Role of Choline in the Modulation of Degenerative Processes: In Vivo and In Vitro Studies

Abstract

The purpose of the present study was to examine the nutraceutical potential of choline as an added value to its well-known brain nutrient role. Several toxicity, antitoxicity, genotoxicity, antigenotoxicity, and longevity endpoints were checked in the somatic mutation and recombination test in in vivo Drosophila animal model. Cytotoxicity in human leukemia-60 cell line (HL-60) promyelocytic and NIH3T3 mouse fibroblast cells, proapoptotic DNA fragmentation, comet assay, methylation status, and macroautophagy (MA) activity were tested in in vitro assays. Choline is not only safe but it is also able to protect against the DNA damage caused by an oxidative genotoxin. Moreover, it improves the life extension in the animal model. The in vitro results show that it is able to exhibit genetic damage against leukemia HL-60 cells. Single-strand breaks in DNA are observed at the molecular level in treatments with choline, although only a significant hypermethylation on the long interspersed elements-1 and a hypomethylation on the satellite-alpha DNA repetitive DNA sequences of HL-60 cells at the lowest concentration (0.447 mM) were observed. Besides, choline decreased MA at the lower assayed concentration and the MA response to topoisomerase inhibitor (etoposide) is maintained in the presence of treatment with 0.22 mM choline. Taking into account the hopeful results obtained in the in vivo and in vitro assays, choline could be proposed as a substance with an important nutraceutical value for different purposes.

Introduction

Choline is a natural amine classified in the vitamin B complex and is a precursor for many other biologically important molecules. It was officially recognized as an essential nutrient important in the diet by the Institute of Medicine in 1998,¹ its requirement extending into adulthood and old age.² Choline is synthesized in the liver. It is present in several foods, with liver, egg, and wheat germ among the best dietary sources of choline.³

Choline is important for brain development as it is a precursor for the neurotransmitter acetylcholine, which is essential for the activity of cholinergic neurons.^4,5 Choline is important for reducing the risk of neural tube defects⁶ for memory development⁷ and it has also been demonstrated to be an essential element for survival and normal growth of cultured cells.^8

–11 In primary neuronal cortical cell cultures, inhibition of phosphatidyl choline synthesis through N-methyl-d-aspartate receptor is a key early event in the process of cellular excitotoxicity that leads to necrotic cell death¹² due to cytoplasmic membrane damage caused by increased hydrolysis of membrane phospholipids.¹³ Furthermore, similar to folic acid, genomic stability has been attributed to choline¹⁴ because both are methyl donors and a high choline diet has been associated with a decreased risk of breast cancer.¹⁵

On the other hand, studies have shown that choline deficiency may have adverse effects such as increased DNA damage and apoptosis in lymphocytes,¹⁶ increased plasma homocysteine levels, which have been associated with cardiovascular disease,¹⁷ cognitive decline,¹⁸ bone fractures,¹⁹ development of fatty liver and liver muscle damage,²⁰ and a reduced secretion of liver triglyceride, resulting in accumulation of liver triglycerides,²¹ among other pathologies.

Despite the beneficial effects of a daily intake of choline, a greater intake than the recommended dosage has been associated with harmful effects such as nausea and diarrhea,²² body odor, sweating and salivation,^23
–25 hypotension,²⁶ hepatotoxicity,²⁷ and dermatitis.²⁸ In rare cases, a large amount of choline consumption has been associated with depression²⁹ and with exacerbated symptoms of parkinsonian patients.³⁰

Wide range of factors affect the dietary choline requirements, such as the work of choline in concert and interaction with other nutrients,⁵ the gender,³¹ the physical activity of individuals,^32,33 the bioavailability of choline,³⁴ and the genetic polymorphisms,³⁵ among others.

Many nutrients can be considered as a nutraceutic because of their additional biological activities mostly related to delaying degenerative processes. A nutraceutical substance should be able to prevent genetic oxidative damage, increase life span in normal cells/organisms, and induce clastogenic injuries in tumor cells. In this study, we have tested the nutraceutical potential of choline. Several points related to degenerative processes have been checked: (i) in vivo assays using the Drosophila model, as 70% of human disease genes are conserved in this organism,³⁶ to evaluate the toxicity, antitoxicity, genotoxicity, antigenotoxicity, and longevity induction and (ii) in vitro assays to evaluate the cytotoxic, DNA-induced damage activity, methylation status, and macroautophagy activity in the human leukemia-60 cell line (HL-60) promyelocytic and immortalized NIH3T3 cell models.

The main aim of our study is to identify the possible nutraceutical potential of choline on the degenerative process to propose it as a substance with therapeutic potential and consider it not only as an essential element for daily intake. For that purpose, we fed Drosophila melanogaster with different concentrations of choline and we analyzed the survival percentage, the mutagenic effect, the protection against H₂O₂, and the extension of life span. Moreover, using in vitro models of human leukemia cells (HL-60) and mouse fibroblast cells (NIH3T3), we studied the effect of choline on growth inhibition of tumoral cells, DNA damage (internucleosomal fragmentation as double-strand breaks DNA laddering associated with activation of the apoptotic pathway or single/double-strand breaks in cells), the modulation of methylation status, and the macroautophagy (MA) activity.

Materials and Methods

Simple compound

Different concentrations of choline (Fluka; 26980-50G) were tested (0.447, 0.895, 1.791, 3.581, and 7.163 mM) taking into account the average daily food intake of D. melanogaster (1 mg/day) and the average body weight of D. melanogaster (1 mg).³⁷ The concentration range was calculated to make it comparable with the daily tolerable upper intake for humans (3.5 g/day)^38,39 and higher concentrations were also assayed to study the possible nutraceutical potential of choline.

In vivo assays

Drosophila melanogaster strains

Two Drosophila strains were used, each with a hair marker in the third chromosome:

• multiple wing hairs genetic marker (mwh)/mwh, carrying the recessive mutation mwh (multiple wing hairs) that produces multiple tricomas per cell instead of one.⁴⁰

• flare genetic marker (flr³ )/In (3LR) TM3, rip^psep bx^34ee^sBd^S , where the flr³ (flare) marker is a homozygous lethal recessive mutation that produces deformed tricomas, but is viable in homozygous somatic cells once larvae start the development.⁴¹

Strains were maintained at 25°C and 80% humidity in glass tubes with a homemade meal (0.5 g NaCl, 12 g agar-agar, 100 g yeast, 25 g sucrose, 5 mL propionic acid, 3.5 mL of 0.2% streptomycin sulfate solution, and 1 L of water), making changes three times per week.

Virgin females were obtained from these tubes and were crossed to perform the crosses for the different assays of toxicity, antitoxicity, genotoxicity, antigenotoxicity, and longevity.

Toxicity and antitoxicity assays

Survival percentages of treated Drosophila were studied in the toxicity assays [(number of individuals born in each treatment/number of individuals born in the negative control) × 100]. We assayed five concentrations of choline ranged between 0.447 and 7.16 mM. The antitoxicity tests consisted of combined treatments of the same concentrations as in the toxicity assays by adding the H₂O₂ at 0.12 M (Sigma; H1009).⁴² The negative controls were prepared with medium and distilled water and positive controls with medium and H₂O₂.⁴³ Three independent experiments were carried out for each assay. Chi-square test in a Microsoft Office Excel 2007 was used to determine if the tested compounds significantly inhibited the survival of flies, with respect to the control and among the concentrations. In the toxicity assay, statistical chi-square values (P < .05) for the different concentrations tested were obtained by comparing the different concentrations with respect to the negative control, whereas statistical chi-square values of antitoxicity assays were obtained by comparing the different concentration values with respect to the positive control.

Genotoxicity and antigenotoxicity assays (somatic mutation and recombination test)

The genotoxicity assays were carried out following the method described by Graf et al. by crossing transheterozygous larvae for mwh and flr³ genes.⁴⁴ The treatment tubes contained 0.85 g of Drosophila Instant Medium (Formula 4–24; Carolina Biological Supply) and 4 mL of solutions with 0.447 and 7.16 mM of choline. The antigenotoxicity tests were performed by combining 0.12 M H₂O₂ and the same concentrations used in genotoxicity assays of choline.

Wings of emerging transheterozygous individuals (mwh flr⁺/mwh⁺ flr³ ) for each control and concentration were mounted on slides using Faure's solution (30 g gum Arabic, 20 mL glycerol, 50 g chloral hydrate, and 50 mL water) and scored under a photonic microscope at 400 × magnification. Similar numbers of male and female wings were mounted and wing hair mutations were scored from a total of 24,400 monotricoma wild-type cells per wing.⁴⁵ In the balancer-heterozygous genotypes (mwh/TM3, Bd^S), mwh spot phenotypes are produced predominantly by somatic point mutation and chromosome aberrations since mitotic recombination between the balancer chromosome and its structurally normal homolog is a lethal event. Wing hair spots were grouped into three different categories: a small single spot corresponding to one or two cells exhibiting the mwh phenotype and occur in the late stages of mitotic division; a large single spot with three or more cells showing mwh or flr³ phenotypes and occur in the early stages of larval development; or a twin spot corresponding to two juxtapositioning clones, one showing the mwh phenotype and other the flr³ phenotype. Small and large spots are originated from somatic point mutation, chromosome aberration, and somatic recombination, while twin spots are produced exclusively by somatic recombination between the flr³ locus and the centromere.

A total of 25–44 wings were mounted and analyzed for the different treatments. The total number of spots was determined and a multiple decision procedure was applied to determine whether a result is positive, inconclusive, or negative.⁴⁶ The frequencies of each type of mutant clone per wing were compared with the concurrent control and analyzed applying the binomial Kastenbaum and Bowman test,⁴⁷ without Bonferroni correction and at 5% level of significance. All inconclusive results were analyzed with the nonparametric U-test of Mann–Whitney and Wilcoxon (α = β = 0.05). The inhibition percentages (IPs) for combined treatments were calculated from total spots per wing with the following formula⁴⁸: \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document} \begin{align*}{ \rm IP} = & [ ( { \rm single \ genotoxin} - { \rm combined \ treatment} ) / \\ & { \rm single \ genotoxin} ] \times 100\end{align*} \end{document}

Life span assays

All experiments were carried out at 25°C according to the procedure described by Tasset-Cuevas et al.⁴⁹ Sets of 10 adult individuals of the same gender were selected and placed into sterile vials containing 0.21 g of Drosophila Instant Medium and 1 mL of different concentrations of choline solution (0.447, 0.895, 3.581, and 7.16 mM). Four replicates were followed during the complete life span for each control and the established concentrations. Alive animals were counted and the respective media renewed twice a week.

To know the quality of life of treated Drosophila in longevity trials, the upper 25% of life span survival curves was studied. This part of the life span is considered as the health span of a curve, characterized by low and more or less constant age-specific mortality rate values.⁵⁰

The statistical treatment of survival data for each control and concentration was assessed with the SPSS Statistics 17.0 software (SPSS, Inc.), applying the Kaplan–Meier method. The significance of curves was determined using the log-rank method (Mantel-Cox).

In vitro assays

Cell culture conditions

The promyelocytic human leukemia cell line HL-60 was grown in RPMI-1640 medium (Sigma; R5886) supplemented with heat-inactivated fetal bovine serum (Linus; S01805), l-glutamine (Sigma; G7513), and antibiotic–antimycotic solution (Sigma; A5955). Cells were incubated at 37°C in a humidified atmosphere of 5% CO₂. The cultures were plated at 2.5 × 10⁴ cells/mL density and passed every 2 days.

The NIH3T3 cell line, derived from mouse fibroblast cells, was cultured at 37°C, 95% humidity, and 5% CO₂ in complete Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% (v/v) heat-inactivated newborn calf serum (Gibco) and 1% penicillin/streptomycin/Fungizone mix. The cell cultures were passaged every 3–4 days by trypsinization (0.05%). Only passages 10–25 were used.

The use of these two types of cells will allow us to study the effect of choline on promyelocytic leukemia and on an immortalized fibroblast cell model line. Although they belong to different organisms (human and mouse), results complemented each other and cytotoxicity assays will be comparable.

Cytotoxicity assay

HL-60 cells were placed in 96-well culture plates (2 × 10⁴ cells/mL) and treated for 72 h with choline 0.447–7.16 mM. Cell viability was determined by the trypan blue dye (Sigma; T8154) exclusion test in a Neubauer chamber at 100 × magnification (AE30/31; Motic). Curves were plotted as survival percentage of three independent experiments with respect to the control growing for 72 h.

NIH3T3 cells were plated in 96-well flat-bottom plates (BD Biosystems) at 1 × 10⁴ cells per well and treated for 24 h with choline 0.223–7.16 mM. Cell viability was measured using the CellTiter-Blue Cell Viability Assay (Promega). After treatments, 20 μL of CellTiter-Blue Reagent was added to each well and cells were cultured for 2 h as changes in fluorescence at 540 nm excitation and 590 nm emission wavelengths were measured using a Tecan, Infinite M200Pro microplate reader. Fluorescence intensity values were normalized to values of untreated cells. Curves were plotted as survival percentage of three independent experiments with respect to the control growing for 24 h.

Determination of DNA fragmentation

DNA internucleosomal fragmentation is observed by DNA laddering and it is associated with activation of the apoptotic pathway in cancer cells as a hallmark of apoptosis affecting genomic integrity.⁵¹ HL-60 cells (1 × 10⁶ cells/mL) were treated with different concentrations of choline for 5 h. Treated cells were collected and centrifuged at 603.72 × g for 5 min, and DNA was extracted as follows: the cell pellet was resuspended in 900 μL of cell lysis buffer pH 8.0 (10 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid [EDTA], 100 mM NaCl) and 100 μL of sodium dodecyl sulfate 10% and 25 μL of proteinase K solution (20 mg/mL) were added and incubated with shaking for 5 h at 55°C. After this, 432 μL of 5 M NaCl was added and the samples were centrifuged at 11,336.52 × g for 15 min. Supernatant was recovered into a fresh tube and 750 μL of cold isopropanol was added to precipitate DNA. Then, samples were centrifuged at 11,336.52 × g for 10 min, washed with 1 mL of 70% ethanol, and DNA dried and resuspended in 20 μL of deionized water. Finally, 0.6 μL of 0.4 mg/mL RNase was added and incubated at 37°C (6.0372 × g) overnight. Total extracted DNA was quantified in a spectrophotometer (Nanodrop ND-1000) and 1200 ng of DNA was subjected to 2% agarose gel electrophoresis at 80 mA for 25 min, stained with ethidium bromide, and visualized under UV light.

Comet assay

The DNA strand break induction was determined by the alkaline comet assay (pH <13), following the method previously described^52
–54 with some modifications. Cells were treated with choline (0.895, 1.791, and 7.16 mM) for 5 h. After washing steps in phosphate-buffered saline, a concentration of 6.25 × 10⁵ cells/mL was mixed with 0.75% low-melting point agarose (Sigma; A4018) and transferred to frosted-end slides. The slides were bathed in lysis solution (2.5 M NaCl, 100 mM Na-EDTA, 10 mM Tris, 250 mM NaOH, 10% dimethyl sulfoxide, and 1% Triton X-100; pH 13) for 1 h at 4°C and immersed into alkaline electrophoresis buffer (300 mM NaOH and 1 mM Na-EDTA; pH 13) for 20 min at 4°C. Then, electrophoresis (20 V, 400 mM for 15 min) was performed and slides were submerged into neutralization buffer (0.4 M Tris-HCl buffer; pH 7.5). Finally, slides were dried overnight at room temperature in the dark. DNA of 50–100 single cells was visualized by treating slides with 7 μL of a 10 μg/mL stock solution of propidium iodide (Sigma; P4170).⁵³ Comet images were analyzed at 400 × magnification using a Leica DM 2500 fluorescence microscope with green filter and an attached camera (JAI CV-M4CL). The OpenComet plugging from ImageJ (NIH) was used to score individual parameters for each cell.

Statistical analysis of data was performed using SPSS Statistics 17.0 software. The main parameters of comet imaging are total DNA, % of DNA in the comet and tail, tail length, and tail moment (TM). The latter is the single most relevant index of DNA damage, which is calculated as the percent DNA in the tail multiplied by the distance between the means of the head and tail distributions.^52,53 Moreover, TM is considered appropriate for regulatory or interlaboratory comparison studies.⁵⁵ The TM data were analyzed applying a one-way analysis of variance (ANOVA) and post hoc Tukey's test to determine the effect of choline on HL-60 cell DNA integrity. P ≤ .05 was considered statistically significant.

Methylation status

Genomic DNA was isolated in the same way as described in the DNA fragmentation section. Bisulfite-modified DNA from the 0.447 and 7.163 mM choline treatments, using the EZ DNA Methylation-Gold Kit, was used as a template for fluorescence-based, real-time, quantitative methylation-specific PCR (qMSP). The final reaction mixture with a total volume of 10 μL consisted of 2 μL of deionized water, 5 μM each of forward and reverse primers, 2 μL of iTaq Universal SYBR Green Supermix (Bio-Rad; containing antibody-mediated hot-start iTaq DNA polymerase, dNTPs, MgCl₂, SYBR Green I dye, enhancers, stabilizers, and a blend of passive reference dyes, including ROX and fluorescein), and 25 ng of bisulfite-converted genomic DNA.

qMSP conditions were as follows: one step at 95°C for 3 min, 45 cycles at 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, another step at 95°C for 30 s, followed by a 65°C step during a period of 30 s, and finally a boost step from 65°C to 95°C for 95 s increasing 0.5°C per 0.05 s. qMSP was carried out in 48-well plates in MiniOpticon Real-Time PCR System (MJ Mini Personal Thermal Cycler; Bio-Rad) and was analyzed by Bio-Rad CFX Manager 3.1 software.

We selected repetitive elements to analyze a wide range of human genomic DNA. While Alu and long interspersed element (LINE) sequences are interspersed throughout the genome, satellite DNA is confined to the centromere areas.^56

–59 All sequences had been obtained from Isogen Life Science. Alu M1, LINE-1, and satellite-alpha DNA (Sat-α) sequences were used (see Table 1 for detailed information⁶⁰).

Table 1.

Primer Information

						GC content (%)
Reaction ID	GenBank number	Amplicon start	Amplicon end	Forward primer sequence 5′ to 3′ (N)	Reverse primer sequence 5′ to 3′ (N)	Forward	Reverse
ALU-C4	Consensus sequence	1	98	GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA (36)	ATTAACTAAACTAATCTTAAACTCCTAACCTCA (33)	25	27.3
ALU-M1	Y07755	5059	5164	ATTATGTTAGTTAGGATGGTTTCGATTTT (29)	CAATCGACCGAACGCGA (17)	27.6	58.8
LINE-1	X52235	251	331	GGACGTATTTGGAAAATCGGG (21)	AATCTCGCGATACGCCGTT (19)	47.6	52.6
SAT-α	M38468	139	260	TGATGGAGTATTTTTAAAATATACGTTTTGTAGT (34)	AATTCTAAAAATATTCCTCTTCAATTACGTAAA (33)	23.5	21.2

Source from Weisenberger et al. ⁶⁰

Sat-α, satellite-alpha DNA; LINE, long interspersed elements.

The relative yielded results were normalized with the housekeeping sequence Alu C4 using the Nikolaidis et al. ⁶¹ and Liloglou et al. ⁶² comparative CT method. Each sample was analyzed in triplicate. One-way ANOVA and post hoc Tukey's tests were used to evaluate the differences between the tested compound, repetitive elements, and concentrations.

MA activity evaluation

MA activity in NIH3T3 cells was evaluated as follows: for mCherry-GFP-LC3 conversion, NIH3T3 fibroblasts were transduced with a lentivirus carrying the tandem construct and cells were analyzed at least 1 week after transduction to assure stable expression; 1 × 10⁴ cells were plated per well in glass-bottom 96-well plates and fluorescence after the indicated treatments was read in both channels using a high-content microscope (Operetta; Perkin Elmer). Moreover, the cytotoxic anticancer stressor, etoposide (Etopo; 25 μM), was added to NIH3T3 cells to analyze the growing behavior of cells treated with choline. Images of nine different fields per well were captured, which rendered an average of 2000–3000 cells counted. Nuclei, cell perimeter, and puncta were identified using the manufacturer's software Columbus 2.4.2. Puncta positive for both fluorophores correspond to autophagosomes, whereas those only positive for the red fluorophore correspond to autolysosomes. Autophagic flux was determined as the conversion of autophagosomes to autolysosomes (red-only puncta).

The statistical significance of MA activity for each concentration was determined using Student's t-test with the SPSS Statistics 17.0 software (SPSS, Inc.).

Results

Toxicity and antitoxicity

Figure 1A shows the relative percentage of emerging adults after toxicity treatments with larvae with different concentrations of choline. A nonsignificant survival rate compared with the control is shown.

FIG. 1.

Toxicity (A) and antitoxicity (B) levels of choline in Drosophila melanogaster. Data are expressed as percentage of surviving adults with respect to 300 untreated 72-h-old larvae from three independent experiments treated with different concentrations of choline (A) and combined treatments with 0.12 M H₂O₂ (B). *Significant differences with respect to the positive control; ^abPairwise comparison among concentrations.

The antitoxicity assays revealed the ability of choline to protect individuals against oxidative stress at concentrations of 0.895–7.16 mM. Figure 1B shows that the positive control H₂O₂ was toxic at 0.12 M with an average survival rate of 62% with respect to the water control. On the other hand, choline showed a positive dose–response effect in the combined treatments at high concentrations.

Genotoxicity and antigenotoxicity

Table 2 shows the results of genotoxicity and antigenotoxicity assays in the somatic mutation and recombination test. Negative control showed a frequency of mutations per wing of 0.157, which falls into the historical range for the wing spot test.^63,64 The concentration of H₂O₂ used (0.12 M) has been demonstrated to exert a potent genotoxic effect capable to induce somatic mutations and mitotic recombination in D. melanogaster ⁶⁵ at a rate of 0.388 spots/wing. Choline seems to have no genotoxic effect at the tested concentrations with mutation rates not significantly different from that of water control (0.200 and 0.171 spots/wing for the highest and lowest concentrations, respectively). Moreover, choline was able to inhibit the genotoxic activity of H₂O₂ in a dose-dependent manner (41.5% and 66.2% for the lowest and highest concentrations, respectively).

Table 2.

Genotoxicity and Antigenotoxicity of Choline in the Drosophila Wing Spot Test

	Clones per wing (no. spots) ^a
Compound	Number of wings	Small single clones (1–2 cells) m = 2	Large simple clones (more than two cells) m = 5	Twin clones m = 5	Total clones m = 2	Mann–Whitney U-test ^b	Inhibition percentage (%) ^c
H₂O	38	0.157 (6)	0	0	0.157 (6)
H₂O₂	36	0.305 (11)	0.083 (3)	0	0.388 (14) +
Simple treatment
Choline (mM)
[0.447]	41	0.097 (4)	0.073 (3)	0	0.171 (7) i	Δ
[7.16]	25	0.200 (5)	0	0	0.200 (5) i	Δ
Combined treatment with H₂O₂ (0.12 M)
Choline (mM)
[0.447]	44	0.182 (8)	0.045 (2)	0	0.227 (10) λ		41.5
[7.16]	38	0.079 (3)	0.052 (2)	0	0.131 (5) λ		66.2

+ (positive) and i (inconclusive) versus negative control; λ (significantly different) versus positive control.

Levels of significance α = β = 0.05, tail test without Bonferroni correction. Inconclusive results were resolved by U-test of Mann–Whitney and Wilconxon.

Statistical diagnosis according to Frei and Wurgler.⁴⁶

Inconclusive results were resolved by Mann–Whitney U-test. Delta marker (Δ) means no differences between the treatment and the negative control.

The inhibition percentages for the combined treatments were calculated from total spots per wing according to Abraham.⁴⁸

Longevity assays

The entire life span curves obtained by the Kaplan–Meier method for each substance and concentration are shown in Figure 2A. Choline induced a life span extension in D. melanogaster with an average range of 57.2–62.1 days for the different concentrations of choline with respect to the control (47 days on average) (Table 3).

FIG. 2.

Survival parameters of Drosophila melanogaster fed with different concentrations of choline. (A) Survival curves, (B) health span averages, and (C) gender comparison. (A) Survival curves of Drosophila melanogaster. (B) Mean of survival time in the highest 75% of surviving population. ***Indicates significant differences (P < .001) with respect to the control. (C) Significance between female and male curves with respect to their controls is symbolized by asterisk (*); significant survival values between females and males at the different treatments are symbolized by arrows (→).

Table 3.

Mean and Significances Of Life Span, Health Span, and Life Span Curves by Gender

				Life span curves by gender (days)
Compound	Concentration (mM)	Mean life span ^a (days)	Mean health span ^b (days)	Females ^a	Males ^a	Gender sig. ^b
H₂O		47.242	19.769	51.202	49.914	0.386
Choline	0.447	58.430^***	38.826^***	60.829^**	55.926^**	0.131
	0.895	57.270^***	33.810^***	63.973^**	52.663^*	0.004
	3.581	62.120^***	35.800^***	64.225^***	59.327^***	0.449
	7.163	59.213^***	37.098^***	63.534^***	55.501^***	0.161

Means were calculated by the Kaplan–Meier method and significance of the curves was determined by the log-rank method (Mantel-cox).

ns, nonsignificant (P > .05), ^*significant (P < .05), ^**highly significant (P < .01), ^***very highly significant (P < .001).

Significant survival values between females and males caused by the different assayed concentrations symbolized by arrow in Figure 2C.

Health span assays

Figure 2B shows that choline induced a significant increase of health span in D. melanogaster when compared with the control (Table 3). The different concentrations of choline (0.447–7.16 mM) showed similar mean survival time values among them with an increased range of 14.1–19.1 days with respect to the control.

Gender studies

All the assayed choline concentrations showed significantly increased survival time, with respect to their control, with an average of 11.9 and 5.9 days for females and males, respectively (Fig. 2C; Table 3). Moreover, comparing female and male life span curves, there was a significant difference in longevity at the choline concentration of 0.895 mM with an increase in 11 days for females with respect to males.

Cytotoxicity

Choline did not exert any cytotoxic effect in the in vitro assays in HL-60 and NIH3T3 cells (Fig. 3A).

FIG. 3.

Effect of choline on cell viability. (A) Viability of promyelocytic human leukemia cells (HL-60) treated with different concentrations of choline for 72 h. (B) Viability of mouse fibroblasts (NIH3T3) in the presence of different concentrations of choline after 20 h. Each point represents the growing percentage with respect to its control. Values are mean ± SE from three independent experiments. SE, standard error.

DNA internucleosomal fragmentation

Figure 4A shows electrophoresis of the genomic DNA of HL-60 cells treated with different concentrations of choline. Results show that choline did not induce internucleosomal fragmentation.

FIG. 4.

DNA-induced damage in promyelocytic HL-60 cells treated with different concentrations of choline for 5 h. (A) Internucleosomal DNA fragmentation. (B) DNA strand break induction. (A) M indicates DNA size marker, C indicates Control treatment. (B) Alkaline comet assay (pH <13) of HL-60 cells treated with 0.895, 1.791, and 7.16 mM of choline. DNA migration is reported as mean TM. Values are mean ± SE. Different letters in treatments mean differences with respect to the negative control after one-way ANOVA and post hoc Tukey's test. TM, tail moment; ANOVA, analysis of variance.

Comet assay

Results of the TM for different concentrations of choline-treated HL-60 cells are shown in Figure 4B. Choline induced significant genomic DNA damage, increasing the TM of comets in HL-60 promyelocytic cell line with respect to the concurrent control.

Methylation status

The relative normalized expression of three repetitive sequences (Alu M1, LINE-1, and Sat-α) studied in HL-60 cells treated with different concentrations of choline is shown in Figure 5. Choline did not exhibit modulation of the methylation status as both concentrations assayed showed methylation levels similar to that of the normalized control. The only exception was for the lowest concentration of choline in the LINE-1 and Sat-α regions that showed a significant hypermethylation and demethylation status, respectively (Fig. 5).

FIG. 5.

Relative normalized expression data of each repetitive element. Relative normalized expression data of each repetitive element (Alu M1, LINE-1, and Sat-α). Different letters mean different values after one-way ANOVA and post hoc Tukey's test. Sat-α, satellite-alpha DNA; LINE, long interspersed elements.

MA activity

Choline decreased MA in NIH3T3 cells at the lower concentrations assayed (Fig. 6). However, the MA response (of increased MA) to topoisomerase inhibitor (etoposide) is still maintained in the presence of the lowest concentration of choline analyzed (Fig. 7).

FIG. 6.

Effect of choline on macroautophagy activity. Macroautophagy activity was measured in NIH3T3 cells stably expressing the tandem reporter mCherry-GFP-LC3. Analysis was done using high-content microscopy in nine different fields per condition and well (approximately total of 3500 cells per condition). (A) Quantification of the number of autophagosomes (APG) and (B) autophagolysosomes (APGL). *Significant (P < .05).

FIG. 7.

Effect of etoposide on macroautophagy induced by choline. Macroautophagy activity was measured in NIH3T3 cells stably expressing the tandem reporter mCherry-GFP-LC3; cells were grown in the absence or presence of the stressor (Etopo: 25 μM). Concentration was selected on the basis of results obtained in single treatments shown in Figure 5. Images and analysis were done using high-content microscopy in nine different fields per condition and well (approximately total of 3500 cells per condition). (A) Quantification of the number of autophagic vacuoles (AV: total red puncta), autophagosomes (APG: total yellow puncta), and autophagolysosomes (APGL: red, but not green, puncta) was performed. *Significant (P < .05). (B) Representative merged images of these cells and high-magnification insets. Autophagosomes and autophagolysosomes are shown as yellow and red puncta, respectively.

Discussion

Recent work points out the critical role of choline in brain development.⁶⁶ Besides, getting adequate choline in the diet is important throughout life for optimal health in pregnancy and lactation,⁶⁷ neural tube defects,⁶⁸ memory development,⁶⁹ heart disease,⁷⁰ inflammation^16,71 and cancers.^15,72

The antitoxic activity of choline against H₂O₂ found in our in vivo experiments would be in agreement with the well-known biological effects in humans showing that choline-deficient diets are related to liver and kidney degenerative diseases⁷³ and a dietary supplementation with choline induces a reduction of tissue injury and mortality in rat⁷⁴ and juvenile carp,⁷⁵ although an excess of choline intake could be toxic in humans.³⁸ Oxidative species, particularly hydrogen peroxide and derived hydroxyl radicals, are known genotoxic carcinogens.⁷⁶ Our antitoxicity and antigenotoxicity results showed that choline is able to protect against genomic damage induced by this genotoxin. Our results of genotoxic inhibitory ability of choline in vivo due to its antioxidant activity against peroxide caused by its hydroxy amine groups⁷⁷ are in agreement with previous in vitro studies on the genomic impact of choline deficiencies.^14,35 Longevity is a trait influenced by many factors, including gender, genetic variation, environmental influences such as diet, lifestyle, access to healthcare, and cultural influences.⁷⁸ Choline at lower concentrations, like other methyl donors such as purine and folate,⁷⁹ could be argued as a potential target of sex-specific implication for Drosophila life span. Besides, methyl-deficient diets cause fatty livers and promote liver carcinogenesis in rodents.⁸⁰ On the other hand, supplementation with choline improves hepatic steatosis.⁸¹ Our results suggest that lower concentrations of choline could be an essential nutrient to prevent and protect the degenerative processes like aging and DNA damage.

Our results on genotoxicity of choline against HL-60 tumor cells are consistent with the conclusively demonstrated fact that choline metabolism is altered in a wide variety of cancers,⁸² hence proposing novel anticancer therapies targeting choline metabolism. Experimental studies in mice established dose–effect relationship between choline deficiency and carcinogenic activity of diethanolamine,⁸³ which is related with greater membrane fragility than cells grown in a control medium.⁸⁴ The use of two types of model cell lines allowed us to obtain complementary conclusions on the mode of action of choline. Methodologies for the different cells are used following the standard protocols described in the manufacturer's manuals as they belong to different suspension and adherence types of cultures, hence conditions are different, but still comparable.

Although we did not obtain significant results for the DNA damage assays (DNA internucleosomal fragmentation and comet assay), studies suggest that choline deficiency in humans is associated with significant DNA damage and with apoptosis in lymphocytes.¹⁶ Moreover, studies affirm that choline has a significant impact on genomic stability and cell death, depending on its availability.¹⁴

Chemopreventive molecules induce demethylation in tumoral cells, contrary to the general hypermethylation that tumoral cells exhibit.⁸⁵ Nevertheless, several studies have identified a usual hypomethylation status of specific Alu, LINE-1, and Sat-α repetitive sequences in cancer cells.^86
–88 The present pilot study on the epigenetic effects of choline treatments in tumoral cells did not show any significant blocking effect of choline on repetitive sequences on HL-60 tumoral cells, except for hypermethylation in LINE-1 sequences and hypomethylation in Sat-α sequences caused by 0.447 mM choline. According to Zeisel³⁵ and Locker et al.,⁸⁹ DNA methylation is influenced by the availability of choline: an excess of choline used to cause hypermethylation, which is associated with gene silencing or reduction of gene expression, and furthermore common genetic polymorphisms have effects on the dietary requirements; whereas a choline deficiency is associated with DNA hypomethylation, which is related with health consequences in brain development and birth defects, fatty liver, muscle damage, elevation of plasma homocysteine, and others problems in adults. LINE sequences are moderately dispersed repetitive DNA, mainly transposable elements, which may be involved in regulation of gene expression. LINE-1 methylation status has been shown to be a good indicator of genome-wide methylation. On the other hand, alpha-satellite DNA are highly repetitive sequences located in heterochromatic regions around the centromere/telomere, with structural or organizational roles, role in chromosome pairing, involvement in cross-over or recombination, and junk. Taking into account the importance of choline requirements and functions of the different repetitive sequences studied, for LINE sequences, either a deficit or an excess of choline in treatments of HL-60 cells leads to a hypermethylation status in these repetitive sequences. The major fact observed on the DNA demethylation status of alpha-satellite sequences of HL-60 cells treated with 0.447 mM choline (lower concentration than the recommend one) should be considered as the most important effect due to their main consequences on health. More research should be carried out on the epigenetic modifications induced by some dietary molecules, until clear response of the entire methylation status of genome is known.

MA is considered an inducible type of autophagy, with an essential role in the maintenance of cellular homeostasis and as the forefront of the response to cellular stress.⁹⁰ It is known that MA decreases with age in almost all organisms studied and diet or specific nutrients affect MA activity.⁹¹ We have also observed that dietary choline inhibits MA activation. Further studies are needed to understand this apparent paradox as choline exerts benefits on longevity and at the same time inhibits MA activity.

In the present study, a general overview of the biological activity at individual, cellular, and molecular levels drawn from the in vivo and in vitro assays could be obtained to evaluate the role that choline has in the modulation of degenerative processes. Our data indicate that choline is neither toxic nor genotoxic, protects from oxidative genetic damage, and increases life span and health span in the animal model. Nevertheless, choline does not inhibit tumor growth, increase MA, and induce DNA damage and it rarely modifies the methylation status of repetitive sequences of tumoral cells. Taking into account the overall studies carried out in the present work, dietary choline requirements are shown as an excellent example of nutrigenomics due to the important health implications of choline. The hopeful results of our in vivo assays about protection against oxidative agents and longevity support this fact.

Footnotes

Acknowledgment

The authors thank Dr. Ana Maria Cuervo for her critical support in the field of autophagy.

Author Disclosure Statement

No competing financial interests exist.

References

Institute of Medicine (US) Standing Committee on Scientific Evaluation of Dietary Rerefence Intakes: Dietary Reference Intakes for Thiamin, Riboflavin, Niacin, Vitamin B6, Folate, Vitamin B12, Pantothenic Acid, Biotin, and Choline. National Academies Press, Washington, DC, USA, 1998.

Zeisel

, Da Costa

K-A

: Choline: An essential nutrient for public health. Nutr Rev, 2009; 67:615–623.

Howe

, Williams

, Holden

, Zeisel

, Mar

M-H

: USDA Database for the Choline Content of Common Foods. UDo Agriculture, Beltsville MD, 2004, p. 26.

Blusztajn

, Wurtman

: Choline and cholinergic neurons. Science, 1983; 221:614–620.

Zeisel

, Blusztajn

: Choline and human nutrition. Annu Rev Nutr, 1994; 14:269–296.

Zeisel

, Niculescu

: Perinatal choline influences brain structure and function. Nutr Rev, 2006; 64:197–203.

Zeisel

: The fetal origins of memory: The role of dietary choline in optimal brain development. J Pediatr, 2006; 149:S131–S136.

Eagle

: The minimum vitamin requirements of the L and HeLa cells in tissue culture, the production of specific vitamin deficiencies, and their cure. J Exp Med, 1955; 102:595–600.

Terce

, Brun

, Vance

: Requirement of phosphatidylcholine for normal progression through the cell cycle in C3H/10T1/2 fibroblasts. J Lipid Res, 1994; 35:2130–2142.

10.

Yen

, Mar

, Meeker

, Fernandes

, Zeisel

: Choline deficiency induces apoptosis in primary cultures of fetal neurons. FASEB J, 2001; 15:1704–1710.

11.

Yen

, Mar

, Zeisel

: Choline deficiency-induced apoptosis in PC12 cells is associated with diminished membrane phosphatidylcholine and sphingomyelin, accumulation of ceramide and diacylglycerol, and activation of a caspase. FASEB J, 1999; 13:135–142.

12.

Gasull

, DeGregorio-Rocasolano

, Zapata

, Trullas

: Choline release and inhibition of phosphatidylcholine synthesis precede excitotoxic neuronal death but not neurotoxicity induced by serum deprivation. J Biol Chem, 2000; 275:18350–18357.

13.

Farooqui

, Yang

, Rosenberger

, Horrocks

: Phospholipase A2 and its role in brain tissue. J Neurochem, 1997; 69:889–901.

14.

, Ni

, Zhou

, et al.: Choline and/or folic acid deficiency is associated with genomic damage and cell death in human lymphocytes in vitro. Nutr Cancer, 2012; 64:481–487.

15.

, Gammon

, Zeisel

, et al.: Choline metabolism and risk of breast cancer in a population-based study. FASEB J, 2008; 22:2045–2052.

16.

da Costa

, Niculescu

, Craciunescu

, Fischer

, Zeisel

: Choline deficiency increases lymphocyte apoptosis and DNA damage in humans. Am J Clin Nutr, 2006; 84:88–94.

17.

Homocysteine Studies Collaboration: Homocysteine and risk of ischemic heart disease and stroke: A meta-analysis. JAMA, 2002; 288:2015–2022.

18.

Seshadri

, Beiser

, Selhub

, et al.: Plasma homocysteine as a risk factor for dementia and Alzheimer's disease. N Engl J Med, 2002; 346:476–483.

19.

van Meurs

, Dhonukshe-Rutten

, Pluijm

, et al.: Homocysteine levels and the risk of osteoporotic fracture. N Engl J Med, 2004; 350:2033–2041.

20.

Kohlmeier

, da Costa

K-A

, Fischer

, Zeisel

: Genetic variation of folate-mediated one-carbon transfer pathway predicts susceptibility to choline deficiency in humans. Proc Natl Acad Sci USA, 2005; 102:16025–16030.

21.

Yao

, Vance

: The active synthesis of phosphatidylcholine is required for very low density lipoprotein secretion from rat hepatocytes. J Biol Chem, 1988; 263:2998–3004.

22.

Deuster

, Cooper

: Choline. In: Sports Nutrition: Vitamins and Trace Elements ( Wolinsky

, Driskell

, eds.). Taylor & Francis Group, LLC., United Kingdom, 2006, pp. 139–161.

23.

Lawrence

, Millac

, Stout

, Ward

: The use of choline chloride in ataxic disorders. J Neurol Neurosurg Psychiatry, 1980; 43:452–454.

24.

Growdon

, Hirsch

, Wurtman

, Wiener

: Oral choline administration to patients with tardive dyskinesia. N Engl J Med, 1977; 297:524–527.

25.

Zeisel

, Wishnok

, Blusztajn

: Formation of methylamines from ingested choline and lecithin. J Pharmacol Exp Therapeut, 1983; 225:320–324.

26.

Loffelholz

: Release of acetylcholine in the isolated heart. Am J Physiol Heart Circ Physiol, 1981; 240:H431–H440.

27.

Nadkarni

, Peller

, Retig

: Eosinophilic hepatitis after ingestion of choline magnesium trisalicylate. Am J Gastroenterol, 1992; 87:151–153.

28.

Fischer

: Contact allergy to choline chloride. Contact Dermatitis, 1984; 10:316–317.

29.

Davis

, Holister

, Berger

: Choline chloride in schizophrenia. Am J Psychiatry, 1979; 136:1581–1584.

30.

Gelenberg

, Doller-Wojcik

, Growdon

: Choline and lecithin in the treatment of tardive dyskinesia: Preliminary results from a pilot study. Am J Psychiatry, 1979; 136:772–776.

31.

Tessitore

, Sesca

, Greco

, Pani

, Dianzani

: Sexually differentiated response to choline in choline deficiency and ethionine intoxication. Int J Exp Pathol, 1995; 76:125.

32.

von Allwörden

, Horn

, Kahl

, Feldheim

: The influence of lecithin on plasma choline concentrations in triathletes and adolescent runners during exercise. Eur J Appl Physiol Occup Physiol, 1993; 67:87–91.

33.

Conlay

, Wurtman

, Blusztajn

, et al.: Decreased plasma choline concentrations in marathon runners. N Engl J Med, 1986; 315:892.

34.

Jope

, Domino

, Mathews

, et al.: Free and bound choline blood levels after phosphatidylcholine. Clin Pharmacol Therapeut, 1982; 31:483–487.

35.

Zeisel

: Gene response elements, genetic polymorphisms and epigenetics influence the human dietary requirement for choline. IUBMB Life, 2007; 59:380–387.

36.

Fortini

, Skupski

, Boguski

, Hariharan

: A survey of human disease gene counterparts in the Drosophila genome. J Cell Biol, 2000; 150:F23–F30.

37.

William

, Carvalho

, Mak

, et al.: Prandiology of Drosophila and the CAFE assay. Proc Natl Acad Sci USA, 2007; 104:8253–8256.

38.

, Vance

: Phosphatidylcholine and choline homeostasis. J Lipid Res, 2008; 49:1187–1194.

39.

Yates

, Schlicker

, Suitor

: Dietary reference intakes: The new basis for recommendations for calcium and related nutrients, B vitamins, and choline. J Am Diet Assoc, 1998; 98:699–706.

40.

Yan

, Huen

, Morely

, et al.: The multiple-wing-hairs gene encodes a novel GBD-FH3 domain-containing protein that functions both prior to and after wing hair initiation. Genetics, 2008; 180:219–228.

41.

Ren

, Charlton

, Adler

: The flare gene, which encodes the AIP1 protein of Drosophila, functions to regulate F-actin disassembly in pupal epidermal cells. Genetics, 2007; 176:2223–2234.

42.

Lozano-Baena

, Tasset

, Munoz-Serrano

, Alonso-Moraga

, de Haro-Bailon

: Cancer prevention and health benefices of traditionally consumed Borago officinalis plants. Nutrients, 2016; 8:pii:E48.

43.

Anter

, Campos-Sanchez

, Hamss

, et al.: Modulation of genotoxicity by extra-virgin olive oil and some of its distinctive components assessed by use of the Drosophila wing-spot test. Mutat Res, 2010; 703:137–142.

44.

Graf

, Wurgler

, Katz

, et al.: Somatic mutation and recombination test in Drosophila melanogaster . Environ Mutagen, 1984; 6:153–188.

45.

Moraga

, Graf

: Genotoxicity testing of antiparasitic nitrofurans in the Drosophila wing somatic mutation and recombination test. Mutagenesis, 1989; 4:105–110.

46.

Frei

, Wurgler

: Statistical methods to decide whether mutagenicity test data from Drosophila assays indicate a positive, negative, or inconclusive result. Mutat Res, 1988; 203:297–308.

47.

Frei

, Wurgler

: Optimal experimental design and sample size for the statistical evaluation of data from somatic mutation and recombination tests (SMART) in Drosophila . Mutat Res, 1995; 334:247–258.

48.

Abraham

: Antigenotoxicity of coffee in the Drosophila assay for somatic mutation and recombination. Mutagenesis, 1994; 9:383–386.

49.

Tasset-Cuevas

, Fernandez-Bedmar

, Lozano-Baena

, et al.: Protective effect of borage seed oil and gamma linolenic acid on DNA: In vivo and in vitro studies. PLoS One, 2013; 8:e56986.

50.

Soh

, Hotic

, Arking

: Dietary restriction in Drosophila is dependent on mitochondrial efficiency and constrained by pre-existing extended longevity. Mech Ageing Dev, 2007; 128:581–593.

51.

Wyllie

: Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature, 1980; 284:555–556.

52.

Husseini

, El-Fayoumi

, O'Neill

, Rapoport

, Pitt

: DNA damage induced by micellar-delivered doxorubicin and ultrasound: Comet assay study. Cancer Lett, 2000; 154:211–216.

53.

Olive

, Banath

: The comet assay: A method to measure DNA damage in individual cells. Nat Protoc, 2006; 1:23–29.

54.

Prosperini

, Juan-Garcia

, Font

, Ruiz

: Beauvericin-induced cytotoxicity via ROS production and mitochondrial damage in Caco-2 cells. Toxicol Lett, 2013; 222:204–211.

55.

Kumaravel

, Vilhar

, Faux

, Jha

: Comet assay measurements: A perspective. Cell Biol Toxicol, 2009; 25:53–64.

56.

Deininger

, Moran

, Batzer

, Kazazian

Jr. : Mobile elements and mammalian genome evolution. Curr Opin Genet Dev, 2003; 13:651–658.

57.

Ehrlich

: DNA methylation in cancer: Too much, but also too little. Oncogene, 2002; 21:5400–5413.

58.

Lee

, Wevrick

, Fisher

, Ferguson-Smith

, Lin

: Human centromeric DNAs. Hum Genet, 1997; 100:291–304.

59.

Weiner

: SINEs and LINEs: The art of biting the hand that feeds you. Curr Opin Cell Biol, 2002; 14:343–350.

60.

Weisenberger

, Campan

, Long

, et al.: Analysis of repetitive element DNA methylation by MethyLight. Nucleic Acids Res, 2005; 33:6823–6836.

61.

Nikolaidis

, Raji

, Markopoulou

, et al.: DNA methylation biomarkers offer improved diagnostic efficiency in lung cancer. Cancer Res, 2012; 72:5692–5701.

62.

Liloglou

, Bediaga

, Brown

, Field

, Davies

: Epigenetic biomarkers in lung cancer. Cancer Lett, 2014; 342:200–212.

63.

Anter

, Romero-Jimenez

, Fernandez-Bedmar

, et al.: Antigenotoxicity, cytotoxicity, and apoptosis induction by apigenin, bisabolol, and protocatechuic acid. J Med Food, 2011; 14:276–283.

64.

Rojas-Molina

, Campos-Sanchez

, Analla

, Munoz-Serrano

, Alonso-Moraga

: Genotoxicity of vegetable cooking oils in the Drosophila wing spot test. Environ Mol Mutagen, 2005; 45:90–95.

65.

Romero-Jimenez

, Campos-Sanchez

, Analla

, Munoz-Serrano

, Alonso-Moraga

: Genotoxicity and anti-genotoxicity of some traditional medicinal herbs. Mutat Res, 2005; 585:147–155.

66.

Meck

, Williams

: Characterization of the facilitative effects of perinatal choline supplementation on timing and temporal memory. Neuroreport, 1997; 8:2831–2835.

67.

Zeisel

: Choline: Critical role during fetal development and dietary requirements in adults. Annu Rev Nutr, 2006; 26:229–250.

68.

Shaw

, Carmichael

, Yang

, Selvin

, Schaffer

: Periconceptional dietary intake of choline and betaine and neural tube defects in offspring. Am J Epidemiol, 2004; 160:102–109.

69.

Glenn

, Kirby

, Gibson

, et al.: Age-related declines in exploratory behavior and markers of hippocampal plasticity are attenuated by prenatal choline supplementation in rats. Brain Res, 2008; 1237:110–123.

70.

Olthof

, Brink

, Katan

, Verhoef

: Choline supplemented as phosphatidylcholine decreases fasting and postmethionine-loading plasma homocysteine concentrations in healthy men. Am J Clin Nutr, 2005; 82:111–117.

71.

Detopoulou

, Panagiotakos

, Antonopoulou

, Pitsavos

, Stefanadis

: Dietary choline and betaine intakes in relation to concentrations of inflammatory markers in healthy adults: The ATTICA study. Am J Clin Nutr, 2008; 87:424–430.

72.

Ackerstaff

, Glunde

, Bhujwalla

: Choline phospholipid metabolism: A target in cancer cells?. J Cell Biochem, 2003; 90:525–533.

73.

Johnston

: Acetonaemia. Can J Comp Med, 1939; 3:171–172.

74.

Rivera

, Wheeler

, Enomoto

, Thurman

: A choline-rich diet improves survival in a rat model of endotoxin shock. Am J Physiol, 1998; 275(4 Pt 1):G862–G867.

75.

, Jiang

W-D

, Liu

, et al.: Effect of choline on antioxidant defenses and gene expressions of Nrf2 signaling molecule in the spleen and head kidney of juvenile Jian carp (Cyprinus carpio var. Jian). Fish Shellfish Immunol, 2014; 38:374–382.

76.

Floyd

: The role of 8-hydroxyguanine in carcinogenesis. Carcinogenesis, 1990; 11:1447–1450.

77.

Saito

, Ishihara

: Antioxidant activity and active sites of phospholipids as antioxidants. J Am Oil Chemists' Soc, 1997; 74:1531–1536.

78.

Maklakov

, Simpson

, Zajitschek

, et al.: Sex-specific fitness effects of nutrient intake on reproduction and lifespan. Curr Biol, 2008; 18:1062–1066.

79.

Bauer

, Katzenberger

, Hamm

, et al.: Purine and folate metabolism as a potential target of sex-specific nutrient allocation in Drosophila and its implication for lifespan-reproduction tradeoff. Physiol Genomics, 2006; 25:393–404.

80.

Wainfan

, Poirier

: Methyl groups in carcinogenesis: Effects on DNA methylation and gene expression. Cancer Res, 1992; 52(7 Suppl):2071s–2077s.

81.

Buchman

, Dubin

, Moukarzel

, et al.: Choline deficiency: A cause of hepatic steatosis during parenteral nutrition that can be reversed with intravenous choline supplementation. Hepatology, 1995; 22:1399–1403.

82.

Glunde

, Jacobs

, Bhujwalla

: Choline metabolism in cancer: Implications for diagnosis and therapy. Expert Rev Mol Diagn, 2006; 6:821–829.

83.

Leung

, Kamendulis

, Stott

: Review of the carcinogenic activity of diethanolamine and evidence of choline deficiency as a plausible mode of action. Regul Toxicol Pharmacol, 2005; 43:260–271.

84.

da Costa

K-A

, Badea

, Fischer

, Zeisel

: Elevated serum creatine phosphokinase in choline-deficient humans: Mechanistic studies in C2C12 mouse myoblasts. Am J Clin Nutr, 2004; 80:163–170.

85.

Roman-Gomez

, Jimenez-Velasco

, Agirre

, et al.: Repetitive DNA hypomethylation in the advanced phase of chronic myeloid leukemia. Leuk Res, 2008; 32:487–490.

86.

Chalitchagorn

, Shuangshoti

, Hourpai

, et al.: Distinctive pattern of LINE-1 methylation level in normal tissues and the association with carcinogenesis. Oncogene, 2004; 23:8841–8846.

87.

Ehrlich

, Hopkins

, Jiang

, et al.: Satellite DNA hypomethylation in karyotyped Wilms tumors. Cancer Genet Cytogenet, 2003; 141:97–105.

88.

Schmid

: Human Alu subfamilies and their methylation revealed by blot hybridization. Nucleic Acids Res, 1991; 19:5613–5617.

89.

Locker

, Reddy

, Lombardi

: DNA methylation and hepatocarcinogenesis in rats fed a choline-devoid diet. Carcinogenesis, 1986; 7:1309–1312.

90.

Schneider

, Cuervo

: Autophagy and human disease: Emerging themes. Curr Opin Genet Dev, 2014; 26:16–23.

91.

Hannigan

, Gorski

: Macroautophagy: The key ingredient to a healthy diet?. Autophagy, 2009; 5:140–151.