Fish Protein Hydrolysates Affect Cholesterol Metabolism in Rats Fed Non-Cholesterol and High-Cholesterol Diets

Abstract

Fish consumption is well known to provide health benefits in both experimental animals and human subjects. Numerous studies have demonstrated the beneficial effects of various protein hydrolysates on lipid metabolism. In this context, this study examined the effect of fish protein hydrolysates (FPH) on cholesterol metabolism compared with the effect of casein. FPHs were prepared from Alaska pollock meat using papain as a protease. Male Wistar rats were divided into the following four dietary groups of seven rats each: either casein (20%) or FPH (10%) + casein (10%), with or without 0.5% cholesterol and 0.1% sodium cholate. Serum and liver lipid levels, fecal cholesterol and bile acid excretions, and the hepatic expression of genes encoding proteins involved in cholesterol homeostasis were examined. In rats fed the FPH diets compared with casein diets with or without cholesterol and sodium cholate, the indexes of cholesterol metabolism—namely, serum cholesterol, triglyceride, and low-density lipoprotein-cholesterol levels—were significantly lower, whereas fecal cholesterol and bile acid excretions were higher. Rats fed the FPH diets compared with casein with cholesterol exhibited a lower liver cholesterol level via an increased liver cholesterol 7α-hydroxylase (CYP7A1) expression level. This study demonstrates that the intake of FPH has hypocholesterolemic effects through the enhancement of fecal cholesterol and bile acid excretions and CYP7A1 expression levels. Therefore, fish peptides prepared by papain digestion might provide health benefits by decreasing the cholesterol content in the blood, which would contribute to the prevention of circulatory system diseases such as arteriosclerosis.

Introduction

E pidemiological studies in Greenland Inuit and Japanese fishing villages suggest that the consumption of fish and marine animals can prevent coronary heart disease.^1,2 Numerous researchers have also reported that regular fish consumption helps prevent atherosclerosis, thrombosis, and sudden cardiac death. These beneficial effects of fish consumption have mostly been attributed to the n-3 polyunsaturated fatty acids, such as eicosapentaenoic acid and docosahexaenoic acid.^3,4 However, total serum cholesterol (CHOL) is not materially affected by n-3 fatty acid consumption; low-density lipoprotein-CHOL (LDL-C) content and high-density lipoprotein-CHOL (HDL-C) content tend to rise slightly, and serum triglyceride content tends to decrease.⁵ These effects of marine n-3 fatty acids are now well established. Normal diets include not only fish oil but also whole fish, which provide many nutrients, such as minerals, vitamins, and protein.

Dietary proteins have been demonstrated to influence the CHOL content of human subjects and animals.^6

–9 For example, soy protein is well known to reduce serum CHOL content relative to casein.¹⁰ Several reports have also demonstrated that peptides prepared through the in vitro digestion of plant proteins exhibited hypocholesterolemic activity in serum, which may result from the increased excretion of fecal CHOL and bile acid.^11,12 These reports also indicated that animal protein hydrolysates prepared by treating pork meat with papain or β-lactoglobulin with trypsin exhibited hypocholesterolemic activity.^13,14 Fish protein hydrolysates (FPH) have many beneficial effects as a result of their antihypertensive,¹⁵ antioxidative,¹⁶ and immunomodulating¹⁷ properties. Few studies have focused on the hypocholesterolemic effects of dietary salmon protein hydrolysates prepared with Protamex™ (Novozymes A/S, Bagsvaerd, Denmark) in the serum and livers of experimental animals.⁷ The hypocholesterolemic effects of salmon protein hydrolysates in rats fed CHOL-containing diets never been examined. Moreover, there have been no studies evaluating the mRNA expression levels of liver CHOL metabolism-associated genes as they relate to the intake of FPH.

Fish proteins play an important role in human nutrition worldwide, and Alaska pollock (Theragra chalcogramma) is one of the most commonly consumed fish worldwide. We prepared Alaska pollock protein hydrolysates using papain. Papain was chosen for the hydrolysis because previous studies suggested that papain-hydrolyzed pork meat had a hypocholesterolemic effect,¹³ whereas pepsin- and trypsin-hydrolyzed pork meat showed no plasma hypocholesterolemic effect.¹⁸ To obtain detailed information on the hypocholesterolemic effect, we evaluated the effects of dietary FPH on lipid metabolism, especially on the serum and liver CHOL levels, along with the mRNA expression levels of enzymes and nuclear receptors related to CHOL metabolism in rats fed experimental diets with and without CHOL. Takahashi¹⁹ has confirmed the positive correlation between mRNA expression levels and the enzyme activities of lipid metabolism. Hence, this study evaluated the influence of enzymes involved in liver CHOL metabolism by measuring mRNA expression levels. This study can be expected to contribute to the development of functional food materials and food chemistry by clarifying the health functionality of FPH.

Materials and Methods

Preparation of fish protein and FPH

Fish fillets of Alaska pollock (T. chalcogramma) were obtained from Suzuhiro Co., Ltd. (Odawara, Japan). The minced fillets were washed three times with cold distilled water and then dried. The resulting meat was treated with cold acetone, ethyl acetate, and n-hexane to remove lipids. The solvents in the meat were evaporated under N₂ gas, and the meat was then homogenized with 10 volumes of 0.02% (wt/wt) papain (W-40; Amano Enzyme, Inc., Nagoya, Japan) at pH 7.0 and incubated at 60°C for 1 hour. The digests were heated to 95°C for 30 minutes to inactivate the papain, and the reaction mixture was then dried using a drum dryer.

The compositions of casein and FPH are presented in Table 1. The crude protein content was determined by the Kjeldahl method. The crude fat content was measured by Soxhlet extraction. The moisture content was estimated as the loss in weight after drying at 105°C for 24 hours. The ash amount was analyzed by direct ignition at 550°C for 24 hours.

Table 1.

Nutrients in Dietary Proteins

	Dietary protein (g/kg)
	Casein	FPH
Crude protein	882	881
Crude fat	15	3
Moisture	72	80
Ash	17	23

Crude protein content was determined by the Kjeldahl method, crude fat content was measured by the Soxhlet method, moisture content was determined as the loss in weight after drying at 105°C for 24 hours, and ash content was determined by direct ignition at 550°C for 24 hours.

FPH, fish protein hydrolysates.

The dietary proteins were hydrolyzed using 6 M HCl for 24 hours. The amino acid composition in the dietary proteins was determined by reversed-phase high-performance liquid chromatography (HPLC) with fluorescence detection using automated precolumn derivatization with o-phthaldialdehyde and 2-mercaptoethanol.²⁰ The identification and quantitation of each amino acid were carried out using commercially available authentic standard mixtures.

The molecular weight (MW) distribution of the FPH was analyzed by gel permeation HPLC using TSKgel G3000SWXL (300-×7.8-mm column) (Tosoh Co., Tokyo, Japan) with ultraviolet detection (UV-8020 spectrophotometer, Tosoh Co.).

Animal study

The experimental protocol was reviewed and approved by the Animal Ethics Committee of Kansai Medical University (Suita, Osaka, Japan) and followed the “Fundamental Guidelines for Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions” (Notice No. 71, issued by the Japanese Ministry of Education, Culture, Sports, Science and Technology, June 1, 2006). Five-week-old male Wistar rats (obtained from Shimizu Laboratory Supplies Co., Ltd., Kyoto, Japan) were housed in plastic cages in an air-conditioned room (temperature, 20–22°C; humidity, 55–60%; lights on 8:00–20:00 hours). After acclimation for 3 days on AIN-93G diets,²¹ the rats were then divided into four dietary groups, as shown in Table 2. The experimental diets were prepared according to the AIN-93G formula, with the CHOL diet containing 5 g/kg CHOL and 1 g/kg sodium cholate. Rats were given free access to the experimental diets and tap water. All of the diet components were products of Oriental Yeast Co., Ltd. (Tokyo).

Table 2.

Composition of the Experimental Diets

	Content (g/kg)
	Non-cholesterol diet		Cholesterol diet
Composition	CAS	FPH	CAS+C	FPH+C
Dextrinized cornstarch	132.0	132.0	132.0	132.0
Cornstarch	397.5	397.5	391.5	391.5
Casein	200.0	100.0	200.0	100.0
FPH^a	—	100.0	—	100.0
Sucrose	100.0	100.0	100.0	100.0
Cellulose	50.0	50.0	50.0	50.0
AIN-93G mineral mixture	35.0	35.0	35.0	35.0
AIN-93 vitamin mixture	10.0	10.0	10.0	10.0
L-Cystine	3.0	3.0	3.0	3.0
Choline bitartrate	2.5	2.5	2.5	2.5
Soybean oil	70.0	70.0	70.0	70.0
Cholesterol	—	—	5.0	5.0
Sodium cholate	—	—	1.0	1.0

Diets were prepared based on the AIN-93G recommendations.²¹

FPH prepared from Alaska pollock fillets using papain.

CAS, casein diet; FPH, FPH diet; CAS+C, casein-containing cholesterol diet; FPH+C, FPH-containing cholesterol diet.

Feces were collected from each group every 24 hours for 7 days prior to sacrifice. After being fed with the experimental diets for 4 weeks, the rats were weighed and sacrificed under pentobarbital (Nembutal^®; Dainippon Sumitomo Pharma Co., Ltd., Osaka) anesthesia. Rats were not fasted before sacrifice because food deprivation before death leads to a significant down-regulation of the genes involved in fatty acid synthesis and CHOL metabolism.²² Blood was collected from the abdominal descending aorta without anticoagulants, and serum was subsequently obtained by centrifugation of the blood at 1500 g for 15 minutes. Liver and abdominal white adipose tissues (WATs) located in the epididymis, mesentery, and perinephria were excised, weighed, and perfused with cold saline. An aliquot of the liver was taken for mRNA expression analysis and stored in RNA-Later Storage Solution (Sigma-Aldrich, St. Louis, MO, USA). All other samples were frozen rapidly in liquid nitrogen and stored at −80°C until analysis.

Analysis of serum, liver, and feces lipid indexes

Serum CHOL, triglyceride (TG), phospholipid, HDL-C, and LDL-C levels were measured in triplicate using an automatic analyzer (model AU5431, Olympus Co., Tokyo).

Total liver lipids were extracted by the method of Bligh and Dyer.²³ Liver CHOL content was determined by gas–liquid chromatography (model GC-14B chromatograph, Shimadzu Co., Kyoto) using 5α-cholestane as an internal standard. Liver TG content was determined using an enzymatic assay kit (Triglyceride-E-Test Wako, Wako Pure Chemical Industries, Ltd., Osaka) after the total liver lipid content was dissolved in an equal volume of dimethyl sulfoxide. Liver phospholipid content was determined by separation using silica gel column chromatography with chloroform and methanol as elution solvents.²⁴ Liver protein content was determined according to the method of Lowry et al.²⁵ using bovine serum albumin as a standard.

Fecal CHOL content was determined by gas–liquid chromatography.²⁶ Fecal bile acid content was measured as the 3α-hydroxysteroid equivalent based on the molar extinction coefficient of NADH at 340 nm.²⁷

Analysis of liver mRNA expression levels

Total RNA was extracted from livers using an RNeasy Mini Kit (Qiagen, Tokyo), and cDNA was then synthesized from the total RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems Japan Ltd., Tokyo). Real-time quantitative reverse transcription polymerase chain reaction (PCR) analysis was performed using an automated sequence detection system (ABI Prism 7000, Applied Biosystems Japan Ltd.). PCR cycling conditions were as follows: 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The mRNA expression levels of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR), CHOL 7α-hydroxylase (CYP7A1), acyl-coenzyme A:CHOL acyltransferase-1 (ACAT-1), sterol regulatory element-binding protein-2 (SREBP-2), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were measured using TaqMan^® gene expression assays (Applied Biosystems Japan Ltd.). PCR primers (HMGR, Rn00565598_m1; CYP7A1, Rn00564065_m1; ACAT-1, Rn00567139_m1; SREBP-2, Rn01502638_m1; and GAPDH, Rn99999916_s1) were purchased from Applied Biosystems Japan Ltd.

The mRNA expression levels of low-density lipoprotein receptor (LDLR), small heterodimer partner-1 (SHP-1), farnesoid X receptor-α (FXRα), liver receptor homolog-1 (LRH-1), and GAPDH were measured using SYBR^® Green PCR Master Mix (Applied Biosystems Japan Ltd.). The PCR solution (25 μL) was composed of 12.5 μL of SYBR Green PCR Master Mix solution, 5 μL of template cDNA, 1 μL of forward primer, 1 μL of reverse primer, and 5.5 μL of RNase-free water. The primer sequences used for detecting LDLR, SHP-1, FXRα, LRH-1, and GAPDH were as follows: LDLR, forward 5′ CACCCCCTCGTTGAAAACCT 3′, reverse 5′ CCTTAGCCAGCTCTTCCAGATC 3′; SHP-1, forward 5′ CGCCTGGCCCGAATC 3′, reverse 5′ GAAGGGTACAGGAGATGTTCTTGAG 3′; FXRα, forward 5′ GGGCCTTGGACGTCTCTGA 3′, reverse 5′ CTGGGATGGTGGTCTTCAAATAA 3′; LRH-1, forward 5′ TCCGGGCAATCAGCAAA 3′, reverse 5′ CCCCATTCACGTGCTTGTAGT 3′; and GAPDH, forward 5′ GAAGACACCAGTAGACTCCACGACATA 3′, reverse 5′ GAAGGTCGGTGTGAACGGATT 3′. The expression signal of GAPDH, a housekeeping gene, served as an internal control for normalization.

Statistical analysis

Data are expressed as mean±SE values for each dietary group of seven rats. To determine the dietary protein, CHOL, and interactions between dietary protein and CHOL, data were analyzed by two-way analysis of variance. Statistical comparisons were made using the Tukey–Kramer test. Differences were considered significant at P<.05. The analyses were performed using StatView-J version 5.0 software (Abacus Concepts, Berkeley, CA, USA).

Results

Amino acid composition and MW of FPH

Amino acid compositions of casein and FPH are presented in Table 3. In FPH, alanine, arginine, aspartic acid, glycine, and lysine levels are high, whereas the proline level is low. However, concentrations of the branched-chain amino acids, valine, leucine, and isoleucine, were nearly identical, and the polarity of amino acids did not reveal any significant differences.

Table 3.

Amino Acid Composition of Dietary Proteins

	Dietary protein (g/kg of protein)
Amino acid	Casein	FPH
Alanine	43	84
Arginine	27	50
Aspartic acid^a	67	105
Cystine	3	5
Glutamic acid^b	183	157
Glycine	30	64
Histidine	25	18
Isoleucine	53	47
Leucine	91	85
Lysine	69	91
Methionine	25	29
Phenylalanine	39	29
Proline	123	37
Serine	62	57
Threonine	44	53
Tyrosine	39	28
Valine	72	55

Aspartic acid + asparagine.

Glutamic acid + glutamine.

The casein was detected mostly as bands (approximately 30 kDa), whereas the FPH was detected at <5 kDa (data not shown).

Growth indexes and organ weights

Initial and final body weights, body weight gain, energy intake, food efficiency ratio, and relative weights of liver and WAT (the sum of epididymal, mesentery, and perirenal WAT) are presented in Table 4. There were no significant differences in any indexes of growth among the groups. The relative liver weights were highest in the FPH group, and WAT weights were lower in the FPH + CHOL-containing diet group than in the FPH-alone diet group (P<.001 and P=.014, respectively).

Table 4.

Initial Body Weight, Final Body Weight, Body Weight Gain, Energy Intake, Food Efficiency Ratio, and Relative Weights of Liver and White Adipose Tissue of Rats Fed the Experimental Diets for 4 weeks

					Two-way ANOVA (P value)
	CAS	FPH	CAS+C	FPH+C	P	CHOL	P×CHOL
Growth parameter
Initial BW (g)	101±3.7	110±2.0	109±3.1	106±2.8	.384	.661	.089
Final BW (g)	307±10.1	319±5.1	314±6.3	317±8.0	.393	.731	.608
BW gain (g/day)	7.3±0.3	7.5±0.1	7.3±0.3	7.6±0.3	.498	.820	.820
Energy intake (kcal/day)	69.3±2.7	72.9±3.2	67.0±1.4	71.4±1.6	.243	.631	.847
Food efficiency (g/kcal)^*	0.106±0.004	0.102±0.002	0.110±0.003	0.106±0.003	.062	.645	.944
Relative organ weights
Liver weight (g/kg of BW)	39.0±1.1^b	37.9±1.0^b	53.9±2.0^a	52.8±1.3^a	.385	<.001	.986
WAT weight (g/kg of BW)^†	45.1±1.8^ab	50.0±1.4^a	44.0±1.9^ab	39.2±1.2^b	.968	.014	.042

Data are mean±SE values (n=7). Food consumption and body weight (BW) were recorded every 2 days. Liver and white adipose tissue (WAT) values were obtained after sacrifice, and weights were measured.

Values in the same row not sharing a common letter are significantly different at P<.05 by the Tukey–Kramer test.

The data were calculated from the BW gain per energy intake.

†

The WAT weight represents the sum of WAT weights from epididymis, mesentery, and perinephria.

ANOVA, analysis of variance; CHOL, cholesterol; P, protein.

Serum, liver, and fecal lipid indexes

The lipid indexes in serum and liver are presented in Table 5. The CHOL-containing diet groups showed significantly increased serum CHOL content compared with the non–CHOL-containing diet groups. The serum CHOL content was significantly (P<.001) lower in the FPH diet groups than in the casein diet groups. Serum TG content in rats fed FPH diets (FPH and FPH+CHOL) was significantly (P<.001) lower than that in rats fed casein diets (casein and casein +CHOL). Rats fed dietary FPH diets (FPH and FPH+CHOL) had significantly higher serum HDL-C levels than rats fed dietary casein diets (casein and casein +CHOL). Serum LDL-C levels in rats in the FPH and FPH+CHOL groups were significantly (P<.001) lower than those in rats in the casein and casein +CHOL groups.

Table 5.

Lipid Indexes in Serum and Liver of Rats Fed the Experimental Diets

					Two-way ANOVA (P value)
	CAS	FPH	CAS+C	FPH+C	P	CHOL	P×CHOL
Serum (mg/dL)^*
CHOL	77.6±2.5^ab	66.0±2.9^c	84.9±3.2^a	72.4±2.1^bc	<.001	.038	.892
TG	33.0±1.2^a	26.4±1.4^b	34.7±1.5^a	29.6±1.3^ab	<.001	.098	.602
HDL-C	57.7±2.6	60.7±2.2	54.0±0.9	59.9±1.4	.036	.277	.477
LDL-C	5.3±0.3^a	4.1±0.2^b	5.7±0.1^a	4.2±0.3^b	<.001	.247	.606
Liver (mg/g of protein)
CHOL^†	35.4±5.7^c	36.0±2.1^c	478±33^a	348±38^b	.029	<.001	.028
TG^‡	266±27^b	234±26^b	1177±65^a	1250±87^a	.932	<.001	.475

Data are mean±SE values (n=7).

abc

Values in the same row not sharing a common letter are significantly different at P<.05 by the Tukey–Kramer test.

The serum was obtained from blood in the portal vein, and lipid contents were then measured using an Olympus model AU5431 automatic analyzer.

†

The liver CHOL content was measured using gas–liquid chromatography.

‡

The liver triglyceride (TG) content was measured by the enzymatic method.

HDL-C, high-density lipoprotein-CHOL; LDL-C, low-density lipoprotein-CHOL.

The CHOL-containing diets increased liver CHOL and TG content compared with the non–CHOL-containing diets (P<.001 for both). Liver CHOL content was significantly lower in rats fed FPH diets (FPH and FPH+CHOL) than in rats fed casein diets (casein and casein +CHOL). There was no significant difference in liver TG content between the casein and FPH diet groups.

Table 6 presents daily fecal CHOL and bile acid excretions for 7 days prior to sacrifice. The CHOL-containing diet groups showed increased fecal CHOL and bile acid content compared with the non–CHOL-containing diet groups (P<.001 for both). Fecal CHOL and bile acid content were significantly (P<.001 for both) higher in the dietary FPH groups (FPH and FPH+CHOL) than in the dietary casein groups (casein and casein +CHOL).

Table 6.

Cholesterol and Bile Acid Contents in Daily Excreted Feces for 7 Days Prior to Sacrifice in Rats Fed Experimental Diets for 4 weeks

					Two-way ANOVA (P value)
	CAS	FPH	CAS+C	FPH+C	P	CHOL	P×CHOL
CHOL (mg/day)	30.0±0.8^c	40.8±1.0^c	135.7±4.3^b	273.6±8.3^a	<.001	<.001	.034
Bile acid (μmol/day)	41.0±1.7^c	98.2±1.3^b	106.3±4.3^b	214.2±6.4^a	<.001	<.001	.025

Data are mean±SE values (n=7). Feces were collected from each group every 24 hours for 7 days prior to sacrifice. The CHOL content was measured using gas-liquid chromatography. The bile acid contents were measured by enzymatic methods.

abc

Values not sharing a common letter are significantly different at P<.05 by the Tukey–Kramer test.

mRNA expression levels

The relative mRNA expression levels related to CHOL metabolism in the liver are presented in Table 7. The CHOL-containing diet groups had significantly (P=.002) higher CYP7A1 expression levels than the non–CHOL-containing diet groups. The CYP7A1 expression level tended to be higher in the FPH+CHOL group compared with the casein +CHOL group, but the difference was not significant. The SHP-1 expression level tended to be lower (P=.055) in the dietary FPH groups (FPH and FPH+CHOL) than in the dietary casein groups (casein and casein +CHOL). The ACAT-1 expression level was significantly (P<.001) higher in the CHOL-containing diet groups than in the non–CHOL-containing diet groups. The CHOL-containing diet groups had a slightly higher LDLR expression level than the non–CHOL-containing diet groups. There were no significant differences in HMGR, SREBP-2, FXRα, and LRH-1 expression levels among the groups.

Table 7.

Effect (Relative Expression Level) of Dietary Casein and Fish Protein Hydrolysate on mRNA Expression Levels of Cholesterol Metabolism Genes in Rats Fed the Experimental Diets for 4 weeks

					Two-way ANOVA (P value)
Gene	CAS	FPH	CAS+C	FPH+C	P	CHOL	P×CHOL
CYP7A1	1.00±0.17^b	1.17±0.20^b	2.88±0.70^ab	3.91±0.93^a	.351	.002	.503
SHP-1	1.01±0.23	0.66±0.07	0.95±0.13	0.79±0.10	.055	.529	.697
HMGR	1.00±0.13	0.96±0.13	0.84±0.10	0.84±0.09	.860	.242	.842
ACAT-1	1.00±0.05^b	1.25±0.07^b	1.85±0.12^a	1.87±0.16^a	.111	<.001	.881
LDLR	1.00±0.12	0.87±0.07	1.14±0.04	1.09±0.06	.308	.045	.663
SREBP-2	1.00±0.09	1.18±0.10	1.13±0.05	0.97±0.05	.766	.912	.079
FXRα	1.00±0.14	1.10±0.14	1.08±0.12	1.03±0.20	.892	.977	.615
LRH-1	1.00±0.15	0.88±0.13	1.08±0.08	0.89±0.11	.231	.706	.778

Data are mean±SE values (n=7). Total RNA was extracted from liver, and mRNA expression levels were determined by real-time polymerase chain reaction analysis using the glyceraldehyde 3-phosphate dehydrogenase mRNA expression level for normalization. mRNA expression levels of each gene are shown relative to the livers of rats fed the non-CHOL diet with casein (=1.00).

Values in the same row not sharing a common letter are significantly different at P<.05 by the Tukey–Kramer test.

ACAT-1, acyl-coenzyme A:CHOL acyltransferase-1; CYP7A1, CHOL 7α-hydroxylase; FXRα, farnesoid X receptor-α; HMGR, 3-hydroxy-3-methylglutaryl-coenzyme A reductase; LDLR, low-density lipoprotein receptor; LRH-1, liver receptor homolog-1; SHP-1, small heterodimer partner-1; SREBP-2, sterol regulatory element-binding protein-2.

Discussion

FPH are already well known to offer many beneficial effects as a result of their antihypertensive,¹⁵ antioxidative,¹⁶ and immunomodulating¹⁷ properties. In fact, the health-promoting effects of FPH have attracted attention throughout the world. In this study, we prepared Alaska pollock protein hydrolysates using papain as a new health functional food material. We chose Alaska pollock (T. chalcogramma) because it is one of the most commonly consumed fish in the world. To elucidate the mechanism underlying the hypocholesterolemic effect of FPH, we evaluated serum, liver, and fecal lipid levels, along with the mRNA expression levels of enzymes and nuclear receptors related to CHOL metabolism, in rats fed experimental diets with and without CHOL.

The major findings of this study were that serum CHOL, TG, and LDL-C contents decreased and the HDL-C content remained unchanged in rats fed the FPH diet compared with rats fed the casein diet (Table 5). It is important to note that serum CHOL content in the FPH+CHOL diet was improved to a normal level (non–CHOL casein diet; casein diet). There has been evidence that the elevation of serum TG and LDL-C contents significantly increases coronary heart disease risk, and there is an inverse correlation between serum HDL-C content and coronary heart disease risk.^28,29 It has been suggested that dietary FPH might aid in the prevention of coronary heart disease and arteriosclerosis through decreasing serum TG, CHOL, and LDL-C contents.

Protein hydrolysates are known to have a bitter taste. However, the energy intake and food efficiency of rats fed FPH were similar to those of rats fed casein (Table 4). Relative liver weight of rats fed the CHOL-containing diets was significantly higher than those of rats fed the non–CHOL-containing diets (P<.001). Liu et al.³⁰ have suggested that rats fed the CHOL diet accumulated excess TG in liver through the increased synthesis and decreased secretion of TG. In this study, the liver TG and CHOL levels of rats fed the CHOL-containing diets were significantly higher than those of rats fed the non–CHOL-containing diets. It was speculated that the increased liver weights in rats fed CHOL-containing diets may primarily be due to lipid accumulation.

Two main arguments have been discussed concerning the effects of dietary protein on serum CHOL levels. One hypothesis relates to the amino acid composition of protein, such as methionine,³¹ cysteine,³² and glycine.³³ In this study, 10% FPH replaced part of the 20% total dietary protein; therefore, the amino acid compositions of the casein and FPH diets were similar. The decreased serum CHOL levels in the dietary FPH groups cannot be explained in terms of differences in amino acid composition. The other hypothesis is that there are differences in the structures of peptides produced during digestion. Nagata et al. ³⁴ demonstrated that the degree of decrease in serum CHOL content depended on the extent of fecal steroid excretion. In addition, previous studies have reported hypocholesterolemic effects of peptides from papain hydrolysate treatment of pork meat¹³ and from microbial proteases hydrolysate of soybean protein¹⁰ through the enhancement of fecal steroid excretion. Therefore, the effects of FPH on serum CHOL content likely resulted from peptides produced during gastric and intestinal digestion of FPH. We therefore analyzed the effects of FPH on fecal CHOL and bile acid excretions. Fecal CHOL and bile acid levels in rats fed the FPH diet were higher by 1.36- and 2.39-fold in rats fed the non–CHOL diet and by 2.02- and 2.01-fold in rats fed the CHOL diet, respectively, than in rats fed the casein diet (Table 5). These results suggest that dietary FPH may effectively inhibit the absorption of CHOL across the jejunal epithelium and bile acids in the ileum. The mechanism for this difference in the inhibition of CHOL and bile acid between casein and FPH is not clear at present. It is necessary to perform further experiments in order to clarify the mechanism of the altered binding capacities of bile acid by hydrophobic binding and micellar solubility of CHOL and bile acid. However, Wergedahl et al. ⁷ have reported that dietary salmon protein hydrolysates prepared by Protamex did not change fecal bile acid excretion in hyperlipidemic obese Zucker rats. As for fecal bile acid excretion, it is not considered to differ based on the use of different enzymes or fish species. Therefore, the effect of dietary FPH on fecal bile acid excretion remains controversial.

CHOL homeostasis is maintained by a balance of its uptake, biosynthesis, catabolism, and excretion. The beneficial effects of dietary FPH on circulating CHOL can be confirmed by examining the expression levels of liver CHOL metabolism enzymes, such as CYP7A1, HMGR, ACAT-1, and LDLR. Moreover, the maintenance of CHOL homeostasis is also regulated by transcription factors and nuclear receptors. This study sought to clarify the effects of FPH on liver transcription factors and nuclear receptors involved in CHOL metabolism, such as SREBP-2, SHP-1, FXRα, and LRH-1. Rats fed the FPH+CHOL diet exhibited a tendency toward increased CYP7A1 expression levels compared with rats fed the casein +CHOL diet, although there was no difference in CYP7A1 expression between the casein and FPH groups. Liver CYP7A1 catalyzes the rate-limiting step of the bile acid synthetic pathway. CYP7A1 expression is negatively regulated by bile acid through SHP-1.³⁵ SHP-1 expression levels were negatively regulated via the inactivation of FXRα by the decreased re-absorption of bile acid.³⁵ It is known that decreased SHP-1 activates LRH-1, which binds to the promoter of CYP7A1 and increases its mRNA expression level. Rats fed FPH had a significantly higher fecal bile acid content (P<.001), whereas their SHP-1 expression levels tended to be lower (P=.055) than those in rats fed casein (Table 7). Liver CYP7A1 expression level, however, was not increased though the enhancement of fecal bile acid, and rats fed dietary FPH tended to exhibit lower SHP-1 expression levels. CYP7A1 expression is positively regulated by hepatocyte nuclear factor-4α and liver X receptor-α³⁶ in addition to the FXRα/SHP-1 pathway. Hepatocyte nuclear factor-4α and LXRα expression levels should be determined to elucidate how CYP7A1 is down-regulated in rats fed the FPH diet.

It was demonstrated here that dietary FPH did not influence the liver gene expression levels of HMGR, LDLR, or SREBP-2, indicating that dietary FPH does not alter CHOL uptake and biosynthesis. The expression level of ACAT-1, which catalyzes the storage of excess CHOL in cells,³⁷ was significantly higher in rats fed the CHOL diets than in rats fed the non-CHOL diets, suggesting that excess liver CHOL resulting from dietary CHOL was stored as cholesteryl ester through the enhancement of the ACAT-1 expression level.

In conclusion, FPH decreased serum CHOL and LDL-C levels and increased fecal CHOL and bile acid amounts when compared with casein. In addition, when rats were fed CHOL diets, the FPH diet improved the serum CHOL level to normal (non-CHOL casein diet; CAS group). Dietary FPH might provide health benefits by decreasing CHOL content in the blood, which would, in turn, contribute to the prevention of circulatory system diseases such as arteriosclerosis.

Footnotes

Acknowledgments

We thank Hayato Maeda of Hirosaki University and Masashi Hosokawa and Kazuo Miyashita of Hokkaido University for their support with the real-time PCR analyses. We are also grateful to Seisuke Sukeithu, Shuhei Yasumaru, and Akira Yoshida of Kansai University for their assistance with lipid analyses.

Author Disclosure Statement

No competing financial interests exist.

References

Bang

, Dyerberg

, Sinclair

. The composition of the Eskimo food in north western Greenland. Am J Clin Nutr, 1980; 33:2657–2661.

Kromhout

, Bosschieter

, de Lezenne Coulander

. The inverse relation between fish consumption and 20-year mortality from coronary heart disease. N Engl J Med, 1985; 312:1205–1209.

Berge

, Madsen

, Vaagenes

, Tronstad

, Göttlicher

, Rustan

. In contrast with docosahexaenoic acid, eicosapentaenoic acid and hypolipidaemic derivatives decrease hepatic synthesis and secretion of triacylglycerol by decreased diacylglycerol acyltransferase activity and stimulation of fatty acid oxidation. Biochem J, 1999; 343:191–197.

Illingworth

, Schmidt

. The influence of dietary n-3 fatty acids on plasma lipids and lipoproteins. Ann N Y Acad Sci, 1993; 676:60–69.

Harris

. n-3 fatty acids and lipoproteins: comparison of results from human and animal studies. Lipids, 1996; 31:243–252.

Zhang

, Beynen

. Influence of dietary fish proteins on plasma and liver cholesterol concentrations in rats. Br J Nutr, 1993; 69:767–777.

Wergedahl

, Liaset

, Gudbrandsen

et al. Fish protein hydrolysate reduces plasma total cholesterol, increases the proportion of HDL cholesterol, and lowers acyl-CoA:cholesterol acyltransferase activity in liver of Zucker rats. J Nutr, 2004; 134:1320–1327.

Shukla

, Bettzieche

, Hirche

, Brandsch

, Stangl

, Eder

. Dietary fish protein alters blood lipid concentrations and hepatic genes involved in cholesterol homeostasis in the rat model. Br J Nutr, 2006; 96:674–682.

Hosomi

, Fukunaga

, Arai

, Nishiyama

, Yoshida

. Effects of dietary fish protein on serum and liver lipid concentrations in rats and the expression of hepatic genes involved in lipid metabolism. J Agric Food Chem, 2009; 57:9256–9262.

10.

Sugano

, Goto

, Yamada

et al. Cholesterol-lowering activity of various undigested fractions of soybean protein in rats. J Nutr, 1990; 120:977–985.

11.

Liyanage

, Han

, Watanabe

et al. Potato and soy peptide diets modulate lipid metabolism in rats. Biosci Biotechnol Biochem, 2008; 72:943–950.

12.

Sugano

, Yamada

, Yoshida

, Hashimoto

, Matsuo

, Kimoto

. The hypocholesterolemic action of the undigested fraction of soybean protein in rats. Atherosclerosis, 1988; 72:115–122.

13.

Morimatsu

, Ito

, Budijanto

, Watanabe

, Furukawa

, Kimura

. Plasma cholesterol-suppressing effect of papain-hydrolyzed pork meat in rats fed hypercholesterolemic diet. J Nutr Sci Vitaminol (Tokyo), 1996; 42:145–153.

14.

Nagaoka

, Futamura

, Miwa

et al. Identification of novel hypocholesterolemic peptides derived from bovine milk beta-lactoglobulin. Biochem Biophys Res Commun, 2001; 281:11–17.

15.

Cinq-Mars

, Hu

, Kitts

, Li-Chan

. Investigations into inhibitor type and mode, simulated gastrointestinal digestion, and cell transport of the angiotensin I-converting enzyme-inhibitory peptides in Pacific hake (Merluccius productus) fillet hydrolysate. J Agric Food Chem, 2008; 56:410–419.

16.

Kim

, Je

, Kim

. Purification and characterization of antioxidant peptide from hoki (Johnius belengerii) frame protein by gastrointestinal digestion. J Nutr Biochem, 2007; 18:31–38.

17.

Duarte

, Vinderola

, Ritz

, Perdigón

, Matar

. Immunomodulating capacity of commercial fish protein hydrolysate for diet supplementation. Immunobiology, 2006; 211:341–350.

18.

Morimatsu

, Kimura

. Hypocholesterolemic effect of partial hydrolysates of pork meat in rats. Nippon Shokuhin Kogyo Gakkai-Shi, 1992; 39:770–777.

19.

Takahashi

. Soy protein and fish oil independently decrease serum lipid concentrations but interactively reduce hepatic enzymatic activity and gene expression involved in fatty acid synthesis in rats. J Nutr Sci Vitaminol (Tokyo), 2011; 57:56–64.

20.

Georgi

, Pietsch

, Sawatzki

. High-performance liquid chromatographic determination of amino acids in protein hydrolysates and in plasma using automated pre-column derivatization with o-phthaldialdehyde/2-mercaptoethanol. J Chromatogr, 1993; 613:35–42.

21.

Reeves

, Nielsen

, Fahey

GC:

Jr . AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition Ad Hoc Writing Committee on the reformulation of the AIN-76A rodent diet. J Nutr, 1993; 123:1939–1951.

22.

Horton

, Bashmakov

, Shimomura

, Shimano

. Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice. Proc Natl Acad Sci U S A, 1998; 95:5987–5992.

23.

Bligh

, Dyer

. A rapid method of total lipid extraction and purification. Can J Biochem Physiol, 1959; 37:911–917.

24.

Rouser

, Kritchevsky

, Simon

, Nelson

. Quantitative analysis of brain and spinach leaf lipids employing silicic acid column chromatography and acetone for elution of glycolipids. Lipids, 1967; 2:37–40.

25.

Lowry

, Rosebrough

, Farr

, Randall

. Protein measurement with the Folin phenol reagent. J Biol Chem, 1951; 193:265–275.

26.

Miettinen

, Ahrens

Jr , Grundy

. Quantitative isolation and gas–liquid chromatographic analysis of total dietary and fecal neutral steroids. J Lipid Res, 1965; 6:411–424.

27.

Bruusgaard

, Sorensen

, Gilhuus-Moe

, Skålhegg

. Bile acid determination with different preparations of 3alpha-hydroxysteroid dehydrogenase. Clin Chim Acta, 1977; 77:387–395.

28.

Mabuchi

, Kita

, Matsuzaki

et al.

Large scale cohort study of the relationship between serum cholesterol concentration and coronary events with low-dose simvastatin therapy in Japanese patients with hypercholesterolemia and coronary heart disease: secondary prevention cohort study of the Japan Lipid Intervention Trial (J-LIT)

Circ J, 2002; 66:1096–1100.

29.

Jacobson

, Miller

, Schaefer

. Hypertriglyceridemia and cardiovascular risk reduction. Clin Ther, 2007; 29:763–777.

30.

Liu

, Huang

. Sources of triacylglycerol accumulation in livers of rats fed a cholesterol-supplemented diet. Lipids, 1995; 30:527–531.

31.

Sugiyama

, Ohkawa

, Muramatsu

. Relationship between amino acid composition of diet and plasma cholesterol level in growing rats fed a high cholesterol diet. J Nutr Sci Vitaminol (Tokyo), 1986; 32:413–423.

32.

Serougne

, Ferezou

, Rukaj

. Effect of excess dietary l-cystine on the rat plasma lipoproteins. Ann Nutr Metab, 1984; 28:311–320.

33.

Katan

, Vroomen

, Hermus

. Reduction of casein-induced hypercholesterolemia and atherosclerosis in rabbits and rats by dietary glycine, arginine and alanine. Atherosclerosis, 1982; 43:381–391.

34.

Nagata

, Ishiwaki

, Sugano

. Studies on the mechanism of antihypercholesterolemic action of soy protein and soy protein-type amino acid mixtures in relation to the casein counterparts in rats. J Nutr, 1982; 112:1614–1625.

35.

Goodwin

, Jones

, Price

et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell, 2000; 6:517–526.

36.

Chiang

. Bile acid regulation of gene expression: roles of nuclear hormone receptors. Endocr Rev, 2002; 23:443–463.

37.

Chang

, Chang

, Cheng

. Acyl-coenzyme A:cholesterol acyltransferase. Annu Rev Biochem, 1997; 66:613–638.