Classification of Sasang Constitutional Body Types Using Immunostimulatory Activities of Constitution-Specific Herbal Extracts in Human Primary Immune Cells

Abstract

Sasang is a Korean traditional constitutional medicine in which individuals are classified into four constitutional types: Taeyangin, Soeumin, Taeumin, and Soyangin. However, the classification of each constitution is empirical and not scientific, and so it is difficult to consistently classify patients into these four constitutional types. Acanthopanacis cortex (AC; Taeyangin), Rehmanniae radix (RR; Soyangin), Ephedra herba (EH; Taeumin), and White ginseng (WG; Soeumin) are herbal medicines that are used to treat and prevent diseases associated with these four constitutions. Therefore, AC, RR, EH, and WG extracts (ACE, RRE, EHE, and WGE) were used as reference extracts to determine constitutional differences in the immunostimulatory activities of primary immune cells isolated from the blood of 15 volunteers. Cellular proliferation, nitric oxide (NO), tumor necrosis factor-α (TNF-α) protein production, TNF-α and interleukin-6, and inducible NO synthase mRNA expression were measured as the immunostimulatory parameters. The increase in cell proliferation of V2, V3, V8, V11, and V12 was highest in EHE-treated lymphocytes among the ACE-, RRE-, EHE- or WGE-treated lymphocytes, and increase in cellular proliferation of V4, V7, V13, V14, and V15 in RRE-treated lymphocytes was significantly better than the other three medicines. The cell proliferation of V1, V5, V6, V9, and V10 responded best to WGE among the four extracts. Results of cell proliferation and other immunostimulatory parameters showed similar trends in regard to individual differences. These extracts may be useful as reference extracts in the development of a rapid and dependable individual lymphocyte- or macrophage-based assay that aids in the Sasang constitutional classification.

Introduction

S asang constitutional medicine (SCM) is a unique form of Korean medicine that was devised by Je-Ma Lee in 1894. SCM originated from the theory that individuals with different types of constitutions respond differently to various herbs and foods, and that those responses can be used to treat and prevent diseases specifically associated with four different constitutions.¹

SCM classifies individuals into four constitutional types, Taeyangin, Taeumin, Soyangin, and Soeumin, on the basis of the strengths and weaknesses of their internal organ functions, physical features, and the body's response to different herbs and foods. These constitutions are characterized by predisposed imbalances in the four major organs, namely the lungs, the liver, the spleen, and the pancreas. The Taeyangin constitution is characterized by large lungs and a small liver, which means that the lung functions are more vigorous, whereas the liver functions are more diminished. In contrast, the Taeumin constitution is characterized by a greater liver function and a less lung function. The Soyangin constitution is characterized by greater spleen functions and smaller kidney functions. This constitutional type is also associated with a weaker upper body relative to the lower body, and thin legs. In addition, people with the Soyangin constitution are rarely overweight, and the area around the chest is well developed. Lastly, the Soeumin constitution is characterized by greater kidney functions and lesser spleen functions. People with this constitution have small physiques and faces and neat features.^2
–4 According to a previous report, the Taeumin constitution accounts for about 50% of the total Korean population, whereas the Soyangin constitution accounts for about 30% of the total Korean population. The Soeumin population is ∼20%.⁵ Interestingly, the population of Taeyangin individuals is extremely low (0.03%–0.1%).⁶ The imbalances in the internal organs that are inherent in these four constitutions can be treated by using oriental herbal medicines that increase the functional strength of the weaker organs.²

Until recently, traditional methods for classification of the Sasang constitution were Questionnaire for Sasang constitution classification II (QSCC II), voice recognition, constitutional pulse diagnosis, and the O-ring test; however, the traditional diagnostic methods used to classify individuals have not yet been validated scientifically, and many patients have been classified into different constitutions when different methods were used.³ The Je-Ma Lee project, which was funded by the Korea Institute of Oriental Medicine from 2005 to perform scientific studies of traditional oriental medicine, was carried out, and through this study, new diagnostic techniques for the classification of constitution by genetic markers were developed; however, this approach is not yet ready for practical use. The very core of the SCM is classification of the Sasang constitution, and so an improved method that is based on scientific evidence is needed to solve the fundamentals of these problems.

Treatment with white ginseng (WG) extract produces different individual responses to cell proliferation, nitric oxide (NO) production, and tumor necrosis factor-α (TNF-α) protein release, which were not observed for treatment with the red ginseng extract.⁷ Raw garlic extract also produces individual differences; however, no obvious differences at the individual level were observed after treatment with black garlic extract on immunostimulatory activity.⁸ The results of these studies showed individual differences in the same food ingredients due to the effect of food components.^7,8 The development of methods to identify the difference between these individuals may be very important for the scientific validation of the Je-Ma Lee's SCM theory.

In general, previous studies have shown that the human constitution is very closely related to the immune response.^7
–9 The proinflammatory cytokines (interleukin [IL]-6, TNF-α, etc.) and proinflammatory mediators (inducible nitric oxide synthase [iNOS], NO, etc.) are secreted as a self-defense mechanism when immune cells are stimulated by various stresses.^10

–15 Cytokines, such as IL-6 and TNF-α, play an important role in this signaling during the course of an immune response to antigens, infections agents, various extracts, and compounds isolated from various extracts in activated immune cells.^7,8,10,16 Cytokines, like IL-6 and TNF-α, induce the expression of iNOS in lymphocytes, which belongs to the NOS family of enzymes that oxidize L-arginine into NO.^11,12 The NOS family consists of neuronal NOS and endothelial NOS, which are constitutively expressed and are essential for maintaining tissue homeostasis. These proinflammatory cytokines, like the proinflammatory mediators iNOS and NO, are known to play significant immunopathological roles in inflammatory diseases.^14,15

Excessive secretion of TNF-α and IL-6 can be harmful to humans by promoting an unwarranted inflammatory reaction. Generation of iNOS and NO during immunostimulatory activity is beneficial to human body functions, but excessive secretion of NO can also result in oxidative stress.^15,17

Individuals categorized as Taeyangin, Taeumin, Soyangin, and Soeumin constitutions have long been effectively treated with Acanthopanacis cortex (AC), Ephedra herba (EH), Rehmanniae radix (RR), and WG, respectively, for the treatment and prevention of diseases by oriental medical doctors.^7,18,19 However, the choice to use these herbal medicines has been based on experience rather than scientific evidence.^7,18,19

Therefore, AC, EH, RR, and WG extracts (ACE, EHE, RRE, and WGE) were selected as samples for the classification of constitutions with the goal of determining their efficacy. Of 40 individuals enrolled in this study, four volunteers were similarly classified by the four traditional SCM diagnostic methods (QSCC II, voice recognition, constitutional pulse diagnosis, and O-ring test), and 11 individuals were classified in the same constituent by three of the traditional SCM diagnostic methods, and so we chose those 15 volunteers for this study. Primary immune cells were isolated from the blood of the 15 volunteers and cultured with ACE, EHE, RRE, and WGE, and the effects of the extracts on cellular proliferation, NO production, and proinflammatory cytokine (TNF-α and IL-6) and mediator (iNOS) expression were analyzed.

Materials And Methods

Volunteers

The study volunteers included 40 students from the Department of Food Science and Biotechnology of the Kangwon National University. They were between the ages of 19 and 30 and did not have any medically diagnosable illnesses. Before participating in the test, the volunteers were given information on the content and procedure of the test, and voluntary written consent was obtained from each subject. All human experiments were approved by the Institutional Review Board for human studies of the Kangwon National University Hospital in Chuncheon. They were divided into the Taeyangin, Taeumin, Soyangin, and Soeumin on the basis of the QSCC II, voice recognition, constitutional pulse diagnosis, and an O-ring test by oriental medical doctors (Table 1).^3,7,9

Table 1.

Classification of the Sasang Constitution of the 30 Volunteers According to the Questionnaire for Sasang Constitution Classification II, Voice Recognition, Constitutional Pulse Diagnosis, and O-Ring Test by Oriental Medical Doctors

	QSCC II	Voice recognition	Constitutional pulse diagnosis	O-ring test	Sex
1	Taeumin	Soyangin	Taeumin	Soyangin	F
2	Taeumin	Soeumin	Soeumin	Soeumin	F	V1
3	Soyangin	Soeumin	Taeumin	Soeumin	M
4	Soeumin	Soyangin	Soeumin	Soeumin	M
5	Taeumin	Taeumin	Taeumin	Taeumin	M	V2
6	Soyangin	Soyangin	Soeumin	Soyangin	F
7	Soyangin	Soeumin	Soeumin	Soyangin	M
8	Taeumin	Taeumin	Taeumin	Taeumin	F	V3
9	Taeumin	Soeumin	Soeumin	Taeumin	M
10	Soyangin	Soeumin	Soeumin	Soyangin	F
11	Taeyangin	Soyangin	Soyangin	Soyangin	M	V4
12	Taeumin	Soyangin	Soeumin	Soyangin	F
13	Soeumin	Soeumin	Soyangin	Taeumin	M
14	Soeumin	Soeumin	Soeumin	Soeumin	F	V5
15	Taeumin	Soyangin	Soeumin	Taeumin	F
16	Soeumin	Soyangin	Soeumin	Soeumin	M	V6
17	Taeumin	Soyangin	Soyangin	Taeumin	M
18	Taeumin	Soyangin	Soyangin	Soyangin	M	V7
19	Soeumin	Soeumin	Soyangin	Soyangin	F
20	Soyangin	Soeumin	Soeumin	Soyangin	F
21	Soeumin	Taeumin	Taeumin	Soeumin	M
22	Taeumin	Soeumin	Taeumin	Taeumin	M	V8
23	Soyangin	Taeumin	Taeumin	Soeumin	F
24	Soeumin	Soyangin	Soeumin	Soeumin	F	V9
25	Taeumin	Taeumin	Soyangin	Soyangin	M
26	Soyangin	Soeumin	Soeumin	Soeumin	F	V10
27	Taeumin	Soeumin	Taeumin	Taeumin	M
28	Taeumin	Soeumin	Taeumin	Soyangin	M
29	Soeumin	Taeumin	Taeumin	Taeumin	M	V11
30	Soeumin	Soyangin	Soeumin	Taeumin	F
31	Taeumin	Soeumin	Taeumin	Soeumin	M
32	Taeumin	Taeumin	Soeumin	Taeumin	M	V12
33	Taeumin	Taeumin	Soyangin	Soyangin	F
34	Soeumin	Soyangin	Soyangin	Soeumin	F
35	Soeumin	Taeumin	Taeumin	Taeumin	F	V13
36	Taeumin	Soyangin	Soeumin	Soeumin	M
37	Taeumin	Taeumin	Soeumin	Soeumin	M
38	Soyangin	Taeumin	Soyangin	Soyangin	F	V14
39	Soeumin	Taeumin	Soeumin	Taeumin	M
40	Soyangin	Soyangin	Soyangin	Soyangin	M	V15

1–40, volunteer number; V1–V15, 15 volunteers in this study; QSCC II, Questionnaire for Sasang Constitution Classification II.

Preparation of herbal medicine extracts

AC, EH, RR, and WG were purchased from a local herbal medicine shop in Chuncheon, cleaned, dried, and ground to fine power before being extracted twice for 24 h at 25°C with 10 volumes of 70% ethanol. After filtration, the 70% ethanol extracts were concentrated using a rotary evaporator (Eyela N-N-series) and then freeze-dried in a lyophilizer (Ilshin Freezer, FD5508). The freeze-dried product was stored at −70°C until use. Before use, the extract was dissolved in a culture medium as a 10.0 mg/mL stock solution and sterilized by membrane filtration through a 0.45-μm filter. Subsequent dilutions were made with the culture medium.

Isolation and culture of lymphocytes and macrophages isolated from blood of 11 healthy volunteers

The methods used for isolation and culture of primary lymphocytes and macrophages isolated from the blood of volunteers were described previously.^7
–9

The blood samples (25 mL) were separated into two 50-mL conical tubes, and the same volume of Dulbecco's phosphate buffered saline (DPBS) was added. Ficoll-Paque was placed below the mixture, and the tubes were centrifuged at 53 g for 15 min. The lymphocyte and monocyte layer was separated and was washed with DPBS three times and centrifuged again at 53 g for 15 min. The pure pellets were then suspended in RPMI 1640, seeded into six-well plastic culture plates, and cultured at 37°C in a humid atmosphere containing 5% CO₂ for 1 h. After this 1-h culture, the suspension of lymphocytes was harvested and washed with RPMI 1640 three times, and the attached monocyte-enriched cell population was placed in RPMI 1640 supplemented with 10 μL granulocyte-macrophage colony-stimulating factor, which promotes the macrophage activity. The primary lymphocytes were used in the cell proliferation assay and were cultured in an RPMI 1640 medium containing 10% fetal bovine serum and 1% penicillin and streptomycin. Moreover, 15 μg/mL con A, which is a T-lymphocyte mitogen, was added on the first day of culture to ensure proliferation of primary T lymphocytes.^7,8,20 Activated macrophages were used to measure TNF-α, IL-6, iNOS, and NO production. The immune cells were then treated as described below to determine the effect of ACE, EHE, RRE, and WGE on cell proliferation, NO production, and proinflammatory cytokine and mediator expression. The immune cells were incubated with a medium containing 83.3 μg/mL ACE, EHE, RRE, or WGE.

Cell proliferation and NO production

The primary lymphocytes and macrophages were cultured at 5×10⁶ cells/mL (200 μL per well) in 96-well plates and treated with 83.3 μg/mL of ACE, EHE, RRE, or WGE. The control was a medium not containing the extract material. After incubating for 24 h, the lymphocytes in the wells were assessed for cell viability by using the MTT assay as described previously,^7,8 and the macrophage culture media were harvested, and NO production was determined using the Griess reagent (1% sulfanilamide in 5% phosphoric acid:1% N-naphthylamine-2HCl in water=1:1 [v/v]). The Griess reagent detects nitrite, which is the stable reaction product of NO and molecular oxygen. The mixtures were then kept at room temperature for 5 min, and the optical density at 570 nm was measured. The nitrite concentration was determined using a standard curve generated with known concentrations of sodium nitrite.

Determination of proinflammatory cytokine and mediator gene expression and TNF-α protein

The primary macrophages were seeded at a density of 5×10⁶ cells/mL (200 μL per well) into 96-well plates and preincubated for 24 h. The culture medium was exchanged with RPMI 1640 containing 83.3 μg/mL ACE, EHE, RRE, or WGE, and the cells were cultured for an additional 24 h. The culture supernatants were collected for determination of TNF-α protein release.

Total RNA was extracted from the oriental medicine extract-treated cells using the Trizol reagent (Invitrogen), according to the manufacturer's instructions for determining mRNA expression levels. For cDNA synthesis, 1 μg of total RNA was reverse-transcribed by using a Superscript II kit (Invitrogen) with the oligo(dT)₁₅ primer according to the manufacturer's recommendations. Polymerase chain reaction (PCR) was performed with a GoTaq^® Green Master Mix PCR kit (Promega) in 20 μL of total reaction mixture containing 1 μL of the RT reaction mixture and 0.5 μL of each primer (forward and reverse, 15 μM). The primers (Bioneer) used in this experiment are shown in Table 2. PCR using the TNF-α primer was performed with an initial cycle of 4 min at 94°C; followed by 40 cycles of 30 sec at 94°C, 30 sec at 54°C, and 30 sec at 72°C; and a final extension for 5 min at 72°C. PCR using the iNOS, IL-6, and 18s rRNA primers was performed similarly, with the exception of the annealing temperature (iNOS, 50°C; IL-6, 48°C; 18s rRNA, 60°C) and the number of cycles (iNOS, 50 cycles; IL-6, 32 cycles; 18s rRNA, 20 cycles). The 18s rRNA transcripts served as internal controls. The PCR products were electrophoresed on 1.5% agarose gels and visualized with ethidium bromide under UV light. The intensities of the bands were analyzed and quantified by SigmaGel software (Jandel Scientific).

Table 2.

List of Primers Used for Reverse Transcription–Polymerase Chain Reaction

Gene		Primer sequence ^a	GenBankAccession No.	Product size (bp)
h-IL-6	Forward	TCAGAACGAATTGACAAACA	M18403	173
	Reverse	TTGAATCCAGATTGGAAGC
h-TNF-α	Forward	GACAAGCCTGTAGCCCATGTTGTA	X02910	480
	Reverse	CAGCCTTGGCCCTTGAAGA
h-iNOS	Forward	GTTCTCAAGGCACAGGTCTC	NM_000625	127
	Reverse	GCAGGTCACTTATGTCACTTATC
18S rRNA	Forward	CGGCTACCACATCCAAGGAA	X03205.1	186
	Reverse	GCTGGAATTACCGCGGCTGC

The primer sequences are shown in the 5′→3′ orientation.

h-IL-6, human interleukin-6; h-TNF-α, human tumor necrosis factor-α; h-iNOS, human inducible nitric oxide synthase.

The concentration of TNF-α protein in the supernatants was measured using an ELISA kit (Human Biotrak ELISA System; Amersham Biosciences), according to the manufacturer's instructions.

Statistical analysis

The data are expressed as means±standard deviation of three to five replicates per experiment. The data were analyzed using the SPSS package (Version 10.0; SPSS). The experiments were repeated at least three times to confirm the results. An analysis of variance was conducted, and Duncan's multiple range tests were used to determine the significance of differences between groups. The level of statistical significance was set to P<.05. The correlation coefficient was used for comparisons between cell proliferation and biomarkers (TNF-α mRNA, TNF-α protein, IL-6 mRNA, iNOS mRNA, and NO), and data were analyzed for statistical significance and correlation coefficient by GraphPad InStat software (Version 3.00; GraphPad InStat, Inc.).

Results

Effect of ACE, EHE, RRE, and WGE on human primary lymphocyte proliferation

Among the 15 volunteers (V1–V15), four volunteers (V2, V3, V5, and V14) were uniformly classified by oriental medicinal doctors using four traditional diagnostic methods, and 11 volunteers were uniformly classified by three of the four traditional SCM diagnostic methods (QSCC II, voice recognition, constitutional pulse diagnosis, and an O-ring test) (Table 1). ACE, EHE, RRE, and WGE have long been used to treat and prevent constitution-specific diseases for Taeyangin, Taeumin, Soyangin, and Soeumin, respectively;^7,18,19 therefore, these extracts were used for classification of constitution in this study.

The effects of ACE, EHE, RRE, and WGE on cell proliferation of lymphocytes isolated from the blood of the 15 volunteers are shown in Table 3. The proliferation of the Taeyangin-specific medicine ACE-treated lymphocytes isolated from the blood of the V4, V6, V7, V9, V11–V15 volunteers was higher than the proliferation of untreated lymphocytes (control) (Table 3), but proliferation was not higher than EHE-, RRE-, or WGE-treated cells. None were classified as Taeyangin based on the results of cell proliferation or the four traditional SCM diagnostic methods (Tables 1 and 3).

Table 3.

Effect of the Acanthopanacis cortex Extract, Ephedra herba Extract, Rehmanniae radix Extract, and White Ginseng Extract on the Cell Proliferation of Primary Lymphocytes Isolated from the Blood of the 15 Volunteers

Volunteers	Control	ACE	EHE	RRE	WGE
V1	100.0±0.2^a	104.3±0.5^a	112.3±0.7^b	116.4±0.6^b	133.2±1.9^c
V2	100.0±0.4^a	104.3±3.7^a	135.8±3.5^c	108.9±6.7^b	108.7±0.7^b
V3	100.0±0.4^a	104.6±2.3^a	153.9±1.1^d	126.7±2.5^c	118.5±0.8^b
V4	100.0±2.0^a	141.5±2.7^d	124.0±2.0^c	148.8±3.6^e	109.3±0.6^b
V5	100.0±1.0^a	104.0±0.6^a	126.7±1.1^c	113.6±1.0^b	157.8±1.7^d
V6	100.0±0.8^a	113.5±0.7^b	118.6±1.7^bc	121.5±2.1^c	140.5±2.5^d
V7	100.0±0.3^a	124.3±0.5^c	108.7±0.4^b	139.1±2.2^d	105.1±0.7^a
V8	100.0±0.3^a	99.8±0.4^a	136.7±1.5^d	104.3±0.5^a	112.5±0.4^b
V9	100.0±1.5^a	118.3±0.9^b	112.8±0.4^b	104.4±0.4^a	134.9±2.2^c
V10	100.0±0.2^a	99.8±0.7^a	112.1±0.7^b	108.2±0.4^b	131.9±0.6^c
V11	100.0±4.9^a	118.1±2.9^b	168.8±2.9^d	124.9±2.9^b	145.1±2.9^c
V12	100.0±2.3^a	118.7±2.1^b	150.4±2.6^c	118.0±0.8^b	121.9±0.5^b
V13	100.0±3.8^a	157.0±8.8^c	128.3±7.7^b	178.9±5.8^d	123.2±5.1^b
V14	100.0±4.6^a	149.8±5.9^c	120.9±2.9^b	178.7±5.1^d	119.1±7.8^b
V15	100.0±3.0^a	147.7±3.0^c	121.9±3.0^b	178.6±5.9^d	120.2±3.0^b

V1–V15, lymphocytes isolated from the blood of the 15 volunteers.

abcd

Means marked by different letters within each row differ significantly from each other (P<.05), as determined by the Duncan's multiple range test (n=9 per individual lymphocyte).

ACE, Acanthopanacis cortex extract; EHE, Ephedra herba extract; RRE, Rehmanniae radix extract; WGE, White ginseng extract.

The proliferation of human primary lymphocytes isolated from the blood of V2, V3, V8, V11, and V12 volunteers was significantly higher when treated with Taeumin-specific herbal medicine EHE than ACE, RRE, or WGE, and the proliferation rates of lymphocytes of V3, V8, V11, and V12 volunteers when treated with EHE were 135.8%±3.5%, 153.9%±1.1%, 136.7%±1.5%, 168.8%±2.9%, and 150.4%±2.6%, respectively (Table 3). The V2, V3, V8, V11, and V12 volunteers were also classified as Taeumin in three or four of the traditional SCM diagnostic methods (Table 1).

Soyangin-specific herbal medicine RRE increased the cellular proliferation of lymphocytes from the V4, V7, V13, V14, and V15 volunteers significantly compared to ACE, EHE, or WGE. RRE-treated lymphocytes from the V4, V7, V13, V14, and V15 volunteers had a proliferation rate of 148.8%±3.6%, 139.1%±2.2%, 178.9%±5.8%, 178.7%±5.1%, and 178.6%±5.9%, respectively. As shown in Table 1, V4, V7, V13, V14, and V15 volunteers were also classified as Soyangin in three of the four traditional SCM diagnostic methods by oriental medicinal doctors (Table 1).

As shown in Table 3, we found that the human primary lymphocytes isolated from the blood of the V1, V5, V6, V9, and V10 volunteers exhibited significantly greater proliferation when cultured with Soeumin-specific medicine WG than with AC, EH, or RR. In addition, the proliferation rates of lymphocytes of the V1, V5, V6, V9, and V10 volunteers were 133.2%±1.9%, 157.8%±1.7%, 140.5%±2.5%, 134.9%±2.2%, and 131.9%±0.6%, respectively. Similarly, the V1, V5, V6, V9, and V10 volunteers were similarly classified by three or four of the four traditional SCM diagnostic methods, as was observed for Soeumin.

Effect of ACE, EHE, RRE, and WGE on the TNF-α protein release, TNF-α mRNA, IL-6 mRNA, and iNOS mRNA expression, and NO production

When the immunostimulatory activity is increased in the immune cells, generation of immunostimulatory cytokines (TNF-α and IL-6) is enhanced.¹⁶

Therefore, we investigated the effects of constitution-specific herbal medicine extracts on proinflammatory cytokines such as TNF-α and IL-6 in primary macrophages isolated from the blood of the 15 volunteers.

TNF-α mRNA levels were found to be higher in ACE-treated macrophages isolated from the blood of V1, V4, V7, V8, V10, V11, V13, V14, and V15 volunteers than the control. TNF-α protein release was also higher when compared with the control in ACE-treated macrophages isolated from the blood of all volunteers, except the V6 volunteer. The TNF-α mRNA and TNF-α protein levels in ACE-treated macrophages were lower than the EHE-, RRE-, or WGE-treated macrophages. No subjects were classified as Taeyangin by traditional SCM diagnostic methods, results that were consistent with the TNF-α mRNA and TNF-α protein release results.

TNF-α mRNA levels were increased in EHE-treated macrophages isolated from the blood of all volunteers except V9, when compared with the controls. TNF-α protein levels were higher in EHE-treated macrophages of all volunteers, relative to the controls. The Taeumin-specific herbal medicine EHE increased the expression of TNF-α mRNA and TNF-α protein significantly better than ACE, RRE, or WGE in primary macrophages isolated from the blood of V2, V3, V8, V11, and V12 volunteers, with the exception of the volunteer V2, who did not respond to ACE, RRE, or WGE treatment in relation to TNF-α mRNA expression. TNF-α mRNA and TNF-α protein release showed similar trends in regard to the classification of V2, V3, V8, V11, and V12 volunteers, who were classified as Taeumin by three or all traditional SCM diagnostic methods.

Treatment of primary macrophages isolated from the blood of the 14 volunteers, except the V9 volunteer (TNF-α mRNA) or the V6 volunteer (TNF-α protein) with RRE, resulted in an increase of TNF-α mRNA and TNF-α protein levels (Figs. 1A, B; 2A, B; and 3A, B). The Soyangin-specific herbal medicine RRE increased the expression of TNF-α mRNA better than ACE, EHE, or WGE in macrophages isolated from the blood of V2, V4, V7, V13, V14, and V15 volunteers. The results of TNF-α protein production were similar to the results observed for TNF-α mRNA expression and constitution classification by traditional SCM diagnostic methods. The one exception was the volunteer V2, who had higher TNF-α mRNA levels after RRE treatment than ACE, EHE, or WGE treatment. Thus, V4, V7, V13, V14, and V15 volunteers were classified as Soyangin.

FIG. 1.

Effect of Acanthopanacis cortex (AC), Ephedra herba (EH), Rehmanniae radix (RR), and White ginseng (WG) extracts (ACE, EHE, RRE, and WGE) on tumor necrosis factor-α (TNF-α) mRNA expression, TNF-α protein production, interleukin-6 (IL-6) mRNA expression, iNOS mRNA expression, and NO production in primary macrophages isolated from the blood of Soeumin (V2, V3, V8, V11, and V12) among the 15 volunteers. (A), (C), and (D) The TNF-α, IL-6, and iNOS mRNA levels in each sample were normalized according to the 18S rRNA (18S) levels. The density of each mRNA band was quantified using SigmaGel software (Jandel Scientific). (B) TNF-α protein levels in the cell culture media were measured by ELISA. (E) Nitrite accumulation was determined as an indicator of NO production in the cultured media. The fold induction (or increase) of TNF-α mRNA, IL-6 mRNA, iNOS mRNA, and nitrite levels in treated cells was calculated as the ratio of the corresponding mean value of the control cells. For each volunteer, means with different letters differ significantly from each other (P<.05), as determined by the Duncan's multiple range test (TNF-α, IL-6, and iNOS mRNA, n=4 per individual macrophage; TNF-α protein and NO, n=9 per individual macrophage).

FIG. 2.

Effect of ACE, EHE, RRE, and WGE on TNF-α mRNA expression, TNF-α protein production, IL-6 mRNA expression, iNOS mRNA expression, and NO production in primary macrophages isolated from the blood of Soyangin (V4, V7, V13, V14, and V15) among the 15 volunteers. (A), (C), and (D) The TNF-α, IL-6, and iNOS mRNA levels in each sample were normalized according to the 18S rRNA (18S) levels. The density of each mRNA band was quantified using SigmaGel software (Jandel Scientific). (B) TNF-α protein levels in the cell culture media were measured by ELISA. (E) Nitrite accumulation was determined as an indicator of NO production in the cultured media. The fold induction (or increase) of TNF-α mRNA, IL-6 mRNA, iNOS mRNA, and nitrite levels in treated cells was calculated as the ratio of the corresponding mean value of the control cells. For each volunteer, means with different letters differ significantly from each other (P<.05), as determined by the Duncan's multiple range test (TNF-α, IL-6, and iNOS mRNA, n=4 per individual macrophage; TNF-α protein and NO, n=9 per individual macrophage).

FIG. 3.

Effect of ACE, EHE, RRE, and WGE on TNF-α mRNA expression, TNF-α protein production, IL-6 mRNA expression, iNOS mRNA expression, and NO production in primary macrophages isolated from the blood of Soeumin (V1, V5, V6, V9, and V10) among the 15 volunteers. (A), (C), and (D) The TNF-α, IL-6 and iNOS mRNA levels in each sample were normalized according to the 18S rRNA (18S) levels. The density of each mRNA band was quantified using SigmaGel software (Jandel Scientific). (B) TNF-α protein levels in the cell culture media were measured by ELISA. (E) Nitrite accumulation was determined as an indicator of NO production in the cultured media. The fold induction (or increase) of TNF-α mRNA, IL-6 mRNA, iNOS mRNA, and nitrite levels in treated cells was calculated as the ratio of the corresponding mean value of the control cells. For each volunteer, means with different letters differ significantly from each other (P<.05), as determined by Duncan's multiple range test (TNF-α, IL-6, and iNOS mRNA, n=4 per individual macrophage; TNF-α protein and NO, n=9 per individual macrophage).

The mRNA and protein levels of TNF-α were enhanced by treatment with WGE in macrophages isolated from the blood of the nine volunteers, except V2 and V12 (TNF-α mRNA), and all volunteers (TNF-α protein). The Soeumin-specific medicine WGE increased the expression of TNF-α mRNA and protein significantly better than ACE, EHE, or RRE in macrophages isolated from the blood of the V1, V5, V6, V9, and V10 volunteers. TNF-α mRNA and protein release showed similar trends in regard to the classification of the Soeumin constitution as traditional SCM diagnostic methods. Thus, we classified V1, V5, V6, V9, and V10 volunteers as Soeumin.

The effects of constitution-specific herbal medicine extracts on IL-6 mRNA expression in macrophages isolated from the blood of the 15 volunteers are shown in Figures 1C, 2C, and 3C. IL-6 mRNA levels by the Taeyangin-specific herbal medicine ACE in macrophages isolated from the blood of V2, V3, V4, V5, V9, V10, V14, and V15 volunteers were significantly higher compared with the untreated control macrophages. The IL-6 mRNA levels after the Taeyangin-specific herbal medicine ACE were lower than the levels observed after EHE, RRE, or WGE treatment in all volunteers.

The IL-6 mRNA levels in macrophages isolated from the blood of V2, V3, V5, V6, V7, V8, V9, V10, V11, and V12 volunteers significantly increased after EHE treatment relative to the untreated macrophages. IL-6 mRNA expression was significantly higher with the Taeumin-specific medicine EHE than with ACE, EHE or WGE treatment in macrophages isolated from the blood of the V2, V3, V8, V11, and V12 volunteers.

The IL-6 mRNA levels increased significantly in macrophages isolated from the blood of all volunteers after Soyangin-specific herbal medicine RRE treatment when compared with untreated control cells. The IL-6 mRNA level of the macrophages from the V4, V7, V13, V14, and V15 volunteers was much higher after RRE treatment than ACE, EHE, or WGE treatment.

Exposure of WGE to macrophages isolated from the blood of all volunteers, except the V7 and V13 volunteers, resulted in higher levels of IL-6 mRNA than the unexposed control. The IL-6 mRNA levels of the WGE (Soeumin-specific medicine extract)-treated macrophages isolated from the blood of the V1, V5, V6, V9, and V10 volunteers was higher than the IL-6 mRNA levels of ACE-, EHE-, or RRE-treated macrophages from some volunteers.

To address whether constitution-specific herbal medicine extracts exhibited different immunostimulatory activities in primary immune cells isolated from the blood of 15 volunteers, functional events mediated by activated immune cells such as the release of a toxic molecule (NO) were investigated, and the mechanism study on the increase in NO was carried out. NOS is synthesized by iNOS.^14,15

Figures 1D, E, 2D, E, and 3D, E show the effects of constitution-specific herbal medicine extracts on proinflammatory mediators, such as iNOS and NO, in primary macrophages isolated from the blood of the 15 volunteers. iNOS mRNA levels were also higher for ACE-treated macrophages isolated from the blood of the V3, V4, V8, V9, V10, V13, V14, and V15 volunteers. Exposure to ACE resulted in NO production that was higher than in the unexposed control. There was no obvious difference in the iNOS mRNA level and NO production in ACE-treated macrophages among volunteers when compared with EHE-, RRE-, or WGE-treated macrophages isolated from the blood of the 11 volunteers.

When macrophages isolated from the blood of 10 volunteers, except V1, V5, V13, V14, and V15, were treated with EHE, a significant increase in iNOS mRNA levels was observed (Figs. 1D, 2D, and 3D). The highest increase in iNOS mRNA levels and NO production was observed for EHE treatment in macrophages isolated from the blood of V2, V3, V8, V11, and V12 volunteers.

iNOS mRNA levels in RRE-treated macrophages isolated from the blood of the V2, V3, V4, V7, V8, V9, V10, V11, V13, V14, and V15 volunteers were upregulated compared with untreated cells (Figs. 1D, 2D, and 3D). Higher levels of NO were obtained when the macrophages isolated from the blood of the 13 volunteers, not including the V3 and V11 volunteers, were exposed to RRE. iNOS mRNA level and NO production of human lymphocytes isolated from the blood of the V4, V7, V13, V14, and V15 volunteers were significantly higher after RRE treatment than ACE, EHE, or WGE treatment.

Treatment of macrophages isolated from the blood of the V1, V5, V6, V7, V8, V9, V10, V11, V13, V14, and V15 volunteers with WGE resulted in increased iNOS mRNA levels when compared with untreated cells (Figs. 1D, 2D, and 3D). WGE significantly increased NO production in macrophages isolated from the blood of all volunteers when compared with untreated cells. WGE treatment increased the iNOS mRNA levels and NO production significantly better than ACE, EHE, or RRE treatment in macrophages isolated from the blood of the V1, V5, V6, V9, and V10 volunteers.

Taken together, the results of this study demonstrate that treatment with the constitution-specific herbal medicine extracts had the same effect on cell proliferation, TNF-α protein release, TNF-α mRNA, IL-6 mRNA, and iNOS mRNA expression, and NO production. In other words, cell proliferation, TNF-α protein release, TNF-α mRNA, IL-6 mRNA, and iNOS mRNA expression, and NO production by Taeyangin-specific herbal medicine ACE treatment was lower than EHE, RRE, or WGE treatment in immune cells isolated from the blood of all volunteers. With the exception of the TNF-α mRNA level of the V2 volunteer, the expression of proinflammatory cytokines (TNF-α mRNA, TNF-α protein release, and IL-6) and mediators (iNOS mRNA, NO) was highest for treatment with the Taeumin-specific medicine EHE when compared with ACE, RRE, or WGE for immune cells isolated from the blood of the V2, V3, V8, V11, and V12 volunteers. Similarly, treatment with the Soyangin-specific herbal medicine RRE resulted in the highest expression of all proinflammatory cytokines and mediators among of the four constitution-specific herbal medicine extracts tested in immune cells isolated from the blood of the V4, V7, V13, V14, and V15 volunteers. In addition, the Soeumin-specific herbal medicine WGE significantly increased the expression of all proinflammatory cytokines and mediators when compared with ACE, EHE, or RRE in immune cells isolated from the blood of the V1, V5, V6, V9, and V10 volunteers.

A positive correlation in Taeumin volunteers (V2, V3, V8, V11, and V12) existed between cell proliferation and TNF-α mRNA expression (r=0.9988, P<.0001) and between cell proliferation and TNF-α protein production (r=0.9893, P=.0013), respectively. There was a positive correlation between cell proliferation and both IL-6 mRNA expression (r=0.8642, P=.0489) and cell proliferation and iNOS mRNA expression (r=0.9607, P=.0093). There was also a positive correlation between cell proliferation and NO production (r=0.9864, P=.0019).

A positive correlation in Soyangin volunteers (V4, V7, V13, V14, and V15) was observed between cell proliferation and biomarker expression, a correlation in cell proliferation and TNF-α mRNA expression (r=0.9429, P=.0163), a correlation in cell proliferation and TNF-α protein production (r=0.9870, P=.0018), a correlation in cell proliferation and IL-6 mRNA expression (r=0.9481, P=.0141), a correlation in cell proliferation and iNOS mRNA expression (r=0.9433, P=.0161), and a correlation in cell proliferation and NO production (r=0.9645, P=.0080), respectively.

In Soeumin volunteers (V1, V5, V6, V9, and V10), a significant and tight positive correlation existed between cell proliferation and TNF-α mRNA expression (r=0.9503, P=.0132) and between cell proliferation and TNF-α protein production, respectively (r=0.9811, P<.0031). There was also a strong, positive correlation between cell proliferation and IL-6 mRNA expression (r=0.9722, P=.0055) and between cell proliferation and iNOS mRNA expression (r=0.9800, P=.0034), respectively. In addition, a strong positive correlation was found between cell proliferation and NO production (r=0.9960, P=.0003).

The cell proliferation results, TNF-α protein release, TNF-α mRNA, IL-6 mRNA, and iNOS mRNA expression, and NO production after constitution-specific herbal medicine extract treatment showed a similar trend with the results obtained from the traditional SCM diagnostic methods. Our results suggest that V2, V3, V8, V11, and V12 volunteers have Taeumin constitutions; V4, V7, V13, V14, and V15 volunteers have Soyangin constitutions; and V1, V5, V6, V9, and V10 volunteers have Soeumin constitutions.

Discussion

Since the Sasang constitutions, which are based on relative strengths and weaknesses in the functions of the major organs, are considered to be uniquely prone to particular diseases and are responsive to specific herbal medicines (i.e., AC, EH, RR, and WG for Taeyangin, Taeumin, Soyangin, and Soeumin, respectively) and constitution-specific food,²¹ it is therefore important to classify individuals into correct constitutions for the effective prevention and treatment of diseases.²² Although SCM has long been used effectively for the treatment of many diseases in Korea, the traditional diagnostic methods used to classify individuals have not yet been validated scientifically. Individuals have been broadly classified with low objectivity and accuracy using traditional diagnostic methods. According to SCM, every person is born with one of four types of constitution, which implies the involvement of heredity in the constitutional makeup and the possible presence of molecular factors determining the constitution.

We hypothesize that the SCM constitutions reflect specific genetic makeups that shape the immune system, and that the ACE, EHE, RRE, and WGE exert their organ-balancing activities by stimulating certain arms of the immune system, thereby inducing specific expressions of certain genes. In particular, we hypothesize that the ACE, EHE, RRE, and WGE induce particular subsets of immune system genes in lymphocytes, and that these expression patterns may be useful for classifying individuals according to the Sasang constitutional classification system. Thus, if this hypothesis is correct, it may be possible to establish rapid, inexpensive, and dependable SCM diagnostic methods. The development of a scientifically based method of classifying individuals into one of the four Sasang constitutions would be useful.

To test this hypothesis, it is most important to find volunteers who have been uniformly classified by all traditional SCM diagnostic methods. In this study, only four volunteers, among the 40 volunteers, were uniformly classified by all four traditional SCM diagnostic methods. Thus, we selected volunteers that were classified in the same across three of the four types of diagnosis methods. Among 40 volunteers in this study, the classification of 15 volunteers was the same using at least three of the four traditional diagnostic methods. These results clearly demonstrated the challenges associated with using the traditional diagnostic methods for the Sasang constitution diagnosis. Thus, scientific methods need to be developed for the classification of Sasang constitutions.

Choi and Oh⁷ analyzed the immunostimulatory activities of the extracts from WG in primary lymphocytes isolated from four constitutions based on the theory of SCM and showed that the immunostimulatory activities of WG in immune cells isolated from the blood of the Soeumin volunteers were higher than those in other constitution. The immunostimulatory activity of cereals, such as rice, brown rice, or glutinous rice, on extract-treated immune cells isolated from Taeumin and Soeumin volunteers was higher than those of immune cells isolated from Taeyangin and Soyangin volunteers.⁹ Thus, the sensitivity and response to a certain herbal medicine may depend on the Sasang type of the individual.

AC, PG, EH, and RR have been shown to enhance the immune responses of people categorized in the Taeyangin, Taeumin, Soyangin, and Soeumin constitutions, respectively.^7,18,19 Thus, we chose constitution-specific herbal medicine extracts, AC, EH, RR, and WG, to assess their potential in categorizing Taeyangin, Taeumin, Soyangin, and Soeumin, respectively, based on activation of primary immune cells isolated from the blood of the 15 volunteers.

We examined whether immune cells isolated from the blood of the 15 volunteers respond better to the constitution-specific medicine than to the medicines that are specific for other constitutions by measuring cell proliferation, proinflammatory cytokines (TNF-α protein, TNF-α mRNA, and IL-6 mRNA), and mediators (iNOS mRNA and NO). To determine the effects of ACE, EHE, RRE, and WGE on cell proliferation, TNF-α protein production and mRNA expression of TNF-α and IL-6, and NO production of immune cells isolated from the blood of these volunteers, the MTT assay and reverse transcription-PCR were performed, respectively. In addition, the Griess reaction and ELISA were used to determine the effect of the constitution-specific herbal medicines on NO production and TNF-α protein generation in macrophages.

Constitution-specific herbal medicine extracts should produce different immune response patterns that are genetically dependent. The immune system plays an important role in the maintenance of homeostasis in vivo, and it is well known that lymphocytes are stimulated to proliferate and produce chemical signals when exposed to natural compounds, plant extracts, and other agents.^23,24

When people take herbal medicine for disease prevention and treatment, water is used for extraction. However, the herbal medicines used in this study were extracted with 70% ethanol, because the yield, antioxidant activity, and immunostimulatory activity were higher than those under the water extraction condition (data not shown).

ACE, EHE, RRE, or WGE treatment produced individual differences in primary immune cells isolated from the blood of the 15 volunteers. The volunteers were divided into three groups based on the immune activity after EHE, RRE, and WGE treatment.

The immune responses to treatment with constitution-specific herbal medicine extracts (ACE, EHE, RRE, and WGE) were consistent across all parameters examined: cell proliferation, proinflammatory cytokines (TNF-α protein, TNF-α mRNA, and IL-6 mRNA), and mediators (iNOS mRNA and NO). Therefore, these extracts may be useful as reference compounds for the development of a rapid and dependable blood immune cell-based assay that can aid in the Sasang constitutional classification. The primary immune cells isolated from the blood of the 15 volunteers may be used to classify Sasang constitution. The results presented in this study support our initial hypothesis. Therefore, it may be possible to generate a scientific assay that would aid in SCM diagnosis. Previous studies on constitution-specific WG and cereal extracts^7,9 are in agreement with the effects of the constitution-specific herbal medicine extracts on immunostimulatory activities observed in this study.

In addition, we classified volunteers as having Taeyangin, Soeumin, Taeumin, or Soyangin constitutions using traditional methods. When volunteers were similarly categorized by three out of four traditional diagnostic methods, we assumed that the classification was correct. Using these criteria, five (V2, V3, V8, V11, and V12 volunteers) were classified as Taeumin (12.5%), five (V4, V7, V13, V14, and V15 volunteers) as Soyangin (12.5%), and five (V1, V5, V6, V9, and V10 volunteers) as Soeumin (12.5%). Taeyangin volunteers could not be reliably identified. The percent Taeyangin, Taeumin, Soeumin, and Soyangin in the Korean population is 0.03%–0.1%, 50%, 30%, and 20%, respectively.⁵ Taeyangin showed a similar trend, but other constitutions showed a different trend in a previous study.^7,9

Conclusions

Fifteen volunteers, among the 40 volunteers enrolled in this study, were similarly classified by three of the four traditional diagnostic methods. Primary immune cells were then isolated from the blood of the 15 volunteers and subjected to analysis. A remarkable consistency in the immune-active responses was observed across all parameters that were measured; the primary immune cells isolated from the blood of V2, V3, V8, V11, and V12 volunteers responded best to the Taeumin-specific medicine EHE, and the immune cells of V4, V7, V13, V14, and V15 volunteers responded best to the Soyangin-specific medicine RRE, and the immune cells of V1, V5, V6, V9, and V10 volunteers responded best to WGE. Thus, oriental medical extracts of EHE, RRE, and WGE are suitable candidates for reference compounds for classification of Taeumin, Soyangin, and Soeumin constitutions, respectively, and the mRNA expression of IL-6, TNF-α, and iNOS and production of NO and TNF-α protein release may be useful output parameters for the development of a rapid and dependable biological assay system that can be used for the Sasang constitutional classification.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

References

Cooper

. Contribution of sasang constitutional medicine. eCAM, 2009; 6:1–3.

, Joo

, Kim

, Lee

, Kim

. Angiotensin converting enzyme gene polymorphism and traditional Sasang classification in Koreans with cerebral infarction. Hereditas, 2003; 138:166–171.

Shim

, Lee

, Kim

, Earm

. Physiome and Sasang constitutional medicine. J Physiol Sci, 2008; 58:433–440.

Jung

, Park

, Chae

et al. Analysis of skin humidity variation between Sasang types. eCAM, 2009; 6:87–92.

Choi

. Sasang constitution and use of mass media and effect study. Korean J J Commun Stud, 2004; 48:218–239.

Lee

, Koh

, Lee

. Sasang constitution as a risk factor for diabetes mellitus: a cross-sectional study. Evid-Based Compl Alt, 2009; 6:99–103.

Choi

, Oh

. Effects of white and red ginseng extracts on the immunological activities in lymphocytes isolated from Sasang constitution blood cells. J Ginseng Res, 2009; 33:33–39.

Purev

, Chung

, Oh

. Individual differences on immunostimulatory activity of raw and black garlic extract in human primary immune cells. Immunopharmacol Immunotoxicol, 2012; 34:651–660.

Choi

, Oh

. Immunological effects of cereal extracts in four different constitutional type. Korean J Food Sci Technol, 2009; 41:572–577.

10.

Belardelli

. Role of interferons and other cytokines in the regulation of the immune response. APMIS, 1995; 103:161–179.

11.

Chang

, Tsai

, Chang

, Chen

. Therapeutic concentrations of propofol protects mouse macrophages from nitric oxide-induced cell death and apoptosis. Can J Anaesth, 2002; 49:477–480.

12.

Hobbs

, Higgs

, Moncada

. Inhibition of nitric oxide synthase as a potential therapeutic target. Annu Rev Pharmacol, 1999; 39:191–220.

13.

Kim

, Huri

, Snyder

. Inducible nitric oxide synthase binds, S-nitrosylates, and activates cyclooxygenase-2. Science, 2005; 310:1966–1970.

14.

Eigler

, Greten

, Sinha

, Haslberger

, Sullivan

, Endres

. Endogenous adenosine curtails lipopolysaccharide-stimulated tumour necrosis factor synthesis. Scand J Immunol, 1997; 45:132–139.

15.

Nathan

, Xie

. Regulation of biosynthesis of nitric oxide. J Biol Chem, 1994; 269:13725–13728.

16.

Kim

, Byeon

, Lee

et al. Immunostimulatory activity of polysaccharides from liquid culture of pine-mushroom Tricholoma matsutake. J Microbiol Biotechnol, 2008; 18:95–103.

17.

Barnes

, Liew

. Nitric oxide and asthmatic inflammation. Immunol Today, 1995; 16:123–130.

18.

Koo

, Kim

. Feature selection from a facial image for distinction of Sasang constitution. Evid-Based Compl Alt, 2009; 6:65–71.

19.

Lee

, Lee

. Stimulatory effects of Korean red ginseng extract on the proliferation and cellular activity of lymphocytes. Korean J Ginseng Sci, 1998; 22:60–65.

20.

Gantner

, Leist

, Lohse

, Germann

, Tiegs

. Concanavalin A-induced T-cell-mediated hepatic injury in mice: the role of tumor necrosis factor. Hepatology, 1995; 21:190–198.

21.

Jeong

, Hong

, Park

et al. Yangkyuk-Sanhwa-Tang induces changes in serum cytokines and improves outcome in focal stroke patients. Vascul Pharmacol, 2002; 39:63–68.

22.

Kim

, Cha

, Jin

, Jeong

. Genetic approach to elucidation of sasang constitutional medicine. eCAM, 2009; 6,S1:51–57.

23.

, Kwon

, Han

et al. Enhancement of immunomodulatory activities of low molecular weight fucoidan isolated from Hizikia fusiforme. Korean J Food Sci Technol, 2008; 40:545–550.

24.

Ryu

, Kim

. Effects of plant water extract mixture (Ixeris sonchifolia Hance, Oenanthe javanica, Fagopyrum esculentum Moench, Hizikia fusiforme, Zingiber officinale Roscoe) on mouse immune cell activation. Korean J Food Nutr, 2007; 20:74–78.