Leucine Protects Against Skeletal Muscle Atrophy in Lipopolysaccharide-Challenged Rats

Abstract

Skeletal muscle atrophy is a decrease in muscle mass that occurs when protein degradation exceeds protein synthesis. Leucine (Leu), an essential branched-chain amino acid in animal nutrition, regulates skeletal muscle protein metabolism. Two experiments were conducted to evaluate whether Leu could alleviate lipopolysaccharide (LPS)-induced skeletal muscle wasting by modulating skeletal muscle protein synthesis and degradation. A total of 24 rats were randomly allocated into three groups (n = 8): (1) non-challenged control; (2) LPS-challenged control; and (3) LPS +3.0% Leu. Rats were fed with control or Leu-supplemented (part of the casein was replaced with 3.0% Leu) diets throughout the trial and were injected intraperitoneally with sterile saline or LPS at days 6, 11, 16, and 21. On the morning of day 22, serum samples were collected and rats were then sacrificed for liver and muscle analysis. In vitro protein degradation, nuclear factor-κB (NF-κB) activity, and proteolytic enzyme activities of the muscles from immune-challenged rats were also measured. Our results showed that the LPS challenge resulted in not only enhanced serum interleukin-1 and liver C-reactive protein (CRP) concentrations but also decreased the average daily body weight gain and muscle fiber diameter. However, dietary Leu inclusion attenuated the increase in CRP level and the decrease in muscle fiber diameter. Importantly, the LPS challenge caused a significant elevation in the muscle proteolysis rate, but dietary Leu supplementation significantly blocked the muscle proteolysis. The mRNA expression of NF-κB, muscle atrophy F-box (MAFbx), and muscle ring finger 1 (MuRF1) was upregulated by the LPS challenge in gastrocnemius muscles, but was downregulated by Leu supplementation. Interestingly, when muscles from the LPS-challenged rats were incubated with Leu in vitro, proteasome-, calpain-, and cathepsin-L-dependent muscle proteolysis and NF-κB activity were decreased. Collectively, the data suggest that Leu supplementation could inhibit excessive skeletal muscle degradation, as well as enhance protein synthesis and, thus, attenuate the negative effects caused by the LPS-induced immune challenge.

Introduction

Skeletal muscle is the most abundant tissue in the body and involved in many important functions.¹ For instance, skeletal muscle mass is a determinant of strength, endurance, and physical performance. However, muscle atrophy can lead to a decrease in both the myofibrillar cross-sectional area and muscle strength. Potential triggers of muscle wasting are long-term immobilization, malnutrition, severe burns, ageing, as well as various serious diseases, such as immune disorders. Lipopolysaccharide (LPS) is one of the best studied immunostimulatory components of bacteria that is widely used to induce immune disorders.^1,2 Nutrient-related muscle atrophies, such as those induced by LPS, are largely restricted to fast-twitch glycolytic fibers, of which the underlying mechanism is usually related to abnormal protein degradation. Several proteolytic systems regulate protein degradation; the ubiquitin-proteasome and autophagy-lysosome systems are thought to be the two most important.^3
–5 Protein degradation of skeletal muscles occurs primarily through upregulation of muscle atrophy F-box (MAFbx) and muscle ring finger 1 (MuRF1), involved in the ubiquitin-proteasome pathway.⁶ Both MAFbx and MuRF1 can be considered the master genes for muscle atrophy and wasting.⁷ Moreover, interleukin (IL)-1, IL-6, and the interferons have been implicated in muscle protein degradation.⁸

Leucine (C₆H₁₃NO₂, Leu) is an essential branched-chain amino acid that cannot be de novo synthesized by animals.⁹ The biochemical actions of Leu include regulating gene expression,^10,11 increasing the secretion of growth hormones,¹² and repairing muscles.^13,14 Recent nutritional studies have shown that dietary supplementation with Leu not only stimulates protein synthesis^15
–17 but also inhibits protein degradation^18
–20 in skeletal muscle. In addition, Leu may function to alleviate a variety of infections and immune challenges.^21

–24 Considering its many health benefits, Leu has received considerable research interest as an important nutritional supplement to protect muscles from degradation. However, few experiments have been conducted to study the effects of extended Leu supplementation on the skeletal muscle wasting in immune-challenged animals. Therefore, further investigation is necessary.

In the present study, we used LPS-induced immune-challenged rats as a model of in vivo rat muscle wasting conditions to investigate whether dietary Leu could alleviate muscle atrophy. Furthermore, possible mechanisms by which Leu exerted its action were studied in the gastrocnemius muscle (mostly fast-twitch glycolytic fibers) harvested from LPS-challenged control rats. Accordingly, we hypothesized that dietary supplementation with Leu potentially regulates skeletal muscle protein synthesis and degradation signaling in LPS-challenged rats and, therefore, protects against muscle atrophy.

Materials and Methods

Materials

Sprague-Dawley (SD) rats were supplied by Dossy Experimental Animals Co., Ltd. (Chengdu, China). Leu (855448-2.5G), LPS (L26637-5 MG), and calpeptin (C8999-5 MG) were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Cycloheximide (94271-100 MG) was purchased from Amresco LLC (Solon, OH, USA). Cathepsin-L inhibitor IV (219433-1MGCN) and clasto-lactacystin β-lactone (426102-100UGCN) were purchased from Merck Millipore (Darmstadt, Germany). All of the other reagents were as indicated in the specified methods.

Animal care and experimental design

All experimental procedures used in the present study were approved by the Animal Care and Use Committee of Sichuan Agricultural University (Chengdu, China). Twenty-four male SD rats, weighing 190 − 200 g, were randomly divided into three groups (n = 8). The rats were individually caged in stainless-steel cages and were provided ad libitum access to water in an environmentally controlled room with a 12-h light/12-h dark cycle. All rats were fed once daily (18:00 h), and feed consumption was determined daily throughout the trial. The basal diet (Table 1) was formulated on the basis of AIN-93G requirements for growth phase of laboratory rodents.²⁵

Table 1.

Composition of the Basal Diet (g/kg)

Ingredients	Content
Corn starch	397.49
Casein (≥85% protein)	200.00
Dextrinized corn starch (90–94% tetrasaccharides)	132.00
Sucrose	100.00
Soybean oil (no additives)	70.00
Fiber	50.00
Mineral mix^a	35.00
Vitamin mix^b	10.00
L-cystine	3.00
Choline bitartrate (41.10% choline)^c	2.50
Tert-butylhydroquinone	0.01

The premix provided the following per kg of diets: 100 mg Zn, 50 mg Mn, 100 mg Fe, 8 mg Cu, 0.30 mg I, and 0.35 mg Se.

The premix provided the following per kg of diets: 2200 IU vitamin A, 220 IU vitamin D₃, 16 IU vitamin E, 0.50 mg vitamin K₃, 1 mg vitamin B₁, 3.50 mg vitamin B₂, 1.5 mg vitamin B₆, 17.50 μg vitamin B₁₂, 0.30 mg folic acid, 0.05 mg biotin, and 15 mg niacin.

Based on the molecular weight of the free base.

The experimental groups were as follows: (1) nonchallenged control (CON; rats fed a control diet and injected with sterile saline); (2) LPS-challenged control (LPS; rats fed the control diet and injected with LPS); and (3) LPS +3.0% Leu treatment (LPSL; rats fed a diet in which part of the casein was replaced by 3.0% Leu, and the animals were injected with LPS). After feeding the experimental diets for 5 days, the immune challenge was induced by LPS. Briefly, the challenged groups were injected intraperitoneally with 50 μg/kg body weight LPS at four times (days 6, 11, 16, and 21), while the control group was simultaneously injected intraperitoneally with the same amount of sterile saline. The Leu²⁶ and LPS^27,28 dose were chosen according to previous studies.

Blood and tissue sampling

At 08:00 h of day 22, the rats were weighed, before collecting blood samples in tubes. Briefly, the tubes were centrifuged at 3000 g for 15 min to isolate the serum. The serum samples were stored at −20°C until further analysis. After blood sampling, all the rats were sacrificed by cervical dislocation after ether anesthesia. Liver samples were removed immediately and frozen in liquid nitrogen and then stored at −80°C until biochemical analysis. Muscle samples were harvested and used to determine fiber size (diameter and density), protein degradation rates, and mRNA levels of nuclear factor-κB (NF-κB), MAFbx, and MuRF1. In the second experimental series (in vitro), muscles harvested from immune-challenged rats (after the fourth LPS injection) were incubated in the absence or presence of 2 mM Leu, to determine the direct effects of Leu on protein degradation rates, proteolytic enzymes, and NF-κB activity.

Biochemical analysis of serum and liver

Analyses of cytokines and immunoglobulins

All immune indices were determined using ELISA Kits (R&D Systems, Minneapolis, MN, USA). The concentrations of inflammatory factors such as IL-1 and immunoglobulins (IgA, IgG, and IgM) in the serum samples were detected following the procedures described previously.^29,30

Assay of C-reactive protein

About 0.1 g liver sample was weighed, thawed, and homogenized (5 min) in nine times the volume (w/v) of ice-cold physiologic saline. The mixtures were then centrifuged at 3000 g, 4°C, for 15 min, and the supernatants were collected and stored at −20°C until C-reactive protein (CRP) analysis. The liver CRP was assayed using a commercially available rat CRP ELISA Kit (R&D Systems, Minneapolis, MN, USA). All of the procedures were performed according to the manufacturer's instructions.

Histochemical analysis of muscle

Muscle samples for histochemical analysis were taken from an equivalent region within the gastrocnemius muscle. Transverse serial sections (10 μm) were cut from entire blocks (1.0 × 1.0 × 1.5 cm) on a cryostat microtome (HM525; Microm GmbH, Munich, Germany) at −20°C and mounted on glass slides. The slides were stained with hematoxylin and eosin (H&E) solution after fixation, and quantitative analysis of all muscle samples for fiber size (diameter and density) was performed using an image analysis program (TEMA1.04; Scanbeam, Hadsund, Denmark). All portions of the sections analyzed were free from sample disruption and freeze damage. The fiber density was calculated using the mean number of fibers per mm².

RNA extraction, reverse transcription, and quantitative real-time PCR

Muscle (gastrocnemius) total RNA isolation, cDNA synthesis, and quantitative real-time PCR analysis were conducted as described previously.³¹ Primers used for quantitative real-time PCR analysis were synthesized commercially by Invitrogen (Shanghai, China) and are listed in Table 2. GAPDH was used as the reference gene to normalize mRNA expression levels of the target genes. The relative quantification of gene expression among the treatment groups was analyzed by the 2^−ΔΔCt method.³²

Table 2.

Sequences of Primers Used for Quantitative Real-Time PCR

Genes	Primer name and sequence (5′-3′)	Accession no.	Annealing temperature (°C)
GAPDH	G-F: GACAACTTTGGCATCGTGGA	NM_017008	58.21
	G-R: ATGCAGGGATGATGTTCTGG
mTOR	mT-F: TGGAGGGAGAGCGTCTGAGA	NM_019906	60.89
	mT-R: TGATGTGCCGAGGCTTTGT
NF-κB	NF-F: ATCTGTTTCCCCTCATCTTTCC	NM_199267.2	59.33
	NF-R: TGCGTCTTAGTGGTATCTGTGC
MAFbx	MA-F: CCATCAGGAGAAGTGGATCTATGTT	AY_059628.1	60.09
	MA-R: GCTTCCCCCAAAGTGCAGTA
MuRF1	Mu-F: GTGAAGTTGCCCCCTTACAA	AY_059627.1	61.00
	Mu-R: TGGAGATGCAATTGCTCAGT

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MAFbx, muscle atrophy F-box; mTOR, mammalian target of rapamycin; MuRF1, muscle ring finger 1; NF-κB, nuclear factor-κB.

Muscle incubations

Gastrocnemius muscles were gently dissected with intact tendons, mounted on stainless steel supports at resting length, and incubated under physiological conditions in a shaking water bath at 37°C for 2 h, as described in detail previously.³³ Proteolysis rates were determined by measuring the net release of free tyrosine into the incubation medium, because tyrosine is neither synthesized nor degraded in muscle samples. Cycloheximide (0.5 mM) was added to the incubation medium to prevent reincorporation of tyrosine into muscle protein. Paired muscles from the LPS-challenged rats were incubated in vitro, in the absence or presence of Leu dissolved in clasto-lactacystin β-lactone, cathepsin-L inhibitor IV, or calpeptin at 100 μM.

Proteolytic enzymes and NF-κB activities

The effects of Leu on proteolytic enzyme activities were determined by incubating paired gastrocnemius muscles harvested from the LPS-challenged rats for 2 h, as described above, in the absence or presence of Leu (2 mM). The muscles were then rinsed in physiologic saline, weighed, and homogenized (1:10, w/v) in nine volumes of ice-cold physiologic saline. The mixture of muscles and physiological saline was centrifuged at 2000 g, 4°C, for 20 min. Total protein concentration in the supernatant was measured according to Bradford³⁴ using bovine serum albumin as the protein standard. The 20S proteasome, calpain, cathepsin-L, and NF-κB activities were determined using commercially available assay kits (BioVision, Milpitas, CA, USA) according to the manufacturer's instructions.

Statistical analysis

The results were reported as the mean values with their standard errors. Each rat was considered as one statistical unit. Student's t-test or analysis of variance (ANOVA) followed by Holm-Sidak's or Duncan's method was used as appropriate. P < .05 was considered as statistically significant.

Results

Growth performance

The growth performance results are given in Figure 1. The LPS challenge resulted in a remarkable decrease (P < .05) in average daily body weight gain (ADG), whereas dietary supplementation with Leu had no obvious effect (P > .05) on alleviating the ADG loss caused by the LPS challenge. No significant difference (P > .05) in average daily feed intake (ADFI) among the three treatment groups was observed.

FIG. 1.

Influences of Leu on the growth performance of rats over the experimental periods. (A) ADG, (B) ADFI. Values are means (eight rats/treatment), with standard errors represented by vertical bars. ^abMean values with unlike letters were significantly different (P < .05). CON (non-challenged control), rats receiving the control diet and injected with sterile saline; LPS (LPS-challenged control), rats receiving the control diet and injected with LPS; and LPSL, rats receiving a 3.0% Leu diet and injected with LPS. ADFI, average daily feed intake; ADG, average daily body weight gain; Leu, leucine; LPS, lipopolysaccharide.

Serum parameters

Following LPS injection, the serum IL-1 (Fig. 2A) and IgM (Fig. 2C) concentrations were increased (P < .05) by 18.76% and 16.79%, respectively. Moreover, the concentrations of IgG (Fig. 2B) and IgA (Fig. 2D) in serum did not differ (P > .05) between rats in the different treatments.

FIG. 2.

Influences of Leu on the serum parameters of rats. (A) IL-1, (B) IgG, (C) IgM, (D) IgA. Values are means (eight rats/treatment), with standard errors represented by vertical bars. ^abMean values with unlike letters were significantly different (P < .05). CON (non-challenged control), rats receiving the control diet and injected with sterile saline; LPS (LPS-challenged control), rats receiving the control diet and injected with LPS; and LPSL, rats receiving a 3.0% Leu diet and injected with LPS. IgA, immunoglobulin A; IgG, immunoglobulin G; IgM, immunoglobulin M; IL-1, interleukin-1.

Fiber size, CRP, and proteolysis rate

The H&E staining results are shown in Figure 3C. We found that LPS injection succeeded in causing musculature morphology injury. We further calculated the fiber diameter (Fig. 3A) and fiber density (Fig. 3B) of the rats in all three treatments. The LPS challenge did not affect (P > .05) the fiber density of gastrocnemius muscles, but it caused a significant decrease (P < .05) in the fiber diameter. Dietary supplementation with Leu significantly alleviated (P < .05) the decrease in fiber diameter of gastrocnemius muscles after the LPS challenge.

FIG. 3.

Influences of Leu on muscle fiber diameter (A), density (B), and morphological structure (C) in rats. Values are means (eight rats/treatment), with standard errors represented by vertical bars. ^abMean values with unlike letters were significantly different (P < .05). CON (non-challenged control), rats receiving the control diet and injected with sterile saline; LPS (LPS-challenged control), rats receiving the control diet and injected with LPS; and LPSL, rats receiving a 3.0% Leu diet and injected with LPS.

Relative to the CON group, LPS administration increased (P < .05) the liver CRP concentration (Fig. 4). Among the LPS-challenged rats, Leu supplementation decreased (P < .05) the liver CRP concentration.

FIG. 4.

Influences of Leu on the liver C-reactive protein in rats. Values are means (eight rats/treatment), with standard errors represented by vertical bars. ^abMean values with unlike letters were significantly different (P < .05). CON (non-challenged control), rats receiving the control diet and injected with sterile saline; LPS (LPS-challenged control), rats receiving the control diet and injected with LPS; and LPSL, rats receiving a 3.0% Leu diet and injected with LPS.

As shown in Figure 5, the muscle proteolysis rate (24.07 ± 1.37 vs. 15.63 ± 0.95 nmol tyrosine/mg protein/h) was significantly increased (P < .05) by the LPS challenge. However, dietary supplementation with Leu significantly blocked (P < .05) the gastrocnemius muscle proteolysis caused by LPS injection.

FIG. 5.

Influences of Leu on the gastrocnemius muscle degradation rate in rats. Values are means (eight rats/treatment), with standard errors represented by vertical bars. ^abMean values with unlike letters were significantly different (P < .05). CON (non-challenged control), rats receiving the control diet and injected with sterile saline; LPS (LPS-challenged control), rats receiving the control diet and injected with LPS; and LPSL, rats receiving a 3.0% Leu diet and injected with LPS.

Gene expression of MAFbx, MuRF1, NF-κB, and mTOR

Expression of the muscle proteolytic genes, such as the ubiquitin ligases MAFbx (Fig. 6A) and MuRF1 (Fig. 6B), increased (P < .05) at least twofold after LPS administration. Importantly, Leu ingestion resulted in significant downregulation (P < .05) of these genes in gastrocnemius muscles after LPS administration.

FIG. 6.

Influences of Leu on the relative mRNA expression of MAFbx (A), MuRF1 (B), NF-κB (C), and mTOR (D) in gastrocnemius muscles of rats. Values are means (eight rats/treatment), with standard errors represented by vertical bars. ^abMean values with unlike letters were significantly different (P < .05). CON (nonchallenged control), rats receiving the control diet and injected with sterile saline; LPS (LPS-challenged control), rats receiving the control diet and injected with LPS; and LPSL, rats receiving a 3.0% Leu diet and injected with LPS. MAFbx, muscle atrophy F-box; mTOR, mammalian target of rapamycin; MuRF1, muscle ring finger 1; NF-κB, nuclear factor-κB.

Compared to the CON rats, the LPS challenge significantly elevated (P < .05) the transcription of NF-κB in gastrocnemius muscles (Fig. 6C). Meanwhile, among the LPS-challenged rats, Leu supplementation caused decreased (P < .05) NF-κB transcription in the gastrocnemius muscles.

In Figure 6D, mammalian target of rapamycin (mTOR) mRNA abundance in the gastrocnemius muscles was not affected (P > .05) by LPS challenge. However, dietary Leu supplementation noticeably increased (P < .05) the gastrocnemius muscles mTOR mRNA abundance among the LPS-challenged rats.

Proteolysis by different proteolytic pathways

The influences of Leu on individual proteolytic pathways (Table 3) were assessed by treating incubated gastrocnemius muscles from LPS-challenged rats with 100 μM of the specific proteasome inhibitor clasto-lactacystin β-lactone, in the absence or presence of 2 mM Leu. Calculated as the percentage of protein degradation that was blocked by clasto-lactacystin β-lactone, Leu decreased the proteasome-dependent protein degradation by ∼59.00%. Similar experimental approaches were used to determine the influences of Leu on calpain- and cathepsin-L-dependent proteolysis. When incubated gastrocnemius muscles were treated with 100 μM of calpeptin (calpain inhibitor) or cathepsin-L inhibitor IV in the presence of Leu, the calculated calpain- and cathepsin-L-dependent protein degradation had decreased by 35.02% and 23.66%, respectively.

Table 3.

Influences of Leucine on Protein Degradation Involving Different Proteolytic Pathways in Incubated Gastrocnemius Muscles from Lipopolysaccharide-Challenged Rats

	Protein degradation (nM Tyr/g ww × 2 h)
Inhibitor	No Leu ^a	Leu ^b	Inhibition by Leu (%)
No addition	824.44 ± 34.83	707.98 ± 33.13
Clasto-lactacystin β-lactone (100 μM)	674.61 ± 65.96	646.50 ± 21.09	−58.97
Proteasomal degradation	149.83	61.48
Calpeptin (100 μM)	268.83 ± 69.58	346.96 ± 31.48	−35.02
Calpain-dependent degradation	555.61	361.02
Cathepsin-L inhibitor IV (100 μM)	735.27 ± 73.72	639.91 ± 81.88	−23.66
Lysosomal degradation	89.17	68.07

The inhibition of protein degradation caused by an inhibitor was calculated as the portion of protein degradation regulated by that specific proteolytic pathway. Values are means of eight replicates per treatment.

Gastrocnemius muscles were harvested from LPS-challenged control rats and incubated for 2 h in the absence of Leu.

Gastrocnemius muscles were harvested from LPS-challenged control rats and incubated for 2 h in the presence of Leu (2 mM).

Leu, leucine; LPS, lipopolysaccharide.

NF-κB and proteolytic enzyme activities

Figure 7A shows that when the LPS-challenged gastrocnemius muscles from rats were incubated in the presence of 2 mM Leu, the activity of NF-κB was remarkably (P < .05) decreased. Treatment of incubated muscles from LPS-challenged rats with Leu inhibited (P < .05) calpain (Fig. 7B), cathepsin-L (Fig. 7C), and 20S proteasome (Fig. 7D) activities. Specifically, Leu decreased calpain, 20S proteasome, and cathepsin-L activity by 43.88%, 43.89%, and 50.47%.

FIG. 7.

Influences of Leu on the activity of NF-κB (A), calpain (B), cathepsin-L (C), and 20S proteasome (D) in the incubated muscles from LPS-challenged rats. Values are means (eight rats/treatment), with standard errors represented by vertical bars. *P < .05 versus the LPS group. LPS, gastrocnemius muscles were harvested from LPS-challenged control rats and were incubated for 2 h in the absence of Leu (2 mM); LPSL, gastrocnemius muscles were harvested from LPS-challenged control rats and incubated for 2 h in the presence of Leu (2 mM).

Discussion

An immune challenge is well established as the key limiting factor for animal production.³⁵ The mechanism of immune challenge on performance and protein synthesis is likely due to higher cytokine release and associated endocrine changes resulting from the immune system activation. LPS is the main virulence factors of gram-negative bacteria,³⁶ which can cause an increase in the release of cytokines, such as IL-1.³⁷ In addition, CRP is secreted by the liver in response to a variety of inflammatory cytokines.³⁸ In this study, an LPS-challenged rat model was used to evaluate whether Leu supplementation could alleviate the immune challenge, by inhibiting skeletal muscle proteolysis in the animals. It was shown that serum IL-1 and liver CRP levels were significantly increased after the LPS challenge. These results indicated that the LPS immune-challenged model was successful.

The LPS challenge also caused a remarkable decrease in ADG. This is similar to previous findings, which report that an LPS-induced immune challenge causes decreased growth performance.^35,39 Also, the decreased muscle fiber diameter and the elevated muscle degradation rate observed in the muscle-atrophying rats were consistent with the loss of weight and muscle protein caused by LPS administration, found in a previous study.⁴⁰ It is known that Leu supplementation can increase skeletal muscle protein synthesis by stimulating mTOR-dependent translation initiation.⁴¹ In the present study, we also found that Leu supplementation upregulated the mTOR mRNA expression in LPS-challenged rats, suggesting that 3.0% dietary Leu supplementation facilitates protein synthesis in rats suffering from the immune challenge. These findings may provide insights into mechanisms associated with prevention of skeletal muscle wasting in LPS-challenged rats. However, further studies are necessary to clearly define the optimum levels of Leu requirements in muscle wasting animals.

The molecular mechanism by which Leu attenuated skeletal muscle wasting was evaluated by examining the role of MAFbx and MuRF1, two critical muscle-specific E3 ligases of the ubiquitin-proteasome system, which are recognized as the primary regulators of protein degradation. We observed that Leu supplementation attenuated the increased MAFbx and MuRF1 mRNA levels following the LPS challenge. It is well known that muscle protein degradation requires the proteasome and the enhanced expression of MAFbx and MuRF1,^7,42 while expression of the proteasome subunits and MuRF1 is regulated through activation of the NF-κB transcription factor.⁴³ Thus, we further explored the impacts of Leu on NF-κB expression. The consequent findings showed that the LPS challenge significantly elevated the NF-κB mRNA level, whereas Leu ingestion decreased the NF-κB mRNA level. Collectively, it is possible that the Leu-induced muscle protein degradation protective effects were at least, in part, associated with the decreased MAFbx and MuRF1 expression through the inhibition of NF-κB expression.

Although the ubiquitin-proteasome pathway plays a particularly important role in muscle wasting,^44,45 there is evidence that additional proteolytic mechanisms are involved.⁴⁶ For instance, previous studies suggest that the calpain- and cathepsin-L-dependent proteolysis are activated in atrophying muscle.^47,48 Therefore, we next tested whether a similar mechanism may be involved in the effects of Leu observed in the present study. When muscles from LPS-challenged rats were incubated in the presence of 2 mM Leu, significant inhibitory effects on proteasome-, calpain- and cathepsin-L-dependent protein degradation occurred, indicating that Leu can reduce the catabolic response to an LPS challenge by inhibiting multiple proteolytic pathways in skeletal muscle. A previous study showed that multiple types of skeletal muscle atrophy may involve a common program of changes in gene expression.⁴⁹ Accordingly, the activity of NF-κB in the incubated muscles was determined because this protein complex controls the expression of a large number of genes, including proteolytic enzymes.⁵⁰ As expected, Leu decreased the activity of NF-κB among the LPS-challenged rats. The inhibitory effects of Leu on the activities of three major proteolytic pathways not only validated multiple proteolytic mechanisms during muscle atrophy but also indicated that several proteolysis-associated proteins might be transcriptionally regulated by NF-κB. However, the direct link between these mechanisms and decreased muscle proteolysis is still unknown.

In conclusion, our findings suggest that Leu played beneficial roles in skeletal muscle protein synthesis signaling and in liver acute-phase protein production suppression in LPS-challenged rats. In addition, Leu supplementation reversed the deleterious changes in certain signaling molecules involved in skeletal muscle protein degradation of LPS-challenged rats, which was associated with the decreased MAFbx and MuRF1 expression through downregulation of the NF-κB-dependent signaling pathway and inhibition of the proteasome-, calpain-, and cathepsin-L-dependent protein degradation pathways.

Footnotes

Acknowledgments

We thank Shan Wu, Quyuan Wang, and Huifen Wang for their ongoing assistance during the experiments. This work was supported by the Special Fund for Agro-scientific Research in the Public Interest (201403047) and the Fok Ying-Tung Education Foundation (141027).

Authors' Contributions

Jun He participated in the experimental design and conceived the experiment. Jin Wan carried out the animal trial, performed the biochemical experiments, and participated in data interpretation. Daiwen Chen and Bing Yu contributed to the study design. Yuheng Luo, Xiangbing Mao, Ping Zheng, Jie Yu, and Junqiu Luo assisted with all data interpretation. Jin Wan was also responsible for writing the article.

Author Disclosure Statement

No competing financial interests exist.

References

Orellana

, O'Connor

PMJ

, Bush

, et al.: Modulation of muscle protein synthesis by insulin is maintained during neonatal endotoxemia. Am J Physiol Endocrinol Metab, 2006; 291:E159–E166.

Liu

, Chen

, Odle

, et al.: Fish oil increases muscle protein mass and modulates Akt/FOXO, TLR4, and NOD signaling in weanling piglets after lipopolysaccharide challenge. J Nutr, 2013; 143:1331–1339.

Kim

, Kim

, Yu

, et al.: The activation of NF-κB through Akt-induced FOXO1 phosphorylation during aging and its modulation by calorie restriction. Biogerontology, 2008; 9:33–47.

Sandri

: Autophagy in health and disease. 3. Involvement of autophagy in muscle atrophy. Am J Physiol Cell Physiol, 2010; 298:C1291–C1297.

Ventadour

, Attaix

: Mechanisms of skeletal muscle atrophy. Curr Opin Rheumatol, 2006; 18:631–635.

Jagoe

, Goldberg

: What do we really know about the ubiquitin-proteasome pathway in muscle atrophy?. Curr Opin Clin Nutr, 2001; 4:183–190.

Bodine

, Latres

, Baumhueter

, et al.: Identification of ubiquitin ligases required for skeletal muscle atrophy. Science, 2001; 294:1704–1708.

Zoico

, Roubenoff

: The role of cytokines in regulating protein metabolism and muscle function. Nutr Rev, 2002; 60:39–51.

Suryawan

, Orellana

, Fiorotto

, et al.: Triennial growth symposium: Leucine acts as a nutrient signal to stimulate protein synthesis in neonatal pigs. J Anim Sci, 2011; 89:2004–2016.

10.

Jobgen

, Fu

, Gao

, et al.: High fat feeding and dietary L-arginine supplementation differentially regulate gene expression in rat white adipose tissue. Amino Acids, 2009; 37:187–198.

11.

Palii

, Kays

, Deval

, et al.: Specificity of amino acid regulated gene expression: Analysis of genes subjected to either complete or single amino acid deprivation. Amino Acids, 2009; 37:79–88.

12.

: Amino acids: Metabolism, functions, and nutrition. Amino Acids, 2009; 37:1–17.

13.

Dardevet

, Sornet

, Balage

, et al.: Stimulation of in vitro rat muscle protein synthesis by leucine decreases with age. J Nutr, 2000; 130:2630–2635.

14.

Yin

, Yao

, Liu

, et al.: Supplementing L-leucine to a low-protein diet increases tissue protein synthesis in weanling pigs. Amino Acids, 2010; 39:1477–1486.

15.

Anthony

, Anthony

, Kimball

, et al.: Orally administered leucine stimulates protein synthesis in skeletal muscle of postabsorptive rats in association with increased eIF4F formation. J Nutr, 2000; 130:139–145.

16.

Crozier

, Kimball

, Emmert

, et al.: Oral leucine administration stimulates protein synthesis in rat skeletal muscle. J Nutr, 2005; 135:376–382.

17.

, Yin

, Bie

, et al.: Leucine nutrition in animals and humans: mTOR signaling and beyond. Amino Acids, 2011; 41:1185–1193.

18.

Dardevet

, Sornet

, Bayle

, et al.: Postprandial stimulation of muscle protein synthesis in old rats can be restored by a leucine-supplemented meal. J Nutr, 2002; 132:95–100.

19.

Escobar

, Frank

, Suryawan

, et al.: Physiological rise in plasma leucine stimulates muscle protein synthesis in neonatal pigs by enhancing translation initiation factor activation. Am J Physiol Endocrinol Metab, 2005; 288:E914–E921.

20.

Duan

, Li

, et al.: The role of leucine and its metabolites in protein and energy metabolism. Amino Acids, 2016; 48:41–51.

21.

van Loon

LJC

: Leucine as a pharmaconutrient in health and disease. Curr Opin Clin Nutr, 2012; 15:71–77.

22.

Sakkas

, Jones

, Houdijk

JGM

, et al.: Leucine and methionine deficiency impairs immunity to gastrointestinal parasites during lactation. Br J Nutr, 2013; 109:273–282.

23.

English

, Mettler

, Ellison

, et al.: Leucine partially protects muscle mass and function during bed rest in middle-aged adults. Am J Clin Nutr, 2016; 103:465–473.

24.

, Yin

, Li

, et al.: Amino acids and immune function. Br J Nutr, 2007; 98:237–252.

25.

Reeves

, Nielsen

, Fahey

Jr. : AIN-93 purified diets for laboratory rodents: Final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J Nutr, 1993; 123:1939–1951.

26.

Nagasawa

, Kido

, Yoshizawa

, et al.: Rapid suppression of protein degradation in skeletal muscle after oral feeding of leucine in rats. J Nutr Biochem, 2002; 13:121–127.

27.

Liu

, Wang

, Zhao

, et al.: Effects of maternal LPS exposure during pregnancy on metabolic phenotypes in female offspring. PLoS One, 2014; 9:e114780.

28.

Liu

, Huang

, Hou

, et al.: Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Br J Nutr, 2008; 100:552–560.

29.

Wan

, Jiang

, Xu

, et al.: Alginic acid oligosaccharide accelerates weaned pig growth through regulating antioxidant capacity, immunity and intestinal development. RSC Adv, 2016; 6:87026–87035.

30.

Wan

, Yang

, Xu

, et al.: Dietary chitosan oligosaccharide supplementation improves foetal survival and reproductive performance in multiparous sows. RSC Adv, 2016; 6:70715–70722.

31.

Wan

, Li

, Chen

, et al.: Recombinant plectasin elicits similar improvements in the performance and intestinal mucosa growth and activity in weaned pigs as an antibiotic. Anim Feed Sci Tech, 2016; 211:216–226.

32.

Livak

, Schmittgen

: Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔCt method. Methods, 2001; 25:402–408.

33.

Fareed

, Evenson

, Wei

, et al.: Treatment of rats with calpain inhibitors prevents sepsis-induced muscle proteolysis independent of atrogin-1/MAFbx and MuRF1 expression. Am J Physiol Regul Integr Comp Physiol, 2006; 290:1589–1597.

34.

Bradford

: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 1976; 72:248–254.

35.

Chen

, Zhang

, Wu

: Influences of lipopolysaccharide-induced immune challenge on performance and whole-body protein turnover in weanling pigs. Livest Sci, 2008; 113:291–295.

36.

Heumann

, Roger

: Initial responses to endotoxins and Gram-negative bacteria. Clin Chim Acta, 2002; 323:59–72.

37.

Feldmann

, Male

: Cell cooperation in the immune response. Immunology, 1989; 2:147.

38.

Du Clos

: Function of C-reactive protein. Ann Med, 2000; 32:274–278.

39.

Dritz

, Owen

, Goodband

, et al.: Influence of lipopolysaccharide-induced immune challenge and diet complexity on growth performance and acute-phase protein production in segregated early-weaned pigs. J Anim Sci, 1996; 74:1620–1628.

40.

Jin

, Li

: Curcumin prevents lipopolysaccharide-induced atrogin-1/MAFbx upregulation and muscle mass loss. J Cell Biochem, 2007; 100:960–969.

41.

Torrazza

, Suryawan

, Gazzaneo

, et al.: Leucine supplementation of a low-protein meal increases skeletal muscle and visceral tissue protein synthesis in neonatal pigs by stimulating mTOR-dependent translation initiation. J Nutr, 2010; 140:2145–2152.

42.

Gomes

, Lecker

, Jagoe

, et al.: Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl Acad Sci USA, 2001; 98:14440–14445.

43.

Russell

, Tisdale

: Mechanism of attenuation by β-hydroxy-β-methylbutyrate of muscle protein degradation induced by lipopolysaccharide. Mol Cell Biochem, 2009; 330:171–179.

44.

Lecker

, Goldberg

, Mitch

: Protein degradation by the ubiquitin-proteasome pathway in normal and disease states. J Am Soc Nephrol, 2006; 17:1807–1819.

45.

Acharyya

, Guttridge

: Cancer cachexia signaling pathways continue to emerge yet much still points to the proteasome. Clin Cancer Res, 2007; 13:1356–1361.

46.

Poylin

, Fareed

, O'Neal

, et al.: The NF-κB inhibitor curcumin blocks sepsis-induced muscle proteolysis. Mediat Inflamm, 2008; 2008:317851.

47.

Wei

, Fareed

, Evenson

, et al.: Sepsis stimulates calpain activity in skeletal muscle by decreasing calpastatin activity but does not activate caspase-3. Am J Physiol Regul Integr Comp Physiol, 2005; 288:R580–R590.

48.

Deval

, Mordier

, Obled

, et al.: Identification of cathepsin L as a differentially expressed message associated with skeletal muscle wasting. Biochem J, 2001; 360:143–150.

49.

Jackman

, Kandarian

: The molecular basis of skeletal muscle atrophy. Am J Physiol Cell Physiol, 2004; 287:C834–C843.

50.

Penner

, Gang

, Wray

, et al.: The transcription factors NF-κB and AP-1 are differentially regulated in skeletal muscle during sepsis. Biochem Biophys Res Commun, 2001; 281:1331–1336.