)	0.02
Lysine HCl	0.46
Methionine+cystine	0.19
Threonine	0.18
Isoleucine	0.33
Histidine	0.08
Leucine	0.13
Valine	0.32
Arginine	0.05
Total	100
Chemical composition
Crude protein (%)	17.5
Digestible energy (MJ/kg)	15.5
Tryptophan (%)	0.2
Lysine (%)	1.32
Methionine+cysteine (%)	0.78
Threonine (%)	0.88
Isoleucine (%)	1.03
Histidine (%)	0.55
Leucine (%)	1.76
Valine (%)	1.17
Arginine (%)	1.1
Calcium (%)	1.12
Total phosphorus (%)	0.71

Provided per kilogram of diet: potassium, 5,000 mg; sodium, 2,000 mg; chlorine, 1,517 mg; zinc, 30 mg; manganese, 75 mg; copper, 10 mg; iron, 120 mg; selenium, 0.05 mg; magnesium, 2,000 mg.

Provided per kilogram of diet: vitamin A, 3 mg; vitamin D₃, 0.05 mg; vitamin E, 500 mg; vitamin B₁, 4 mg; vitamin B₆, 12 mg; vitamin B₂, 32 mg; folic acid, 10 mg; d-biotin, 1 mg; vitamin K, 10 mg; vitamin B₁₂, 1 mg; nicotinic acid, 30 mg; d-calcium pantothenate, 50 mg.

Chemical analysis of diets

Crude protein concentrations in the experiment diets were analyzed by standard procedures.¹³ Trp was analyzed after alkaline hydrolysis (4 N NaOH) at 120°C for 15 hours using high-performance liquid chromatography (model LC-10 liquid chromatograph, Shimadzu, Kyoto, Japan).

Blood sampling, tissue collection, and recording of live embryos on day 9 of pregnancy

On day 9 of pregnancy, five mice from each group were selected to continue to term, and the remainder were killed after 12 hours of food deprivation. Immediately after mice were anesthetized,¹⁴ venous blood from the eye sockets and tissue samples from the uterus, fetuses, brain, and spleen were collected. Blood was permitted to clot, and serum was separated by centrifugation at 1,330 g for 15 minutes and stored at −80°C until analysis. All tissue samples were rapidly excised, washed with PBS to remove excess blood, blotted dry, snap-frozen in liquid nitrogen, and then stored at −80°C.

Live litter size, mortality, and abortion rate

The number of dead fetuses was recorded daily throughout the experiment, and mortality was calculated based on these data. Pregnant female mice that yielded no pups were defined as having had a spontaneous abortion, and those yielding any pups were considered “successful” pregnancies, irrespective of the litter size.¹⁵ The number of mice without pups as a percentage of the number of pregnant (plugged) mice was calculated as the abortion rate. The live litter size of each mouse was recorded within 12 hours post-parturition.

Analysis of blood samples

The PRV-specific antibody was quantified using a commercial murine enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer's instructions (LSI, L'arbresle, France). The assay is a blocking ELISA that utilizes microplates coated with PRV antigen. Optical density (OD) values for serum PRV-specific antibody levels were determined (model 680 microplate reader, Bio-Rad Laboratories, Hercules, CA, USA) with 450-nm interference filters installed on the filter wheel. To calculate the blocking percentage of each test sample, we used the following formula: Blocking rate (%)=([OD_negative – OD_test]/OD_negative)×100%.

The test sample was recorded as positive (antibodies present) if the blocking percentage was ≥50%. The test sample was recorded as negative (antibodies absent) if the blocking percentage was ≤45%. The test sample was recorded as doubtful if the blocking rate was 45–50%. The serum concentrations of progesterone were measured (Bio-Radmodel 680 microplate reader with 450-nm interference filters installed on the filter wheel) following the instructions for the murine ELISA kits (R&D Systems, Minneapolis, MN, USA). The minimal detection limit was 80 nmol/L. Intra- and inter-assay coefficients of variation were less than 10%.

Serum IgG, IgA, and IgM were measured using Ig immunoturbidimetry assay kits (Maker Chemical Co., Ltd., Chengdu, China). The determination ranges of IgG, IgA, and IgM were 0–40 g/L, 0–6.2 g/L, and 0–5 g/L, respectively. The intra-assay coefficients of variations for mean IgG, IgA, and IgM concentrations were 5%.

Serum free Trp concentration was determined using high-performance liquid chromatography (Shimadzu model LC-10 liquid chromatograph) after being deproteinized with 3 volumes of 10% sulfosalicylic acid.

IL-1β, IFN-γ, and IL-10 measurements

Embryos in the left uterine horn were used to determine IL-1β, IFN-γ, and IL-10 concentrations. Tissue samples were dissected free from connective tissue, rinsed, and homogenized into 2 volumes of homogenizing buffer. Homogenates were centrifuged at 15,000 g for 30 minutes, and the supernatants were stored at −80°C until analyses. The tissue concentrations of IL-1β, IFN-γ, and IL-10 were measured (Bio-Rad model 680 microplate reader with 450-nm interference filters installed on the filter wheel) using appropriate murine enzyme-linked ELISA kits (R&D Systems).

PRV detection

Total DNA was isolated from brain samples using a conventional phenol/chloroform method as described.¹⁶ Polymerase chain reaction (PCR) amplification for detecting viral DNA was performed using PRV glycoprotein-B-specific primers (forward 5′-ACCCGTACACCGAGTCGTGGCA-3′; reverse 5′-CGGCGTCAGGAATCGCATCA-3′) to give a fragment size of 572 bp. PCR was performed in 10-μL volumes of solution containing 2 μL of extracted DNA, 5 μL of 2× Taq polymerase buffer, 0.2 μL of each primer, 1.6 μL of deoxynucleoside triphosphate (10 mM) solution, 0.2 μL of Taq DNA polymerase, and 0.8 μL of sterile water. The PCR amplification conditions were initial denaturation (95°C for 5 minutes) followed by 30 cycles of (95°C for 1 minute, 62°C for 1 minute for primer annealing, 72°C for 1.5 minutes) for primer extension, and a final extension of 10 minutes at 72°C. The PCR products were analyzed by electrophoresis in 1% agarose gels stained with ethidium bromide and visualized under ultraviolet light. Positive results indicated that mice were infectious on day 9 of pregnancy and on the day of delivery.

RNA extraction and real-time PCR

The left uterine horn and its embryos were used to determine the relative expression of IDO, TLR3, and TLR9. Total RNA was recovered from uterine and fetal tissue using Trizol reagent (Takara, Tokyo, Japan) according to the manufacturer's instructions. RNase-free DNase treatment was performed to eliminate the contamination of trace genomic DNA. Agarose gel electrophoresis was conducted to determine the integrity of RNA. RNA concentrations and purity were confirmed using a nucleic acid/protein analyzer (model DU-800, Beckman Coulter, East Lyme, CT, USA) on approximately 200 ng/μL of each RNA sample. Reverse transcription (RT) was carried out in a total volume of 10 μL containing 2 μL of 5× Prime script™ (Takara) buffer, 0.5 μL of Prime script RT enzyme mix, 0.5 μL of oligo(dT) primer (50 μM), 0.5 μL of random hexamer primers (100 μM), 4 μL of total RNA, and 2.5 μL of RNase-free double distilled H₂O. The RT reaction was performed at 37°C for 15 minutes and 85°C for 5 seconds. Real-time PCR was performed to analyze mRNA expression in the embryos using SYBR Green PCR mix (Takara). A total volume of 12.5 μL in the reaction system contained 6.25 μL of SYBR Premix Ex Taq (2×), 0.25 μL each of the forward and reverse primers (10 μM), 1 μL of cDNA, and 4.75 μL of double distilled H₂O. The sequences for the forward and reverse primers are shown in Table 2. PCR conditions were as follows: initial denaturation at 95°C for 1 minute, followed by 40 cycles of denaturation at 95°C for 5 seconds, annealing at 60°C for 25 seconds, and extension at 72°C for 30 seconds. Melting curve conditions were 95°C for 0 seconds, 50°C for 30 seconds, and 95°C for 0 seconds (temperature change velocity: 0.5°C/s). Amplification and melting curve analysis were performed using the iQ5 Real-time PCR detection system (Bio-Rad). Melting curve analysis was conducted to test the specificity of each product, and products were electrophoresed on 1% agarose gels to confirm product size. The identity of each product was confirmed by DNA sequencing. Each experiment was repeated three times. The comparative threshold cycle method was used to quantify the relative levels of gene expression. Following real-time RT-PCR amplification of IDO, TLR3, and TLR9 mRNAs and normalization with β-actin, the double standard curve method was applied to calculate the relative expression level of each gene in embryos and uteri.

Table 2.

Primer Sequences of Target Genes and Housekeeping Gene

Gene	Primer sequences (5′-3′)	Size of amplified fragment (bp)	Genbank accession number
IDO	Forward AGGATGCGTGACTTTGTG	208	NM-008324
	Reverse TGCCAGCCTCGTGTTTTA
TLR3	Forward TCAAATCCACTTAAAGAGT	263	NM-126166
	Reverse GAACCGTTGCCGACATCA
TLR9	Forward CTTGCCACATGACCATTGAG	216	NM-031178
	Reverse TGTAGTAGCAGTTCCCGTCC
β-Actin	Forward TGCTGTCCCTGTATGCCTCT	224	NM-007393
	Reverse TTTGATGTCACGCACGATTT

IDO, indoleamine 2,3-dioxygenase; TLR, Toll-like receptor.

Statistical analysis

The experiment was conducted in a completely randomized 3×2 factorial design. All data, except for those presented as survival and miscarriage rates, were analyzed using the GLM procedure of SAS (version 8.0, SAS Institute, Inc., Cary, NC, USA) to determine the significance of the main effects (PRV challenge, Trp level, PRV challenge×Trp level interaction). Duncan's multiple range test was performed to separate means when a significant main effect was detected. Differences were considered significant at P<.05 for all tests, and data represent the mean±SD values of all repeat experiments. Fetal survival and miscarriage rates were analyzed by χ² tests.

Results

PCR confirmation of PRV infection in the brain tissue on day 9 of pregnancy

The PRV in brain tissues of mice challenged with PRV could be detected on day 9 of pregnancy, whereas the PBS-injected control mice did not show any infection with this virus (Fig. 1).

FIG. 1.

Polymerase chain reaction analysis for the pseudorabies virus sequence in brain tissues: lane 1, pseudorabies virus DNA-negative control; lanes 2–4, phosphate-buffered saline groups receiving l-tryptophan at 0.5%, 0.35%, and 0.25% of diet, respectively; lanes 5–7, pseudorabies virus groups receiving l-tryptophan at 0.5%, 0.35%, and 0.25% of diet, respectively; and lanes 8–10, pseudorabies virus DNA-positive controls. M denotes DL2000 marker.

Trp supplements affected serum Trp and progesterone concentrations

Overall, the PRV-treated groups had significantly higher serum Trp concentrations than PBS control groups (Fig. 2A). Trp concentration was also affected by the level of Trp in the diet (P<.05). For both the PRV-challenged and PBS-injected groups, the 0.50% Trp group had a higher serum Trp concentration than the 0.25% Trp group (P<.05). Serum progesterone concentration was decreased by the PRV challenge (P<.05) but was increased by the inclusion of 0.5% Trp in PRV-challenged mice (P<.05; Fig. 2B).

FIG. 2.

Effects of l-tryptophan (Trp), pseudorabies virus (PRV), and Trp×PRV interaction on serum concentrations of (A) Trp (μg/mL) and (B) progesterone (nmol/L) on day 9 of pregnancy in mice (n=4). ^abDifferent letters on the same color column indicate significant differences (P<.05). *An asterisk indicates a significant difference between the PRV and phosphate-buffered saline (PBS) groups fed the same dosage of Trp (P<.05).

Trp supplements improved pregnancy success

There were no significant differences in the fetal mortality or abortion rates of pregnant mice between groups (Table 3). Live embryo numbers on day 9 of pregnancy and live litter size (Table 4) were both higher in the PBS groups than in the PRV groups (P<.05). In the PRV groups, dietary inclusion of 0.35% and 0.50% Trp both resulted in increased live embryos and live litter size compared with the 0.25% Trp diet (P<.05).

Table 3.

Effects of l-Tryptophan on Mortality and Abortion Rate of Pregnant Mice in Pseudorabies Virus-Challenged Groups

	Trp level (%)
	0.25	0.35	0.5
Number of deaths/total number of mice	5/25	2/27	1/27
Mortality (%)	20	7.4	3.7
Number of abortions/(total number – number dead)	3/20	2/25	1/26
Abortion rate (%)	15	8	3.8

Table 4.

Effects of l-Tryptophan, Pseudorabies Virus, and l-Tryptophan × Pseudorabies Virus Interaction on Live Embryo Numbers on Day 9 of Pregnancy and Live Litter Size at Delivery

	Trp level (%)			Significance
	0.25	0.35	0.5	Trp	PRV	Trp×PRV
Live embryo numbers
PRV group	10.33±1.58^b ^*	13.80±0.84^a	14.25±0.71^a	< 0.001	<0.001	0.004
PBS group	13.50±0.58	14.67±0.82	14.50±0.84
Live litter size
PRV group	9.67±1.53^b ^*	13.00±1.29^a	13.71±1.11^a	0.001	0.001	0.049
PBS group	12.86±1.34	14.20±1.30	14.13±1.13

Data are mean±SD values.

Values in the same row with no common superscripts differ (P<.05).

An asterisk indicates a significant (P<.05) difference between the PRV and PBS groups fed the same dosage of Trp.

Trp supplements affected serum PRV-specific antibody

The blocking rate of PRV-specific antibody measured either on day 9 of pregnancy or at delivery was higher in the PRV groups than in the PBS groups (P<.05; Table 5). In the PRV groups, dietary inclusion of Trp at 0.35% and 0.50% resulted in higher blocking rates of PRV-specific antibody than did the 0.25% Trp diet (P<.05).

Table 5.

Effects of l-Tryptophan, Pseudorabies Virus, and l-Tryptophan × Pseudorabies Virus Interaction on Serum Pseudorabies Virus-Specific Antibody (Percentage Blocking Rate) on Day 9 of Pregnancy and at Delivery

	Trp level (%)			Significance
	0.25	0.35	0.5	Trp	PRV	Trp×PRV
Day 9 of pregnancy
PRV group	52.55±4.37^b ^*	59.87±3.99^a ^*	63.34±5.56^a ^*	0.019	<0.001	0.007
PBS group	32.86±3.04	33.05±1.14	31.87±1.06
Delivery day
PRV group	54.16±1.84^b ^*	63.90±9.55^a ^*	64.23±7.76^a ^*	0.075	<0.001	0.181
PBS group	27.79±2.61	30.93±3.17	27.29±1.99

Data are mean±SD values (n=5 and 4 in the PRV and PBS groups, respectively).

Values in the same row with no common superscripts differ (P<.05).

An asterisk indicates a significant (P<.05) difference between the PRV and PBS groups fed the same dosage of Trp.

Trp supplements influenced serum Ig profiles

The PRV challenge resulted in enhanced serum concentrations of IgA, IgM, and IgG (P<.05; Table 6). Dietary inclusion of 0.35% and 0.5% Trp both resulted in increased IgG concentrations in challenged mice compared with the 0.25% Trp diet (P<.05). Whether or not the mice received a PRV challenge, the IgM concentrations were higher in the 0.5% Trp group than in the 0.35% and 0.25% Trp groups (P<.05).

Table 6.

Effects of l-Tryptophan, Pseudorabies Virus, and l-Tryptophan × Pseudorabies Virus Interaction on Serum Immunoglobulin Concentrations on Day 9 of Pregnancy

	Trp level (%)			Significance
	0.25	0.35	0.5	Trp	PRV	Trp×PRV
IgG
PRV group	0.92±0.10^c	1.24±0.08^b ^*	1.49±0.07^a ^*	0.001	<0.001	0.005
PBS group	0.79±0.17	0.81±0.09	0.91±0.03
IgA
PRV group	0.45±0.04	0.44±0.11	0.52±0.16	0.207	0.018	0.938
PBS group	0.30±0.09	0.32±0.10	0.42±0.01
IgM
PRV group	0.98±0.01^b ^*	0.99±0.01^b ^*	1.14±0.03^a ^*	< 0.001	<0.001	0.959
PBS group	0.76±0.03^b	0.75±0.04^b	0.91±0.02^a

Data are mean±SD serum immunoglobulin (Ig) concentrations (in g/L) (n=3).

abc

Values in the same row with no common superscripts differ (P<.05).

An asterisk indicates a significant (P<.05) difference between the PRV and PBS groups fed the same dosage of Trp.

Effects of Trp supplements on fetal tissue cytokine concentrations

The PRV challenge resulted in increased IL-1β and IFN-γ concentrations but a decreased IL-10 concentration (P<.05; Table 7). In PRV-challenged mice, dietary inclusion of both 0.35% and 0.5% Trp resulted in decreased IFN-γ concentrations but increased IL-10 concentrations compared with the 0.25% Trp diet (P<.05).

Table 7.

Effects of l-Tryptophan, Pseudorabies Virus, and l-Tryptophan × Pseudorabies Virus Interaction on Fetal Tissue Cytokine Concentrations on Day 9 of Pregnancy

	Trp level (%)			Significance
	0.25	0.35	0.5	Trp	PRV	Trp×PRV
IL-1β
PRV group	2.25±0.05^*	2.12±0.46^*	1.84±0.09	0.046	0.004	0.216
PBS group	1.89±0.02	1.48±0.13	1.71±0.30
IFN-γ
PRV group	17.62±0.42^a ^*	15.29±0.63^b	15.71±0.08^b ^*	<0.001	<0.001	0.010
PBS group	14.87±0.40^a	14.34±0.27^ab	13.86±0.60^b
IL-10
PRV group	6.01±0.27^b	7.06±0.43^a ^*	7.10±0.43^a	0.002	0.008	0.445
PBS group	6.74±0.49^b	8.27±0.42^a	7.46±1.11^ab

Data are mean±SD concentrations (in nmol/g) (n=4).

Values in the same row with no common superscripts differ (P<.05).

An asterisk indicates a significant (P<.05) difference between the PRV and PBS groups fed the same dosage of Trp.

IL-1β, interleukin-1β; IL-10, interleukin-10; IFN-γ, interferon-γ.

Trp supplements up-regulated expression of IDO and down-regulated expressions of TLR3 and TLR9

The PRV challenge resulted in increased expression of IDO both in the embryos (Fig. 3A) and in the uterus (Fig. 3B) but decreased expression of TLR3 (Fig. 4) and TLR9 (Fig. 5) in the same tissues (P<.05). Dietary inclusion of 0.35% and 0.5% Trp in PRV-challenged mice resulted in up-regulated uterine and embryonic IDO expression but down-regulated uterine and embryonic TLR3 and TLR9 expression levels (P<.05).

FIG. 3.

Effects of Trp, PRV, and Trp×PRV interaction on the relative expression of IDO in the (A) embryos and (B) uteri of pregnant mice (n=4). ^abcDifferent letters on the same color column indicate significant differences (P<.05). *An asterisk indicates a significant difference between the PRV and PBS groups fed the same dosage of Trp (P<.05).

FIG. 4.

Effects of Trp, PRV, and Trp×PRV interaction on the relative expression of TLR3 in the (A) embryos and (B) uteri of pregnant mice (n=4). ^abDifferent letters on the same color column indicate significant differences (P<.05). *An asterisk indicates a significant difference between the PRV and PBS groups fed the same dosage of Trp (P<.05).

FIG. 5.

Effects of Trp, PRV and Trp×PRV interaction on the relative expression of TLR9 in the (A) embryos and (B) uteri of pregnant mice (n=4). ^abDifferent letters on the same color column indicate significant differences (P<.05). *An asterisk indicates a significant difference between the PRV and PBS groups fed the same dosage of Trp (P<.05).

Discussion

The objective of this study was to determine whether the pregnancy of PRV-challenged mice was responsive to Trp-induced maternal immune responses. Given evidence that pathogen-challenged animals have increased Trp requirements,¹⁷ our first objective was to examine the effects of dietary Trp level on embryonic survival in PRV-challenged mice. The PRV-challenged mice had lower live embryo numbers and live litter sizes than PBS-treated controls. Our findings that the blocking rates of PRV-specific antibody and IgG concentrations were increased with increased dietary Trp in PRV-challenged mice might provide an explanation for the improved pregnancy rates in pregnant mice receiving high levels of dietary Trp. Reduced IgM production during Trp deficiency has also been observed in previous studies.⁹ Given that IgG is the sole immune protein that can be transported across the fetal membrane, this further indicates the significance of Trp-promoted IgG production in protecting embryos from invading pathogens.

Previous studies have found that pregnant mice had decreased serum levels of viruses such as herpes simplex virus type 1, especially on the day before delivery when the Ig concentrations peak.¹⁸ Igs have been demonstrated to play a crucial role in facilitating the destruction of PRV-infected cells to limit the spread of viruses in the body.¹⁹ A recent study further confirmed that in PRV-challenged pregnant mice, the maternal antibody placental transport served an important role in the protection of the newborn.²⁰ In this regard, it could be an adaptive response that swine serum contains more IgM and IgG in the early stage of PRV infection. This could provide a biological explanation for our observation that PRV-infected mice needed a much higher amount of Trp than normal mice to obtain a similar live embryo number. Thus, PRV-challenged mice in the 0.25% Trp group had the lowest live embryo numbers and live litter sizes. These results suggest that increasing dietary Trp levels might improve pregnancy success by promoting the synthesis of immunity-related proteins to resist viral or other pathogenic challenges.

In addition to acting as the limiting amino acid for immune protein synthesis, Trp also plays an important role in the regulation of cellular immunity via its catabolites. It is interesting that catabolites of Trp, including kynurenine, 3-hydroxykynurenine, and 3-hydroxyanthranilic acid, induce apoptosis in Th1 cells, but not in Th2 cells,¹¹ which implies that increased Trp catabolism might push the Th1/Th2 balance toward the Th2 direction and thus be beneficial for pregnancy. Therefore, our second objective was to determine whether Trp supplements could attenuate PRV-induced Th1 cytokine responses, which may provide new insights into the better pregnancy rates of PRV-challenged mice fed high levels of dietary Trp. The results indicated that Trp supplements had a significant role in blocking a PRV-induced increase in the synthesis of Th1 cytokines, including IFN-γ and IL-2, and in blocking a PRV-induced decrease in synthesis of Th2 cytokines such as IL-10. Because Trp degradation to kynurenine, 3-hydroxykynurenine, and 3-hydroxyanthranilic acid is dependent on IDO activity, which in turn is highly correlated to its gene expression,²¹ the increased IDO expression in the embryo and uterus of pregnant mice fed high-dosage Trp might explain the decreased Th1 and increased Th2 response. The higher serum Trp concentration, combined with the higher IDO expression, in PRV-challenged mice than in PBS-treated mice suggested that IDO expression might be regulated by its substrate, Trp. Similar to our results, increased IDO activity has been observed in the lungs and associated lymph nodes of mice fed increased Trp dosages.²² Although receiving the same dietary Trp dose, PRV-challenged mice had higher serum Trp concentrations than PBS-treated mice, suggesting that the increased systemic Trp might be an adaptive response to immune challenge. This means that when Trp is supplied in lower quantities through the diet, higher amounts of body protein will be catabolized to release the Trp required by the immune system. Regardless of PRV challenge or control treatments, mice fed a high dosage of Trp had higher serum Trp concentrations than those fed a low dosage, indicating the positive role of Trp supplements in attenuating PRV-induced mobilization of body proteins for immune protein synthesis or for the degradation of Trp to catabolites that control Th1 and Th2 immune responses.

Cytokine production is also associated with Ig concentrations. It has been observed in women with recurrent spontaneous abortions that intravenous Ig administration (including IgG) enhances Th2 cytokine polarization and decreases Th1 cytokine concentrations.²³ It would appear that Trp supplements help to create a bias in the Th1/Th2 balance either by acting as a precursor of Ig synthesis or by acting as a substrate for IDO. In addition, it has been proposed that progesterone also plays an important role in the maternal shift of the Th1/Th2 balance.²⁴ Previous studies have shown that the local progesterone levels in the human placenta can directly affect T cell differentiation in the absence of other types of cells and that Th1 development is significantly suppressed by progesterone at concentrations observed in serum during pregnancy.²⁵ In contrast, the induction of IL-10-producing cells was significantly enhanced by progesterone. In the present study, we observed that the concentration of serum progesterone was increased with an increasing dietary Trp level. Although the reason for this is not known, it may provide an additional explanation for how Trp increases Th2-mediated immune responses.

There is growing evidence that rapid innate immune defense against infection usually involves the recognition of invading pathogens by specific pattern recognition receptors attributed to the TLR family.²⁶ Moreover, innate immune responses of the maternal–fetal interface to pathogens can affect the outcome of pregnancy.^27,28 Therefore, we examined the expression of TLR in the uteri and embryos. The results indicated that both TLR3 and TLR9 were expressed in the uteri and embryos of both PRV- and PBS-treated mice. Although they were fed the same diet, PRV-challenged mice had higher uterine and embryonic expression of TLR3 and TLR9 than did PBS-treated controls, indicating that PRV invasion leads to activation of TLR signaling. The stimulation of TLR by the virus leads to the expression and release of pro-inflammatory cytokines such as IFN-γ and ultimately results in inflammation.^29,30 Thus, PRV-induced activation of TLR signaling might provide an explanation for the increased IL-1β and IFN-γ levels. Th2 cytokines are potent down-regulators of TLR expression and Th1 cytokine synthesis to protect against abortion in mice.^2,31 However, Th1 cytokine-mediated apoptosis is promoted in normal circumstances with higher Trp levels.¹¹ It would appear that Trp supplementation might attenuate PRV-induced TLR expression by decreasing the Th1/Th2 cytokine ratio and maintaining the immune balance by preserving intrauterine homeostasis.

In conclusion, a PRV challenge resulted in an increased Trp requirement by pregnant mice. Trp supplements might improve embryonic survival of PRV-infected pregnant mice by down-regulating both TLR expression and pro-inflammatory cytokine synthesis, but at the same time up-regulating the levels of PRV-specific antibodies, anti-inflammatory cytokines, progesterone synthesis, and concentrations of Igs that are beneficial for resisting viral invasion and promoting embryonic development.

Footnotes

Acknowledgments

The Innovative Research Team in University (IRT0555) of China supported this work. We would like to thank the staff at our laboratory for their ongoing assistance.

Author Disclosure Statement

No competing financial interests exist.

References

Christiansen

, Nielsen

, Kolte

. Inflammation and miscarriage. Semin Fetal Neonatal Med, 2006; 11:302–308.

Robertson

, Care

, Skinner

. Interleukin 10 regulates inflammatory cytokine synthesis to protect against lipopolysaccharide-induced abortion and fetal growth restriction in mice. Biol Reprod, 2007; 76:738–748.

Mellor

, Munn

. Immunology at the maternal–fetal interface: lessons for T cell tolerance and suppression. Annu Rev Immunol, 2000; 18:367–391.

Bianchi

ATJ

, Moonen-Leusen

HWM

, van Milligen

, Savelkoul

HFJ

, Zwart

, Kimman

. A mouse model to study immunity against pseudorabies virus infection: significance of CD4+ and CD8+ cells in protective immunity. Vaccine, 1998; 16:1550–1558.

Mateusen

, Van Soom

, Maes

, Favoreel

, Nauwynck

. Receptor-determined susceptibility of preimplantation embryos to pseudorabies virus and porcine reproductive and respiratory syndrome virus. Biol Reprod, 2007; 76:415–423.

Esteban

, Nicolaus

, Garmundi

, Rial

, Rodriguez

, Ortega

, Ibars

. Effect of orally administered l-tryptophan on serotonin, melatonin and the innate immune response in the rat. Mol Cell Biochem, 2004; 267:39–46.

Mellor

, Munn

. Tryptophan catabolism and regulation of adaptive immunity. J Immunology, 2003; 170:5809–5813.

Gershoff

, Gill

, Simonian

, Steinberg

. Some effects of amino acid deficiencies on antibody formation in the rat. J Nutr, 1968; 95:184–190.

Kenney

, Magee

, Piedad-Pascual

. Dietary amino acids and immune response in rats. J Nutr, 1970; 100:1063–1072.

10.

Terness

, Bauer

, Rose

, Dufter

, Watzlik

, Simon

, Opelz

. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites. J Exp Med, 2002; 196:447–457.

11.

Fallarino

, Grohmann

, Vacca

. T cell apoptosis by tryptophan catabolism. Cell Death Differ, 2002; 9:1069–1077.

12.

Pensaert

, Kluge

. Pseudorabies virus (Aujeszky's disease) Virus Infections of Vertebrates, Vol. 2: Virus Infections of Porcines. Pensaert

. Elsevier: Amsterdam, 1989; 39–64.

13.

Official Methods of Analysis, 15th. Association of Official Analytical Chemists: Arlington, VA, 1990.

14.

Hoff

, Rlatg

. Methods of blood collection in the mouse. Lab Anim, 2000; 29:47–53.

15.

, Greenwell

, Brooks

, Calderón-Garcidueñas

, Beall

, Coffin

. Arsenic exposure in pregnant mice disrupts placental vasculogenesis and causes spontaneous abortion. Toxicol Sci, 2007; 99:244–253.

16.

Vogel

, Caron

, Flores

, Weiblen

, Winkelmann

, Mayer

, Bastos

. Distribution of bovine herpesvirus type 5 DNA in the central nervous systems of latently, experimentally infected calves. J Clin Microbiol, 2003; 41:4512–4520.

17.

Sedlmayr

. Indoleamine 2, 3-dioxygenase in materno-fetal interaction. Curr Drug Metab, 2007; 8:205–208.

18.

Burgos

, Ramirez

, Brachet

, Alfaro

, Sastre

, Valdivieso

. Changes in immunoglobulin levels related to herpes simplex virus type 1 brain infection in pregnant mice. J Neurovirol, 2007; 13:233–241.

19.

Chinsakchai

, Molitor

. Immunobiology of pseudorabies virus infection in swine. Vet Immunol Immunopathol, 1994; 43:107–116.

20.

Tanaka

, Mannen

. Pregnancy and parturition of mice latently infected with pseudorabies virus. Exp Anim, 2008; 57:149–152.

21.

Miwa

, Hayakawa

, Miyazaki

, Myojo

, Sasaki

, Sakai

, Takikawa

, Saito

. IDO expression on decidual and peripheral blood dendritic cells and monocytes/macrophages after treatment with CTLA-4 or interferon-γ increase in normal pregnancy but decrease in spontaneous abortion. Mol Hum Reprod, 2005; 11:865–870.

22.

Le Floc'h

, Melchior

, Seve

. The importance of dietary tryptophan for preserving growth and controlling inflammatory response of weaned pigs submitted to immune stress. Int Sci Am Hyg, 2004; 1:239–240.

23.

Sapir

, Carp

, Shoenfeld

. Intravenous immunoglobulin (IVIG) as treatment for recurrent pregnancy loss (RPL) [in Hebrew] Harefuah, 2005; 144:415–420454, 453.

24.

Piccinni

, Giudizi

, Biagiotti

. Progesterone favors the development of human T helper cells producing the Th2-type cytokines and promotes both IL-4 production and membrane CD30 expression in established Th1 cell clons. J Immunol, 1995; 155:128–133.

25.

Hideki

, Makoto

. Direct and indirect inhibition of Th1 development by progesterone and glucocorticoids. J Immunol, 2002; 168:1087–1094.

26.

Aflatoonian

, Fazeli

. Toll-like receptors in female reproductive tract and their menstrual cycle dependent expression. J Reprod Immunol, 2008; 77:7–13.

27.

Zhang

, Wei

, Wu

, Tian

. Toll-like receptor 3 agonist induces impairment of uterine vascular remodeling and fetal losses in CBA×DBA/2 mice. J Reprod Immunol, 2007; 77:61–67.

28.

Koga

, Mor

. Expression and function of Toll-like receptors at the maternal-fetal interface. Reprod Sci, 2008; 15:231–242.

29.

Zhang

, Sun

, Wei

, Wu

, Tian

. Toll-like receptor 3 agonist enhances IFN-gamma and TNF-alpha production by murine uterine NK cells. Int Immunopharmacol, 2007; 7:588–596.

30.

Unterholzner

, Bowie

. The interplay between viruses and innate immune signaling: recent insights and therapeutic opportunities. Biochem Pharmacol, 2008; 75:589–602.

31.

Robertson

, Care

, Skinner

. Interleukin 10 regulates inflammatory cytokine synthesis to protect against lipopolysaccharide-induced abortion and fetal growth restriction in mice. Biol Reprod, 2007; 76:738–748.