Cerebrosides from Sea Cucumber Protect Against Oxidative Stress in SAMP8 Mice and PC12 Cells

Abstract

Alzheimer's disease (AD) is a neurodegenerative disorder. Emerging evidence implicates β-amyloid (Aβ) plays a critical role in the progression of AD. In this study, we investigated the protective effect of cerebrosides obtained from sea cucumber against senescence-accelerated mouse prone 8 (SAMP8) mice in vivo. We also studied the effect of cerebrosides on Aβ-induced cytotoxicity on the rat pheochromocytoma cell (PC12) and the underlying molecular mechanisms. Cerebrosides ameliorated learning and memory deficits and the Aβ accumulation in demented mice, decreased the content of malondialdehyde (MDA), 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-OHdG), 8-hydroxy-2′-deoxyguanosine (8-oxo-G), and nitric oxide (NO), and enhanced the superoxide dismutase (SOD) activity significantly. The neuroprotective effect of sea cucumber cerebrosides (SCC) was also verified in vitro: the cerebrosides increased the survival rate of PC12 cells, recovered the cellular morphology, downregulated the protein levels of Caspase-9, cleaved Caspase-3, total Caspase-3, and Bax, and upregulated the protein level of Bcl-2, revealing that cerebrosides could inhibit Aβ-induced cell apoptosis. The results showed the protective effect of SCC was regulated by the mitochondria-dependent apoptotic pathway. Our results provide a new approach to developing the marine organisms as functional foods for neuroprotection.

Introduction

Alzheimer's disease (AD) is a neurodegenerative disorder, which is characterized by the loss of neurons and the impairment of cognitive function.¹ The presence of neurofibrillary tangles and increased β-amyloid (Aβ) plaque in the brain are regarded as the pathological hallmark of AD.²

Although the mechanism of AD remains unclear, increasing evidence has implicated that Aβ, which is an important component in senile plaque, plays a critical role in the progression of AD. Aβ accumulates in the brain and may trigger neurodegeneration by inducing tau-phosphorylation, oxidative stress, and mitochondria-mediated apoptosis.^3,4 Aβ is derived from the proteolytic cleavage of the amyloid precursor protein by β- and γ-sec retases.⁵ Most of the full-length Aβ peptide is 40 residues, whereas a small proportion is the 42 residue variant.⁶ The Aβ ₄₂ variant is more hydrophobic and more prone to fibril formation than Aβ ₄₀.⁷ Aβ _25–35 is an 11 amino acid fragment of Aβ ₄₂ located at the C-terminal end of the hydrophobic domain, which is often used to mimic the toxic effects caused by Aβ ₄₂.⁸

Senescence-accelerated mouse (SAM) was established as a model of accelerated aging by Takeda et al. ⁹ Compared to senescence-accelerated mouse resistance 1 (SAMR1) presenting a normal aging, senescence-accelerated mouse prone 8 (SAMP8) spontaneously shows age-related behavioral disorders, including learning deficits and cognitive impairment.¹⁰ Besides, SAMP8 mice also display some established pathological features of AD, such as Aβ deposition, increased levels of hyperphosphorylated tau and oxidative stress.^11
–13 Therefore, SAMP8 mice are considered to be good models to study the fundamental mechanism of age-related learning and memory deficits related to AD. The rat pheochromocytoma cell line (PC12), which expresses multiple properties of neurons, was widely used as a model for neurochemical study in vitro research on AD.¹⁴

Sea cucumber is well known as a traditional seafood in East Asian countries, such as Korea, China, and Japan, which contains many bioactive substances, including saponins, phospholipids, and cerebrosides.¹⁵ Sea cucumber has an anticancer, antiviral, and anti-inflammatory activity.¹⁶ The cerebrosides, a type of endogenous glycolipids, widely exist in cell membranes of fungi, plants, animals, and marine organisms.¹⁷ Many studies demonstrated that the cerebrosides derived from sea cucumber (SCC) could improve the biological and nutritional benefits, including antitumor actions, immunomodulatory activity, and improve some metabolic parameters associated with obesity in mice.^18
–20 Our previous study revealed that SCC protects against oxidative damage induced by tert-butylhydroperoxide (t-BHP) and hydrogen peroxide (H₂O₂) in PC12 cells.²¹ However, no study has yet been examined whether SCC has neuroprotective effects in SAMP8 mice and Aβ-induced neurodamage in PC12 cells.

In this study, we first evaluated the neuroprotective effect of SCC in SAMP8 mice, and we further verified the protective mechanism of SCC by Aβ _25–35-treated PC12 cells.

Materials and Methods

Reagents

Sea cucumber (Acaudina molpadioides) was purchased from the Zhou-Shan Fishery Company (Zhejiang Province, China). PC12 cells were obtained from Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). RPMI 1640 medium was purchased from GIBCO (Grand Island, NY, USA). Fetal bovine serum (FBS) was purchased from Hyclone (Logan, UT, USA). Aβ _25–35 and 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Aβ _1–42 ELISA kit was purchased from Wuhan Uscn Life Science, Inc. (Wuhan City, China). Nitric Oxide Assay Kit, TBARS (Thiobarbituric Acid Reactive Substances) Assay Kit, and Total Superoxide Dismutase Assay Kit were obtained from Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). The Nitric Oxide Synthase ELISA kit, 8-hydroxy-2′-deoxyguanosine ELISA kit, and 7,8-dihydro-8-oxoguanine ELISA kit were from R&D System (Minneapolis, MN, USA). Maxima SYBR Green Quantitative Real-Time PCR Master Mix was purchased from Fermentas (Glen Burnie, MD, USA). Anti-Bcl-2, anti-Bax, anti-cleaved Caspase-3, anti-total Caspase-3, anti-Caspase-9 and anti-beta-actin antibodies were from Abcam (Cambridge, United Kingdom).

The preparation and analysis of SCC

The cerebrosides were extracted from the body wall of sea cucumber (A. molpadioides) with CHCl₃/MeOH (2:1, 15 L, four times), according to the modified method of Xu et al. ²² The cerebrosides were isolated from the less polar lipid fraction of the chloroform-methanol extract using high-speed counter-current chromatography with a two-phase solvent system composed of petroleum ether-methanol-water (5:4:1, v/v/v). Then, the purity of SCC was 96.8% analyzed by HPLC-ELSD. A binary gradient elution system consisted of hexane-2-propanol (A, 99:1 by vol) and dichloromethane-methanol (B, 60:40 by vol). The separation was achieved using the following gradient program (100:0, 55:45, 40:60, and 0:100, by vol). The flow rate was 1.0 mL/min. The temperature of drift tube was kept at 50°C and the flow rate of nitrogen was 2.4 L/min. Three cerebrosides were purified from the sea cucumber A. molpadioides (12% AMC1, 78% AMC2, and 10% AMC3).

The preparation of SCC solution was followed by the liposome preparation as described by Du et al. with minor modifications. The mixing molar ratios of the composite lipid classes were SCC/cholesterol = 1:1. The mixtures were dissolved in chloroform and dried to thin films under reduced pressure in a rotary evaporator. The lipid films were hydrated with Hanks balanced salt solution to exfoliate the lipid bilayers by vigorous vortex mixing for 5 min. Then, the liposome suspension was extruded 21 times through a polycarbonate membrane filter with a pore size of 200 nm, and the liposome suspension was diluted to the appropriate concentration by a medium for the following experiments.²³ The control group contained cholesterol only.

Animals and diets

Four-month-old male SAMP8 mice and SAMR1 mice were provided by Nanjing Qingzilan Co. Ltd. (Nanjing, China). The SAMP8 mice were randomly assigned to 2 dietary groups of 10 mice each: 1 control group and 1 SCC group. The SAMR1 mice (n = 10), which showed normal characteristics, were used as the external control. All animals were allowed free access to drinking water. The mice were divided into three groups: SAMP8 group, SAMR1 group, and SCC group. The SAMP8 group and SAMR1 group were supplemented with AIN-93G diet (Table 1). The SCC group mice were supplemented with AIN-93G diet plus 0.5% SCC (Table 1). After 12 weeks of treatment, the mice were tested by the Morris water maze or Barnes maze. The experiment was approved by the Animal Ethics Committee of College of Food Science and Engineering of Ocean University of China (Approval No.: SPXY2015012). All the animals were housed at the Laboratory Animal Facility at the Ocean University of China. Animal care was conducted all through the entire experiment, such as be kind to the animals and minimize the suffering of animals as much as possible.

Table 1.

Composition of Experimental Diets (g/kg Diet)

Ingredients	Control	SCC
Casein	200	200
Starch	499.5	499.5
Sucrose	100	100
Soy oil	50	48.3
Lard	50	48.3
Mineral mix^a	35	35
Vitamin mix^b	10	10
Cellulose	50	50
l-Cystine	3	3
Choline bitartrate	2.5	2.5
Cerebrosides	—	5

The mice were divided into three groups: SAMP8 group, SAMR1 group, and SCC group. The SAMP8 group and SAMR1 group were supplemented with AIN-93G diet. The SCC group mice were supplemented with AIN-93G diet plus 0.5% SCC.

AIN-93G mineral mix.

AIN-93G vitamin mix.

SAMP8, senescence-accelerated mouse prone 8; SAMR1, senescence-accelerated mouse resistance 1; SCC, sea cucumber cerebrosides.

Morris water maze test

The procedures were similar to that described by Morris with minor modifications.²⁴ Briefly, a circular stainless steel pool (130 cm in diameter and 50 cm in height) was divided into four quadrants which were marked with a triangle, square, diamond, and circle, respectively. Ink staining water was filled into the pool and the temperature was set at 22°C ± 1°C. A circular black escape platform (9 cm in diameter and 29 cm in high) was located 1 cm beneath the surface of the water in the middle of one of the quadrants. SAMR1 and SAMP8 mice were trained to find the platform with three trails on the first day and then tested to find the hidden platform for six consecutive days. Each mouse was released and faced the wall of the maze. If the animal found the platform within 60 sec, it was allowed to remain there for 10 sec; if the mouse failed to locate the platform within 60 sec, it was gently guided to the platform and allowed to stay there for 10 sec and its escape latency was recorded as 60 sec. The swim paths, distances, and latencies taken to swim to the platform were monitored with a video camera linked to a computer system. Probe tests were performed on the seventh day to evaluate spatial memory retention. The platform was removed from the pool and the mice were then placed in a position opposite the location of platform position and allowed to swim for 60 sec. The number of crossings over the previous position of the platform and the time spent in the target quadrant in which the platform was hidden during the acquisition trails were recorded as measures for spatial memory.

Barnes maze

The procedures were similar to that described by Barnes with minor modifications.²⁵ Briefly, the apparatus is a circular platform of 92 cm diameter with 20 potential escape holes of 5 cm in diameter. The escape hatch is a black enclosure that attaches below the target escape hole. The mice were placed in the center of the apparatus and allowed to choose and enter into the hole by themselves. During 4-min trials on six consecutive days, the total distance, the error times, and the amount of time taken to find the escape hole were measured using a video-tracking software. If a mouse did not find the escape hole during a particular trial, the latency to escape was assigned a maximum value of 4 min.

Preparation of supernatant of hippocampus and brains

After completing the behavioral studies, all the mice were decapitated and the hippocampi were separated from the whole brain on ice and weighed, then frozen with liquid nitrogen, and stored at −80°C until use.

Hippocampus samples were homogenized in 10 volumes of TBS containing a cocktail of protease inhibitors.²⁶ Samples were sonicated briefly (10 W, 2 × 5 sec) and centrifuged, and the supernatant was collected.

The brain excluding hippocampus was prepared as a 10% (w/w) tissue homogenate in 0.9% saline solution, respectively. The homogenate was centrifuged and the supernatant was collected. The protein concentrations of the supernatant were determined using a BCA protein assay kit.

Biochemistry measurement

The level of soluble Aβ _1–42 in the supernatant of hippocampus was measured using an Aβ _1–42 ELISA kit. The concentration of nitric oxide (NO) was detected using the Nitric Oxide Assay Kit. The concentration of nitric oxide syntheses (NOS) was detected using the Nitric Oxide Synthase ELISA kit. Lipid peroxidation was determined using the TBARS Assay Kit and expressed as nmol malondialdehyde (MDA) equivalents per mg protein. The enzyme activities of superoxide dismutase (SOD) were measured using the Total Superoxide Dismutase Assay Kit. The concentration of 8-OHdG and 8-oxo-G in brain tissue were, respectively, measured using the 8-hydroxy-2′-deoxyguanosine ELISA kit and 7,8-dihydro-8-oxoguanine ELISA kit. All these measurements were performed according to the manufacturer's instructions.

Preparation of Aβ _25–35 solution

Aβ _25–35 was prepared as previously described.²⁷ Briefly, Aβ _25–35 was dissolved in 1% acetic acid solution at a concentration of 200 μM and incubated at 37°C for 7 days to induce aggregation. After aggregation, the solution was stored at −20°C until use.

Cell culture and treatment

Highly differentiated PC12 cells were cultured in RPMI 1640 supplemented with 100 U/mL penicillin, 100 U/mL streptomycin, and 10% FBS at 37°C in a humidified atmosphere of 95% air and 5% CO₂. The medium was changed every other day. To investigate the effects of SCC on PC12 cells, cells were preincubated with SCC at the indicated concentrations for 24 h, Aβ _25–35 at 20 μM was added to the culture for an additional 24 h, followed by the assays described below.

Determination of cell viability

PC12 cells were plated at a density of 1.5 × 10⁵ cells/mL in 96-well plates, and the viability was assessed by the MTT assay as previously reported.²⁸ Briefly, at the end of treatment, the medium was gently aspirated and 200 μL/well MTT (0.5 mg/mL) was added to each well. After incubating at 37°C for 4 h, the medium was discarded, and 200 μL acidated dimethylcarbinol was added into each well to dissolve the formazan product. The absorbance at 570 nm was measured using a microplate reader (Model 680; Bio-Rad, Tokyo, Japan). Cell viability was expressed as a percentage of untreated controls.

RNA extraction and real-time PCR assay

Total cellular RNA was isolated from PC12 cells using Trizol reagent (Invitrogen, USA). The concentration of total RNA was assessed by Nanodrop2000 (Thermo Scientific, USA). One microgram of total RNA from each sample was reverse transcribed to cDNA using random primers and Moloney Murine Leukemia Virus Reverse Transcriptase (Promega Corporation, Madison, WI, USA). Selected genes were amplified using SYBR Green I Master Mix (Roche, Germany) in an iQ5 real-time detection system (Bio-Rad, USA) with 0.3 μM of both forward and reverse primers. PCR conditions were as follows: 1 cycle of 95°C for 10 min, 45 cycles of 95°C for 15 sec, 55–60°C for 20 sec, and 72°C for 30 sec. The purity of PCR products was assessed by melt curve analysis. Relative gene expression was quantified using the standard curve method. Results were expressed as the relative values after normalization to β-actin RNA. The primers used in this study are presented in Table 2.

Table 2.

Sequences of the Primers Used in the Quantitative Real-Time PCR

Gene	Forward primers	Reverse primers
Caspase-9	GCCTCATCATCAACAACGTG	CCTGGTATGGGACAGCATCT
Caspase-3	GACGACAGGGTGCTACGAT	ACAGACCAGTGCTCACAAGG
Bcl-2	TGGGATACTGGAGATGAAGACT	CCACCGAACTCAAAGAAGG
Bax	TCATCCAGGATCGAGCAGA	AAAGTAGAAGAGGGCAACCAC
GSK-3β	AACACCAACAAGGGAGCA	GAGCGTGAGGAGGGATAA
Akt2	ACACGATGTTGGCAAAGAA	GTGCTGGAGGACAACGACT
β-Actin	GCAGATGTGGATCAGCAAGC	GTCAAAGAAAGGGTGTAAAACG

Western blot analysis

Cells were homogenized in the RIPA lysis buffer, which contains the protease inhibitor PMSF. Cellular proteins were isolated on 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Proteins were blotted onto a PVDF membrane. The membranes were incubated with antibodies against Bcl-2, Bax, Caspase-9, cleaved Caspase-3, and total Caspase-3 overnight at 4°C. After this, membranes were incubated with goat anti-rabbit IgG for 2 h at room temperature and the blots were developed with chemiluminescent horseradish peroxidase substrate.

Statistical analysis

The data are presented as mean ± standard error of the mean. Differences between the groups were analyzed by one-way ANOVA and the Bonferroni test using SPSS software (version 17.0). P < .05 was considered statistically significant.

Results

SCC improved learning and memory deficits in SAMP8 mice

The spatial learning and memory in mice were tested using the Morris water maze. In the training session, SAMR1 rapidly learned the location of the platform, whereas SAMP8 had a longer escape latency on the test days compared to SAMR1. The significant decrease in escape latency was observed between untreated mice and SCC-fed mice on days 5 and 6 (Fig. 1A). The probe trial was tested the day after completing the 7-day training. The number of platform crossings in Figure 1B and time spent in the target quadrant in Figure 1C, both were obviously lower in SAMP8 mice compared to SAMR1 mice. However, the SCC-fed mice spent more time in the target quadrant and recovered more number of platform crossings compared to the untreated mice.

FIG. 1.

Effect of SCC on the learning and memory and spatial learning activity in SAMP8 mice. (A) Effect of SCC on the escape latency of SAMP8 mice in the Morris water maze. (B) Effect of SCC on the number of crossing of the platform by SAMP8 mice in the probe trail in the Morris water maze. (C) The time spent in the target quadrant by SAMP8 mice in the Morris water maze. Total distance (D), the escape latency (E), and the error times (F) were recorded in Barnes maze. The results were expressed as mean ± SEM. of 10 mice in each group. ^# P < .05 and ^## P < 0.01 versus the SAMR1 group, *P < .05 and **P < .01 versus the SAMP8 group. SAMP8, senescence-accelerated mouse prone 8; SAMR1, senescence-accelerated mouse resistance 1; SCC, sea cucumber cerebrosides; SEM, standard error of the mean.

The Barnes maze was considered to be more anxiogenic than the Morris water maze; we used it to study the effects of SCC on spatial memory. The total distance, the escape latency, and the error times were recorded as the indirect index of spatial memory. The longer total distance in Figure 1D was observed in untreated SAMP8 mice compared to the SAMR1 group. A longer escape latency in Figure 1E and more errors in Figure 1F were found in untreated SAMP8 mice compared to the SAMR1 group. However, the mice prefed with SCC showed a better performance in the total distance, error times, and the escape latency than that in untreated SAMP8 mice.

Effect of SCC on the Aβ ₄₂ levels in SAMP8 mice

To investigate whether SCC treatment affected the level of Aβ ₄₂, we measured the content of Aβ ₄₂ in the hippocampus. As shown in Figure 2, the Aβ ₄₂ level in the SAMP8 mice increased compared to the SAMR1 mice, In contrast, the results in SCC-fed group revealed a significant reduction in the level of Aβ ₄₂, in which the amounts were decreased by 39.2% compared to the SAMP8 mice.

FIG. 2.

SCC decreases Aβ ₄₂ levels in SAMP8 mice. Hippocampus Aβ ₄₂ levels were measured by ELISA kit. ^# P < .05 versus the SAMR1 group, *P < .05 versus the SAMP8 group. Aβ, β-amyloid.

Effect of SCC on oxidative stress in the brain of SAMP8 mice

The activity of SOD and the content of NO, NOS, MDA, 8-OHdG, and 8-oxo-G in brain tissue were measured. Compared with SAMP1 mice, the activity of SOD was significantly decreased in SAMP8 mice (Fig. 3A). Dietary SCC, significantly, improved the activity of SOD in SAMP8 mice (Fig. 3A). The concentration of MDA and NO in the brain of SAMP8 mice was significantly increased compared to the SAMR1 mice (Fig. 3B, C). However, there was a remarkable decrease in MDA and NO after administration of SCC in mice. In addition, the concentration of NOS was higher in SAMP8 mice than that in SAMR1 mice. However, there was no significant difference in NOS between SAMP8 and SCC-fed mice (Fig. 3D). As for the concentration of 8-OHd and 8-oxo-G, it was higher in SAMP8 mice than that in SAMR1 mice, while the concentration of 8-OHdG and 8-oxo-G was clearly decreased when the SAMP8 mice were prefed with SCC compared to the untreated mice (Fig. 3E, F).

FIG. 3.

Effect of SCC on the antioxidative activity and oxidant damage in SAMP8 mice. (A) The activity of SOD. (B) The concentration of MDA. (C, D) The concentration of NO and NOS of SAMP8 mice. (E, F) The concentration of 8-OHdG and 8-oxo-G of SAMP8 mice in brain tissue. ^# P < .05, versus SAMR1 group; *P < .05, versus SAMP8 group; **P < .01, versus SAMP8 group. MDA, malondialdehyde; NO, nitric oxide; NOS, nitric oxide syntheses; SOD, superoxide dismutase.

Effect of Aβ and SCC on PC12 cell viability

The effect of different concentrations of Aβ _25–35 (0, 1, 5, 10, and 20 μM) on the viability of PC12 cells was examined. Cells were incubated with Aβ _25–35 for 24 and 48 h, and cellular viability was detected by the MTT assay (n = 6). As shown in Figure 4A, Aβ _25–35 decreased cell viability in a concentration- and time-dependent manner and a significant reduction of cell survival was presented at concentrations of 5 μM and higher (P < .01). Treatment with 20 μM Aβ for 24 h induced ∼50% cell death, which was used for this study.

FIG. 4.

Effect of Aβ and SCC on PC12 cell viability. (A) Aβ decreased cell viability in a dose- and time-dependent manner. (B) Effect of SCC on PC12 cell viability. Results were obtained from three independent experiments and were expressed as mean ± SEM. **P < .01 versus the normal control group at 24 h in culture, ^## P < .01 versus the normal control group at 48 h in culture.

Then, various concentrations of SCC (25–400 μg/mL) were added to the culture medium, and after 24 h, cell cytotoxicity was measured. However, 400 μM SCC did not show significant cytotoxicity on PC12 cells (Fig. 4B).

SCC inhibited Aβ _25–35-induced cytotoxicity in PC12 cells

To determine if SCC can protect PC12 cells from Aβ-induced cytotoxicity, we treated PC12 with 20 μM Aβ _25–35 in the presence of SCC at the concentrations of 100 and 400 μg/mL for 24 h. As shown in Figure 5A, PC12 cells grew with long neurites in the medium; when exposed to Aβ _25–35, the damage to cells can be observed obviously. The neurites became shorter than before and cells began to collapse. However, when the cells were pretreated with different concentrations of SCC, the neurite growth was protected and the cell debris disappeared. The MTT assay showed that pretreatment with 400 μM SCC inhibited the decrease in cell viability induced by Aβ _25–35 (Fig. 5B, P < .01), suggesting that SCC had a protective effect against Aβ-induced cytotoxicity. The results indicated SCC could alleviate Aβ-induced cell death.

FIG. 5.

SCC decreased Aβ _25–35-induced cell death. PC12 cells were pretreated with SCC (100, 200, and 400 μg/mL) for 24 h, then exposed to 20 μM Aβ _25–35 for 24 h, the cellular morphology was observed under an inverted microscope (A), and the cell viability was measured by the MTT assay (B). Results were obtained from three independent experiments and were expressed as mean ± SEM. ^# P < .05 versus the normal control group, *P < .05 and **P < .01 versus the Aβ _25–35 group.

Effects of SCC on the mRNA levels of Bcl-2, Bax, Caspase-9, and Caspase-3

To investigate the protective mechanisms of SCC against cell death, we choose some genes such as Caspase-9, Caspase-3, Bcl-2, and Bax., As shown in Figure 6, in Aβ-treated cells, Bcl-2 levels decreased while Caspase-9, Caspase-3, and Bax levels increased significantly. However, when the cells were treated with SCC, a remarkable decrease was observed in Caspase-9 and Caspase-3 mRNA level.

FIG. 6.

Effect of SCC on Aβ-induced cell death through the mitochondrial pathway. PC12 cells were pretreated with SCC (100 and 400 μg/mL) for 24 h and then the cells were exposed to 20 μM Aβ _25–35 for 24 h. The mRNA expression of Bax (A), Bcl-2 (B), Caspase-3 (C), and Caspase-9 (D) was measured by quantitative real-time PCR, normalized with that of β-actin. Results were obtained from three independent experiments and were expressed as mean ± SEM. ^## P < .01 versus the normal control group, **P < .01 versus the model group.

Western blot analysis

The level of antiapoptotic protein Bcl-2 was diminished and the proapoptotic protein Bax was increased in Aβ _25–35-treated cells (Fig. 7). Treatment of 100 μg/mL and 400 μg/mL SCC markedly reversed the Bcl-2 level. Meanwhile, the level of Bax was markedly decreased compared with the model. Figure 7 indicated that Aβ _25–35 upregulated cleaved Caspase-3, Caspase-9, and simultaneously upregulated total Caspase-3. Such an adverse effect was partially inhibited in the presence of SCC. In addition, the total amount of Caspase protein was decreased in the treated group. These data suggested the antiapoptotic ability of SCC.

FIG. 7.

Effect of SCC on Bcl-2, Bax, Cleaved Caspase-3, total Caspase-3, and Caspase-9 protein levels. PC12 cells were treated with SCC (100, 400 μg/mL) for 24 h in the presence of 20 μM Aβ. The expression of Bcl-2, Bax, Cleaved Caspase-3, total Caspase-3, and Caspase-9 level was detected by Western blot analysis and normalized with β-actin. Results are expressed as mean ± SEM of three independent experiments. ^## P < .01, versus normal control group, **P < .01 versus the model group.

Discussion

AD is a neurodegenerative disease that gradually results in loss of memory and impairment of cognitive functions in the elderly.²⁹ Senile plaques are considered to be the hallmark of AD, which is related to the excessive Aβ accumulation.³⁰ Aβ _25–35 is a shorter toxic fragment and represents the biologically active region of full-length Aβ ₄₀/₄₂, exerting similar neurotoxic effects compared with that of Aβ _40/42.³¹ Aβ _25–35 has been used in many experiments.^32
–34 Therefore, Aβ _25–35 used in this study is believed to be suitable to verify whether SCC affords protection against Aβ-induced neurotoxicity in PC12 cells.

In this study, we investigated the effects of SCC in SAMP8 mice in vivo. The SAMP8 is a nongenetically modified strain of mice with a characteristically accelerated aging process.¹² In the Morris water test, the SAMP8 mice showed a longer escape latency and less number of platform crossings and time spent in the target quadrant than SAMR1 mice, which exhibited AD-like cognitive deficits. However, when the SAMP8 mice were fed with SCC, the learning and memory deficits could be ameliorated in the later days of training. These findings also agreed with the results found in the Barnes test, which might depend on the neuroprotective effects of SCC. Aβ is produced as a monomer, but readily aggregates to form multimeric complexes. These complexes range from low molecular weight dimers and trimers to high molecular weight protofibrils, which are soluble Aβ. Finally, fibrillary Aβ known as amyloid plaques was formed, which were insoluble Aβ. Genetic evidence strongly supports the view that Aβ production is central to the cause of AD and the level of soluble Aβ is increased threefold in AD and correlates highly with markers of disease severity.³⁵ Therefore, we measured the soluble Aβ in the hippocampus using an ELISA kit. The decreasing Aβ ₄₂ levels in brain was observed in SCC-fed mice compared to the SAMP8 mice, which suggests that the neuroprotective effect of SCC might be related to its ability to eliminate excess Aβ ₄₂ accumulation or inhibit its production.

AD brain is characterized by extensive oxidative stress, and Aβ is thought, by many researches, to be central to the pathogenesis of this disorder. Oxidative stress induced by Aβ is widely believed to be implicated as one means for AD.³⁶ Oxidative stress has been shown to affect Aβ generation. Moreover, Aβ leads to neuronal lipid peroxidation, protein oxidation, and DNA oxidation. Soluble, aggregated Aβ is postulated to insert into neuronal membranes and might then induce the formation of ROS and increased neurotoxicity.³⁷ The activity of SOD was clearly enhanced, suggesting that the protective effects of SCC might be partly associated with its antioxidative function. The concentration of MDA, 8-OHdG, and 8-oxo-G in brain tissue was significantly reduced when the mice were pretreated with SCC. NO is an important messenger molecule involved in many physiological and pathological processes and is produced mainly by NOS. The concentration of NOS in SCC-fed mice was not different from untreated mice. The concentration of NO was significantly reduced in mice prefed with SCC, indicating that SCC could inhibit the production of NO (P < .05), whereas the increase in NO content in SAMP8 mice was not associated with an increased NOS concentration. Possibly, the elimination of NO in SAMP8 was lower than SCC-fed mice. These results suggested that SCC could reverse cognitive impairment and inhibit the production of Aβ in the brain of SAMP8 mice by preventing the oxidative stress induced by Aβ.

The results in vivo showed that SCC could improve the cognitive function and decrease the Aβ concentration in hippocampus by inhibiting the oxidative stress in SAMP8 mice. We verified the protective effect and the underlying protective mechanism of SCC in Aβ-induced damage in PC12 cells. Bcl-2 family proteins, which contain Bcl-2 and Bax, play key roles in apoptotic cell death by inducing caspase activation.³⁸ Bcl-2 is antiapoptotic, while Bax has the opposite function. Caspase-9 and Caspase-3 are the initiator and executioner Caspases, respectively, which typically predominate in neurodegenerative diseases.³⁹ In the process, activated Bax forms an oligomeric pore, resulting in the release of cytochrome c from the mitochondria and the serial activation of Caspase-9 and Caspase-3.⁴⁰ Our finding indicated that the mRNA level of Caspase-3 and Caspase-9 and the protein expression of Bax, Caspase-9, cleaved Caspase-3, and total Caspase-3 were increased by Aβ _25–35, while SCC significantly reduced their activity. Treatment of PC12 cells with SCC could restore the decreased Bcl-2 mRNA and protein level induced by Aβ _25–35. These results suggested that SCC could inhibit Aβ-induced cell apoptosis by the mitochondria-dependent apoptotic pathway.

In conclusion, this study demonstrated that cerebrosides from sea cucumber can ameliorate the learning and memory deficits as well as inhibit the oxidative stress damage in vivo. The cerebrosides increased the survival rate of PC12 cells, recovered the cellular morphology, downregulated proapoptotic protein Bax, Caspase-9, and cleaved Caspase-3, and upregulated antiapoptotic protein Bcl-2. The results showed that the protective effect of SCC might be related to the mitochondria-dependent apoptotic pathway. Our results may provide a new insight into the development of functional foods for ameliorating learning and memory deficits and neuronal damage.

Footnotes

Acknowledgments

This work was supported by grants from the Project supported by the State Key Program of National Natural Science of China (No. 31330060), the National Natural Science Foundation of China (No. 31371757), and the Program for New Century Excellent Talents in University (NCET-13–0534).

Author Disclosure Statement

No competing financial interests exist.

References

Zhang

, Xu

, Wang

, et al.: Propofol may protect PC12 cells from beta-amyloid(25–35) induced; apoptosis through the gsk-3 beta signaling pathway. Chin Med J, 2013; 126:1884–1889.

Terry

: The pathogenesis of Alzheimer disease: An alternative to the amyloid hypothesis. J Neuropathol Exp Neurol, 1996; 55:1023–1025.

Busciglio

, Lorenzo

, Yeh

, et al.: Beta-amyloid fibrils induce tau phosphorylation and loss of microtubule binding. Neuron, 1995; 14:879–888.

Khan

, Vaibhav

, Javed

, et al.: Attenuation of Abeta-induced neurotoxicity by thymoquinone via inhibition of mitochondrial dysfunction and oxidative stress. Mol Cell Biochem, 2012; 369:55–65.

Kang

, Lemaire

, Unterbeck

, et al.: The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor. Nature, 1987; 325:733–736.

LaFerla

, Green

, Oddo

: Intracellular amyloid-β in Alzheimer's disease. Nat Rev Neurosci, 2007; 8:499–509.

Jarrett

, Berger

, Lansbury

Jr .: The carboxy terminus of the β amyloid protein is critical for the seeding of amyloid formation: Implications for the pathogenesis of Alzheimer's disease. Biochemistry, 1993; 32:4693–4697.

Kong

, Xian

, Ip

, et al.: Protective effects of hydroxysafflor yellow A on beta-amyloid-induced neurotoxicity in PC12 cells. Neurochem Res, 2013; 38:951–960.

Takeda

, Hosokawa

, Higuchi

: Senescence-accelerated mouse (SAM): A novel murine model of accelerated senescence. J Am Geriatr Soc, 1991; 39:911–919.

10.

Takeda

: Senescence-accelerated mouse (SAM) with special references to neurodegeneration models, SAMP8 and SAMP10 mice. Neurochem Res, 2009; 34:639–659.

11.

Canudas

, Gutierrez-Cuesta

, Rodriguez

, et al.: Hyperphosphorylation of microtubule-associated protein tau in senescence-accelerated mouse (SAM). Mech Ageing Dev, 2005; 126:1300–1304.

12.

Del Valle

, Duran-Vilaregut

, Manich

, et al.: Early amyloid accumulation in the hippocampus of SAMP8 mice. J Alzheimers Dis, 2010; 19:1303–1315.

13.

Hosokawa

: A higher oxidative status accelerates senescence and aggravates age-dependent disorders in SAMP strains of mice. Mech Ageing Dev, 2002; 123:1553–1561.

14.

Greene

, Aletta

, Rukenstein

, et al.: PC12 pheochromocytoma cells: Culture, nerve growth factor treatment, and experimental exploitation. Methods Enzymol, 1987; 147:207–216.

15.

, Xue

, Liu

, et al.: The protective effect of eicosapentaenoic acid-enriched phospholipids from sea cucumber Cucumaria frondosa on oxidative stress in PC12 cells and SAMP8 mice. Neurochem Int, 2014; 64:9–17.

16.

Nie

, Wang

: The pharmacological functions and clinical research progress of sea cucumber. Tianjin Pharm, 2002; 14:12–15.

17.

Koynova

, Caffrey

: Phases and phase transitions of the sphingolipids. Biochim Biophys Acta, 1995; 1255:213–236.

18.

, Li

, Xu

, et al.: The anti-tumor activities of cerebrosides derived from sea cucumber Acaudina molpadioides and starfish Asterias amurensis in vitro and in vivo. J Oleo Sci, 2012; 61:321–330.

19.

Gao

, Zhou

, Hu

, et al.: Effects of sea cucumber cerebroside and its long-chain base on lipid and glucose metabolism in obese mice. Zhejiang Da Xue Xue Bao Yi Xue Ban, 2012; 41:60–64.

20.

Margalit

, Shalev

, Pappo

, et al.: Glucocerebroside ameliorates the metabolic syndrome in ob/ob mice. J Pharmacol Exp Ther, 2006; 319:105–110.

21.

, Xue

, Tang

, et al.: Protective effects of cerebrosides from sea cucumber and starfish on the oxidative damage in PC12 cells. J Oleo Sci, 2013; 62:717–727.

22.

, Wang

, Feng

, et al.: Isolation and anti-fatty liver activity of a novel cerebroside from the sea cucumber Acaudina molpadioides . Biosci Biotechnol Biochem, 2011; 75:1466–1471.

23.

, Yang

, Xu

, et al.: Transport and uptake effects of marine complex lipid liposomes in small intestinal epithelial cell models. Food Funct, 2016; 7:1904–1911.

24.

Morris

: Developments of a water-maze procedure for studying spatial learning in the rat. J Neurosci Methods, 1984; 11:47–60.

25.

Barnes

: Memory deficits associated with senescence: A neurophysiological and behavioral study in the rat. J Comp Physiol Psychol, 1979; 93:74–104.

26.

Lim

, Yang

, Chu

, et al.: Ibuprofen suppresses plaque pathology and inflammation in a mouse model for Alzheimer's disease. J Neurosci, 2000; 20:5709–5714.

27.

Huang

, Lu

, Wo

, et al.: Resveratrol protects rats from Aβ-induced neurotoxicity by the reduction of iNOS expression and lipid peroxidation. PLoS One, 2011; 6:e29102.

28.

Yang

, Gao

, Xing

, et al.: Neuroprotective effects of Buyang Huanwu decoction against hydrogen peroxide induced oxidative injury in Schwann cells. J Ethnopharmacol, 2011; 137:1095–1101.

29.

Muthaiyah

, Essa

, Chauhan

, et al.: Protective effects of walnut extract against amyloid β peptide-induced cell death and oxidative stress in PC12 cells. Neurochem Res, 2011; 36:2096–2103.

30.

Gotz

, Ittner

, Schonrock

, et al.: An update on the toxicity of Aβ in Alzheimer's disease. Neuropsychiatr Dis Treat, 2008; 4:1033–1042.

31.

Liu

, Jin

, Sun

, et al.: The neuroprotective effects of tanshinone IIA on β-amyloid-induced toxicity in rat cortical neurons. Neuropharmacology, 2010; 59:7–8.

32.

Sun

, Guo

, Liu

, et al.: Protective effects of bone morphogenetic protein 7 against amyloid-beta induced neurotoxicity in PC12 cells. Neuroscience, 2011; 184:151–163.

33.

Xing

, Dong

, Li

, et al.: Neuroprotective effects of puerarin against beta-amyloid-induced neurotoxicity in PC12 cells via a PI3K-dependent signaling pathway. Brain Res Bull, 2011; 85:212–218.

34.

Dong

, Mao

, Wei

, et al.: Tanshinone IIA protects PC12 cells from β-amyloid_25–35-induced apoptosis via PI3K/Akt signaling pathway. Mol Biol Rep, 2012; 39:6495–6503.

35.

McLean

, Cherny

, Fraser

, et al.: Soluble pool of Aβ amyloid as a determinant of severity of neurodegeneration in Alzheimer's disease. Ann Neurol, 1999; 46:860–866.

36.

Varadarajan

, Yatin

, Aksenova

, Butterfield

: Review: Alzheimer's amyloid β-peptide-associated free radical oxidative stress and neurotoxicity. J Struct Biol, 2000; 130:184–208.

37.

Butterfield

, Drake

, Pocernich

, et al.: Evidence of oxidative damage in Alzheimer's disease brain: Central role for amyloid β-peptide. Trends Mol Med, 2001; 7:548–554.

38.

Antonsson

: Mitochondria and the Bcl-2 family proteins in apoptosis signaling pathways. Mol Cell Biochem, 2004; 256–257:141–155.

39.

Friedlander

: Apoptosis and caspases in neurodegenerative diseases. N Engl J Med, 2003; 348:1365–1375.

40.

Cory

, Adams

: The Bcl2 family: Regulators of the cellular life-or-death switch. Nat Rev Cancer, 2002; 2:647–656.

Cerebrosides from Sea Cucumber Protect Against Oxidative Stress in SAMP8 Mice and PC12 Cells

Abstract

Introduction

Materials and Methods

Reagents

The preparation and analysis of SCC

Animals and diets

Morris water maze test

Barnes maze

Preparation of supernatant of hippocampus and brains

Biochemistry measurement

Preparation of Aβ 25–35 solution

Cell culture and treatment

Determination of cell viability

RNA extraction and real-time PCR assay

Western blot analysis

Statistical analysis

Results

SCC improved learning and memory deficits in SAMP8 mice

Effect of SCC on the Aβ 42 levels in SAMP8 mice

Effect of SCC on oxidative stress in the brain of SAMP8 mice

Effect of Aβ and SCC on PC12 cell viability

SCC inhibited Aβ 25–35-induced cytotoxicity in PC12 cells

Effects of SCC on the mRNA levels of Bcl-2, Bax, Caspase-9, and Caspase-3

Western blot analysis

Discussion

Footnotes

Acknowledgments

Author Disclosure Statement

References

Preparation of Aβ _25–35 solution

Effect of SCC on the Aβ ₄₂ levels in SAMP8 mice

SCC inhibited Aβ _25–35-induced cytotoxicity in PC12 cells