New Insights in Purinergic Therapy: Novel Antagonists for Uridine 5′-Triphosphate-Activated P2Y Receptors from Brazilian Flora

Abstract

P2Y2 and P2Y4 receptors are physiologically activated by uridine 5′-triphosphate (UTP) and are widely expressed in many cell types in humans. P2Y2 plays an important role in inflammation and proliferation of tumor cells, which could be attenuated with the use of antagonists. However, little is known about the physiological functions related to P2Y4, due to the lack of selective ligands for these receptors. This can be solved through the search for novel compounds with antagonistic activity. The aim of this study was to discover new potential antagonist candidates for P2Y2 and P2Y4 receptors from natural products. We applied a calcium measurement methodology to identify new antagonist candidates for these receptors. First, we established optimal conditions for the calcium assay using J774.G8, a murine macrophage cell line, which expresses functional P2Y2 and P2Y4 receptors and then, we performed the screening of plant extracts at a cutoff concentration of 50 μg/mL. ATP and ionomycin, known intracellular calcium inductors, were used to stimulate cells. The calculated EC₅₀ were 11 μM and 103 nM, respectively. These cells also responded to the UTP stimulation with an EC₅₀ of 1.021 μM. Screening assays were performed and a total of 100 extracts from Brazilian plants were tested. Joannesia princeps Vell. (stem) and Peixotoa A. Juss (flower and leaf) extracts stood out due to their ability to inhibit UTP-induced responses without causing cytotoxicity, and presented an IC₅₀ of 32.32, 14.99, and 12.98 μg/mL, respectively. Collectively, our results point to the discovery of potential antagonist candidates from Brazilian flora for UTP-activated receptors.

Introduction

P2YR are G protein-coupled receptors expressed in many cell types in humans. Currently, eight P2Y subtypes have been cloned in mammals: P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, P2Y12, P2Y13, and P2Y14.¹ These subtypes are divided into two groups according to the signaling pathway promoted by G protein. P2Y1, P2Y2, P2Y4, P2Y6, and P2Y11 subtypes are coupled to G_q protein and activate phospholipase Cβ (PLCβ) that forms diacylglycerol (DAG) and inositol 1,4,5,triphosphate (IP₃). IP₃ induces an increase of intracellular calcium through IP₃ receptor activation in the endoplasmic reticulum. Meanwhile, P2Y12, P2Y13, and P2Y14 subtypes are coupled to G_i protein and inhibit adenylyl cyclase, (AC) causing a decrease in cyclic adenosine monophosphate (cAMP) formation.^1,2

P2Y2 and P2Y4 receptors are physiologically activated by uridine 5′-triphosphate (UTP) and promote an increase in intracellular calcium through PLC/IP₃.² They are expressed in many cell types, such as epithelial cells, monocytes, macrophages, neutrophils, cardiomyocytes, and organs, including the brain, heart, kidneys, liver, spleen, and muscle.³ They have effects on chloride secretion in epithelial cells from the airway and eyes, and also induce water secretion in bowel epithelial cells. These functions are important to promote surface lubrification and mucus hydration, which can improve disease treatment, such as dry eye disease and chronic constipation.^2,4

P2Y2R also plays a role in neuroprotection, chemokinesis, and in the proliferation of hepatocytes and tumor cells.^5

–8 P2Y2 is also involved in the production of inflammatory modulators, such as cyclooxygenase-2 (COX-2) and prostaglandin E2 (PGE₂), and neutrophil accumulation in lungs and liver during inflammation.^9

–13 Thus, P2Y2 antagonists might alleviate inflammation signals.

P2Y4R participates in Na⁺, K⁺, and Cl⁻ regulation processes, but its functions are not completely characterized, as it is expressed in the same tissues and cell types as P2Y2R, and activated by the same physiological ligand, UTP.^14

–17 Therefore, the lack of selective ligands impairs the discovery of new functions associated with these receptors. However, this problem can be solved by the search for novel compounds with antagonistic activity on P2Y2 and P2Y4 receptors.

Natural products are an important source for the discovery of new molecules with antagonistic activity. They offer the advantage of millenary use in the treatment of several diseases, such as inflammation, parasitoses, pain, and recently, cancer, constituting the basis of traditional oriental medicines.^18
–20 Among the 13 drugs approved for global marketing between 2005 and 2007, five were classified as natural products, whereas the others were semisynthetic or derived, which reinforces natural product importance for clinical use.²¹ In addition, the literature reports that some biological species express compounds with antagonistic activity on P2 receptors, such as emodin from Rheum officinale Bail and amentoflavone from Rheedia longifolia Planch & Triana on P2X7R.^22,23 However, due to the large number of samples for testing, implementation of high-throughput screening (HTS) methodologies is necessary to meet this demand, since they have the advantage of evaluating many compounds in a short period of time.^24,25

In this scenario, intracellular calcium measurement techniques emerge as a tool for the screening of new antagonists, since P2Y2 and P2Y4 receptors are coupled to the calcium signaling pathway.²⁶ Kaulich et al. tested a series of 40 flavonoids using calcium assays to discover novel lead antagonists for P2Y2R. They found that certain flavonoids could inhibit P2Y2R and suggest using their structures to develop new compounds with antagonistic activity.²⁷ Recently, Ito et al. applied an intracellular calcium measurement protocol through a HTS campaign to search for novel antagonists for the P2Y6 receptor and found one compound, TIM-38, with potential activity.²⁸

Thus, the aim of this study was to improve a protocol based on intracellular calcium measurements and apply it in the discovery of natural product compounds with antagonist activity on P2Y2 and P2Y4 receptors.

Materials and Methods

Reagents

Chemicals were purchased from Sigma Chemical Co. (St. Louis, MO, USA), including ATP, UTP, ADP, UDP, αβ-meATP, Suramin, DMEM, and RPMI culture mediums, NaCl, KCl, Na₂HPO₄, KH₂PO₄, MgCl₂, CaCl₂, Glucose, DMSO, MTT ((3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazolium, Probenecid, and Ionomycin. Fetal bovine serum was obtained from Cultilab (Campinas, SP, Brazil) and Fluo-4 AM was obtained from Life Technologies (CA, USA).

Extracts

Extracts used in this study were collected from Brazilian biomes (Amazon, Cerrado, Caatinga, Atlantic Forest, Pantanal, and Pampas), obtained through methanol extraction, and deposited at Bioprospecting Platform from the Chemistry of Natural Products Laboratory.

The stems from Joannesia princeps Vell. (blind code: JA2) were collected in the Atlantic biome, in Linhares, in the state of Espírito Santo, Brazil. The stems were crushed and mixed with a 1:1 mixture of CH₂Cl₂-CH₃OH to obtain the extract deposited at voucher number EX294. Peixotoa A. Juss were collected in the Cerrado biome, in Tiradentes, located in the state of Minas Gerais, Brazil. Peixotoa A. Juss flower (blind code: RA3) and leaf (blind code: RB3) extracts are deposited at voucher numbers EX9355 and EX9356, respectively. A botanical specimen was deposited at the Federal University of São João del Rei Herbarium under code HUFSJ1103. The flowers and leaves were crushed and homogenized with ethanol to obtain the crude extracts. For the experiments, they were resuspended in a 1 mL Dulbecco's PBS solution containing 0.5% DMSO. The extracts were tested using a single-blind method, that is, the professional responsible for performing screening experiments did not know the name of the biological species that originated the samples.²⁹ Because of this, they were identified by a code.

Cell culture

J774.G8 is a murine macrophage cell line that expresses P2 receptors. The J774.G8 cell line was kindly provided by Dr. Vinícius Cotta from the Laboratory on Thymus Research at the Oswaldo Cruz Institute, Rio de Janeiro, Brazil. The cells were routinely maintained in culture with Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, at 37°C in a 5% CO₂ atmosphere. The medium was changed every 3 days and the cells were adjusted to a concentration of 2 × 10⁶ cells per 150-cm² cell culture flask (Corning, NY, USA). Cell viability was analyzed by the Trypan Blue assay. For this, 10 μL of cell sample was diluted 1:100 in 0.04% Trypan Blue solution. After dilution, 10 μL of the sample were added into the Neubauer chamber and observed under optical microscope Nikon Eclipse TE 2000-S (Nikon, Tokyo, Japan) to count viable cells. Calcium assays were conducted only when the viability range was above 90%.

Calcium assays

J774.G8 cells were plated at a concentration of 2 × 10⁵ cells/well in a 96-well black-wall, clear-bottom plate (Corning, NY, USA), and maintained in culture with DMEM supplemented with 10% fetal bovine serum, at 37°C in a 5% CO₂ atmosphere for 24 h. Subsequently, the medium was replaced by 100 μL of Dulbecco's PBS (DPBS) (136 mM NaCl, 2.68 mM KCl, 8 mM Na₂HPO₄, 1.46 mM KH₂PO₄, 0.5 mM MgCl₂, 0.9 mM CaCl₂, 5.55 mM Glucose, and 2.5 mM Probenecid–pH 7.4) containing Fluo-4 AM [2 μM] and the cells were incubated for 60 min at 37°C in a 5% CO₂ atmosphere. Extracellular Fluo-4AM was then removed by three consecutive washes with 200 μL DPBS and the cells received a final volume of 150 μL DPBS. Subsequently, cells were treated with extracts [50 μg/mL] and PPADS [300 μM], Suramin [300 μM], and Reactive Blue-2 (RB-2) [20 μM] antagonists for 30 min. Finally, the assay plate was placed into the FlexStation III equipment (Molecular Devices, CA, USA), which performed the agonist addition to each well, diluted in 50 μL DPBS. The mobilization of intracellular calcium was measured in real-time prior, during, and after the addition of the agonists at λ (excitation) of 485 nm and λ (emission) of 525 nm. Total measurement runtime was 90 sec and agonists were added at the 20-sec mark. Readings were carried out every 1.52 sec and a total of 60 readings were obtained for each well. The ΔFU, that is, the difference between the fluorescence peak associated with the maximum concentration of intracellular calcium ([Ca²⁺]_i) and basal fluorescence of calcium was determined according to the protocol of Hansen and Bräuner-Osborne (2009).²⁶ The wells whose signal did not return to approximately 30% of the baseline after stimulation were discarded as quality control.

Cell loading observation under a fluorescence microscope

J774.G8 cells were loaded with Fluo-4AM as described previously and observed under a Nikon Eclipse TE 2000-S fluorescence microscope (Nikon, Tokyo, Japan), using 20 × objectives. Fluo-4 was excited using a mercury lamp and a set of filters: exciter: 480/30 and barrier: 535/40. Ionomycin was added after 40 sec of observation and pictures were captured with an Infinity 3 Microscope Digital Camera (Lumenera, Ontario, Canada).

RNA extraction, Reverse transcriptase polymerase chain reaction, and electrophoresis

mRNA was isolated from the J774.G8 cell line from a concentration of 5 × 10⁶ cells using TRIzol (Life Technologies, CA, USA), according to the manufacturer's specifications. Then, 20 μL of mRNA was reverse transcribed at 42°C for 1 h and at 70°C for 5 min using 1 μL of reverse transcriptase enzyme. Next, 4 μL of cDNA samples were used with 4 μL of a primer sequence specific for each P2 receptor subtype, as shown in Table 1. These samples were used for the RT-PCR analysis in a 50 μL reaction volume containing 5 μL of Buffer 10 × , 4 μL Mg²⁺, 0.4 μL dNTP, 0.2 μL Taq polymerase, and 4 μL of water. Cycling conditions were: 94°C for 45 sec, followed by 35 cycles at 54°C (P2Y11), 55°C (P2Y6), 57°C (P2X1), 58°C (P2X3, P2Y14, and P2Y13), 60°C (P2Y2, P2X2, P2X5, P2X6, P2Y12, P2Y1, P2Y4, and GAPDH) or 65°C (P2X4 and P2X7) for 1 min and 72°C for 45 sec. PCR products were submitted to electrophoresis on a 2% agarose gel and visualized by ethidium bromide staining under a transilluminator.

Table 1.

Primer Sequence of P2 Receptors Used in RNA Extraction, Reverse Transcriptase Polymerase Chain Reaction, and Electrophoresis Experiments

P2 receptor subtype	Primer sequence
P2X1	Forward: ATGTCCTCGGCATATTTGAA
P2X1	Reverse: ATTGTGCAGAGAACCCAGAA
P2X2	Forward: TTCATCGTGCAGAAAAGCTACC
P2X2	Reverse: TGGATGCTGTTCTTGATGAGGA
P2X3	Forward: CTTCACCTATGAGACCACCAAG
P2X3	Reverse: CGGTATTTCTCCTCACTCTCTG
P2X4	Forward: TGCTCATCCGCAGCCGCAAAGT
P2X4	Reverse: AGTGGTCGCATCTGGAATCTCGG
P2X5	Forward: ACTTCCCTGCAGAGTGCTGT
P2X5	Reverse: GGCAGCTTTATCAAGGTCACA
P2X6	Forward: TATGTGATGACCAGGAACTG
P2X6	Reverse: CTCCAGATCTCACAGGTCCT
P2X7	Forward: GGCAGTTCAGGGAGGAATCATGG
P2X7	Reverse: AAGCGCCAGGTGGCATAGCTC
P2Y1	Forward: CTGTTGAGACTTGCTAGACCTC
P2Y1	Reverse: ATGTTCAATTTGGCTCTGGC
P2Y2	Forward: GTCGCTTCAACGAGGACTTC
P2Y2	Reverse: GCCAGGAAGTAGAGCACAGG
P2Y4	Forward: TGGCATTGTCAGACACCTTG
P2Y4	Reverse: AAGCAGACAGCAAAGACAGTC
P2Y6	Forward: CGCTTCCTCTTCTATGCCAA
P2Y6	Reverse: GTAGGCTGTCTTGGTGATGTG
P2Y11	Forward: CAGCGTCATCTTCATCACC
P2Y11	Reverse: GCTATACGCTCTGTAGGC
P2Y12	Forward: CTGCCAAGTCATTTTCTGGA
P2Y12	Reverse: AGCATGCTCATCAAGGAATTT
P2Y13	Forward: AGGGGTTTTGTGTGCACTTT
P2Y13	Reverse: CTGACTGCTGTGGTGCTCAT
P2Y14	Forward: GCTGTCCCCAACATCATTCT
P2Y14	Reverse: GTTTTGGGGTAACTCGCAGA
GAPDH	Forward: ATCACCATCTTCCAGGAGCG
GAPDH	Reverse: CCTGCTTCACCACCTTCTTG

Animals

The experiments with animals were approved by Oswaldo Cruz Institute Ethics Committee on the use of Animals, under identification code L-037/2017, approved on November 24, 2017, and followed the ethical principles in animal experimentation from the Brazilian College of Animal Experimentation. Healthy male C57BL/6 mice weighing between 25 and 30 g were obtained from the Oswaldo Cruz Central Bioterium. The animals were housed under 12-h light/12-h dark cycle conditions with free access to food and water.

Peritoneal macrophage isolation

Animals were euthanized by CO₂ asphyxiation. Subsequently, 5 mL of RPMI medium was injected into the peritoneal cavity. Peritoneal cells were collected and macrophages were isolated by centrifugation at 378 g for 10 min. Cell viability was analyzed by the Trypan Blue assay. Peritoneal macrophages were plated at a concentration of 4 × 10⁵ cells/well in a 96-well black-wall, clear-bottom plate and maintained in RPMI culture supplemented with 10% fetal bovine serum, at 37°C in a 5% CO₂ atmosphere for 24 h. Calcium assays were carried out using the same conditions described previously.

Cell viability measurement

J774.G8 cells were plated at a concentration of 2 × 10⁵ cells/well in a 96-well plate (Corning, NY, USA), and maintained in culture with DMEM supplemented with 10% fetal bovine serum, at 37°C in a 5% CO₂ atmosphere for 24 h. Next, cells were treated with extracts [50 μg/mL] and the antagonists, PPADS [300 μM] and RB-2 [20 μM] for 1, 6, or 24 h. Cells treated with Triton-X (0.1%) were considered negative viability controls, whereas positive controls were obtained with cells that did not receive any treatment. Subsequently, the medium was replaced by 180 μL of DMEM without phenol red and each well received 20 μL of MTT solution [100 μg/well]. The plate was then incubated for 3 h at 37°C in a 5% CO₂ atmosphere and then centrifuged at 312 g for 1 min. Finally, supernatants were collected and formazan crystals were dissolved in 100 μL DMSO.³⁰ The absorbance of the wells was measured on a FlexStation III equipment, using λ: 570 nm.

Data analyses

Each sample was measured in triplicate and all experiments were performed on at least 3 independent days. All data are presented as mean ± SDM, whereas the curves are presented as mean ± SEM. To test if samples follow a Gaussian distribution, the D' Agostino and Pearson normality test was used. If data followed a Gaussian distribution, an appropriate parametric test was applied, if not, an appropriate nonparametric test was used. The applied tests were specified in figure legends. P values of .05 or less were considered significant. Graphs and statistical analyses were performed using the GraphPad Prism version 7 software (GraphPad Software, San Diego, CA, USA). The quality of the calcium assay was assessed by calculating the z′-factor. The z′-factor is a valuable tool to evaluate the robustness and suitability of HTS assays. z′-factor values above 0.5 consider the assay as excellent and equal to 1, an ideal assay, whereas values below 0.5 consider that the assay should be reformulated.³¹ This parameter was calculated using the following equation: \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document} \begin{align*}{ \rm { Z^ \prime = 1 - } } { \frac { \left( { { \rm { 3SD \ of \ the \ positive \ control + 3SD \ of \ the \ negative \ control } } } \right) } { \left( { { \rm { mean \ of \ the \ positive \ control - \ mean \ of \ the \ negative \ control } } } \right) } } \end{align*} \end{document}

where cells stimulated with UTP at [10 μM] were considered positive control (concentration used in screening experiments) and cells stimulated with DPBS only were considered negative control.

Results

Establishment of a protocol for the detection of intracellular calcium mobilization

Our primary aim was to discover new antagonists for P2Y receptors activated by UTP, so a protocol for the detection of intracellular calcium mobilization was first established. Fluo-4 is a calcium indicator widely applied in HTS assays of metabotropic receptors that induce increase in intracellular calcium.³² The literature states a range of Fluo-4 used in calcium assays, between 2 and 4 μM.^33

–36 To use low doses of the dye, the first step was to optimize Fluo-4 concentration in our assay conditions, making it more economical for HTS. In this context, we investigated concentrations ranging from 1 to 8 μM, using ATP [100 μM] to stimulate the cells due to its activity as a main physiological P2 receptor agonist, widely expressed in J774.G8 cells. As shown in Figure 1A, no significant difference in the quantification of calcium responses for concentrations between 1 to 4 μM was observed. Concentrations of 6 and 8 μM have shown significant difference only compared with 1 μM.

FIG. 1.

Measurement of [Ca²⁺]_i after ATP and ionomycin stimulation in cells stained with Fluo-4. J774.G8 cells stained with different Fluo-4 concentrations were stimulated with [100 μM] ATP (A) and ionomycin [100 nM] (B) and were monitored for 90 sec on a FlexStation III equipment. Data are presented as Mean ± SDM of four independent experiments performed in triplicate. Data analyses were made using one-way ANOVA and Holm–Sidak post-test; P < .05. Asterisks indicates significant differences in relation to the 1 μM concentration. (ns) means not significant. Observation of J774.G8 cells in brightfield and fluorescence after loading with Fluo-4 and stimulated with ionomycin during 1 minute (objective 20 ×) (C). Representative images from three independent experiments performed in triplicate. ATP (D) and ionomycin (E) curves were obtained from J774.G8 cells stained with 2 μM of Fluo-4. Data are presented as Mean ± SEM of three independent experiments performed in triplicate.

A similar result was obtained in cell stimulation with ionomycin, a calcium ionophore, which promotes a massive transport of this ion from the extracellular to intracellular medium. All concentrations evaluated have a similar profile for calcium response quantification (Fig. 1B). Thus, the selected Fluo-4 concentration to use in our experiments was 2 μM, as calcium responses in this concentration did not differ from higher concentrations, and is cited in the literature.

As we could observe in Figure 1C, cells loaded with Fluo-4 at 2 μM shown a homogenous dye scattering in their cytosol and, after stimulus with ionomycin, become more fluorescent.

Next, two assays were performed to verify Fluo-4 sensibility at the established concentration (2 μM). Cells were stimulated with increasing ATP and ionomycin concentrations, and Fluo-4 fluorescence increased in a concentration-dependent manner, as shown in Figure 1D and E. EC₅₀ for ATP and ionomycin were 11 μM and 103 nM, respectively.

Therefore, in this primary step, Fluo-4 concentrations at 2 μM were ideal for our assay, since cells presented homogenous dye loading and sensibility in responding to calcium stimuli in increasing concentrations.

Quality assessment of calcium responses induced by P2 receptors

To characterize the quality of calcium responses induced by P2 receptors through ATP stimulation acquired on the FlexStation III equipment, we analyzed original records. Original records indicated that DPBS addition alone did not cause signal variations, as expected (Fig. 2A). ATP stimulus, on the other hand, increased intracellular calcium levels, as seen by the fluorescence peak shown in Figure 2B. This effect was reversed with the addition of EGTA, a calcium chelating agent, indicating that the fluorescence is associated with calcium, as shown in Figure 2C. Cells stimulated with ionomycin also increased their fluorescence (Fig. 2D). No decline in intracellular levels during the selected time frame for this experiment, that is, 90 sec, was observed. Therefore, these experiments validated our calcium measurement protocol using the FlexStation III equipment.

FIG. 2.

Original records of calcium signals obtained on a FlexStation III. Original records of calcium signals obtained on a FlexStation III equipment after addition of 50 μL of DPBS (A), ATP [100 μM] (B, C) at 25 sec, or Ionomycin [100 μM] (D) at 20 sec and EGTA [20 mM] (54 sec) (C) (indicated by the arrows) in J774.G8 cells stained with 2 μM of Fluo-4. Representative images from three independent experiments performed in triplicate. Color images are available online.

Characterization of P2 receptors in J774.G8 cells

Before beginning the screening experiments, we attempted to identify which P2 receptors (P2R) were expressed in this cell line to guide our assay, avoiding bias, since some P2R subtypes were activated by the same agonists. First, the RT-PCR technique was performed, aiming to verify which P2R are expressed in J774.G8 cells. As observed in Figure 3A and B, cDNA fragments corresponded to P2X1 (775 bp), P2X7 (186 bp), P2Y1 (683 bp), P2Y2 (850 bp), P2Y4 (544 bp), P2Y6 (480 bp), P2Y11 (274 bp), and P2Y12 (360 bp).

FIG. 3.

P2 receptors subtypes expressed in J774.G8 cell line. In (A) and (B), the columns correspond to cDNA fragments of subtypes described above them. MW std means molecular weight standard. Samples were run on 2% agarose gels and stained with ethidium bromide. Representative images from two experiments. In (C), increase of intracellular calcium induced by agonists of P2 receptors. Cells stained with 2 μM of Fluo-4 were stimulated with ATP [100 μM], UTP [10 μM], ADP [10 μM], UDP [100 μM], αβmeATP [300 μM], and BzATP [100 μM], and were monitored for 90 sec. Data are presented as Mean ± SDM of three independent experiments performed in triplicate. Data analyses were made using one-way ANOVA and Holm–Sidak post-test; P < .05. Asterisks indicates significant differences in relation to the respective group without Ca²⁺. (ns) means not significant. The receptors named inside bars correspond to subtypes activated by agonist used. Color images are available online.

All these receptors, except P2Y12R, are associated with intracellular calcium increase signaling pathways through opening of a nonselective cation ion channel (P2X) or PLCβ/IP₃ system activation (P2Y). Thus, we further investigated the response of P2R subtypes expressed in J774.G8 cells using selective agonists. As shown in Figure 3C, this cell line expresses P2X and P2Y receptors, such as P2Y2 and P2Y4, activated by UTP, P2Y1, and P2Y6, which were activated by ADP and UDP, respectively. Cells also express P2X7 that promoted calcium response after stimulation with BzATP (P2X7 selective agonist). ATP and αβmeATP, nonselective agonists, were used for observing general P2 and P2X receptor calcium responses, respectively. These results confirm the expression of P2 receptors observed in RT-PCR, including UTP-activated P2Y receptors, that is, P2Y2 and P2Y4, which are our target subtypes. Interestingly, we observed that all agonists, with the exception of ADP, presented lower responses without extracellular calcium, possibly indicating the participation of store-operated calcium channels. In the case of ATP and αβmeATP, this response could be regarding ionotropic channels.

Characterization of UTP-induced calcium responses

Since our cells express UTP-activated receptors, that is, P2Y2 and P2Y4, they were stimulated with increasing concentrations of this agonist, to observe UTP response profile (Fig. 4A). The determined EC₅₀ was of 1.021 μM. Next, we obtained the P2Y2 and P2Y4 antagonist profiles by performing an antagonism assay using Reactive-Blue 2 (RB2), Suramin, and PPADS.² As shown in Figure 4B, RB2, Suramin, and PPADS partly inhibited UTP-induced intracellular calcium mobilization. To observe the antagonistic profile of these inhibitors of P2Y2 and P2Y4 receptors, we pretreated cells with different Suramin, RB2, and PPADS concentrations and obtained IC₅₀ of 173.3, 22.98, and 74.24 μM, respectively (Fig. 4C–E). We also observed that Suramin and RB2 partially block intracellular UTP-induced calcium mobilization.

FIG. 4.

Calcium mobilization induced by UTP can be partially inhibited by P2Y2 and P2Y4 nonselective antagonists. UTP concentration–response curve was obtained from J774.G8 cells stained with 2 μM of Fluo-4. Data are presented as Mean ± SEM of three independent experiments performed in triplicate (A). J774.G8 cells stained with 2 μM of Fluo-4 were pretreated with Suramin [300 μM], RB2 [20 μM], and PPADS [300 μM] for 30 min. Cells were then stimulated with UTP [10 μM] and monitored for 90 sec. Data are presented as Mean ± SDM of three independent experiments performed in triplicate. Data analyses were made using one-way ANOVA and Holm–Sidak post-test; P < .05. Asterisks indicates significant differences in relation to UTP (B). J774.G8 cells were pretreated with increasing concentrations of antagonists Suramin (C), RB2 (D), and PPADS (E) during 30 min, then were stimulated with UTP [10 μM]. Data are presented as Mean ± SEM of four independent experiments performed in triplicate.

After characterization of UTP calcium responses and P2Y2 and P2Y4 antagonist inhibition profile, we calculated the z′-factor of our assay. The z′-factor is a statistical parameter used to measure assay robustness. After applying the mathematical z′-factor equation, we obtained a value of 0.645. Therefore, the z′-factor of our assay, which is above 0.5, is within the optimal range (z′ ≥ 0.5). Taken together, these evaluated characteristics suggest that our protocol was appropriate for use.

Mini HTS application

Finally, we performed the screening of 100 natural product extracts, summarized in Table 2. Nine extracts partially inhibited calcium mobilization induced by UTP, namely: JA2 (Joannesia princeps Vell. - stem), JA5, JB2, JB7, P2B6, P5C1, P5F3, RA3 (Peixotoa A. Juss - flower), and RB3 (Peixotoa A. Juss - leaf). The same experiment was repeated using peritoneal macrophages from mice, a primary cell that expresses P2R (Fig. 5A). When using these cells, we observed that only J. princeps Vell. extract was able to significantly inhibit UTP-calcium responses. The mean of J. princeps Vell in peritoneal macrophages was less than in J774.G8 cells (Table 2) (21.07 ± 18.24 compared with 52.97 ± 29.48), which could reflect differences between cell lines and primary cells. Peixotoa A. Juss extracts (RA3 and RB3) were not been tested in peritoneal macrophages due to sample scarcity. Subsequently, cells were treated with increasing concentrations of J. princeps Vell. and Peixotoa A. Juss (flower and leaf) extracts, and the obtained IC₅₀ were equal to 32.32, 14.99, and 12.98 μg/mL, respectively (Fig. 5B–D). Aiming to verify if calcium response inhibition was the result of possible extract cytotoxicity, viability tests were performed using the MTT technique. As observed in Figure 5E, only leaf extract caused a slight decrease in cell viability, but although nonsignificant. Taken together, we characterized J. princeps Vell. and Peixotoa A. Juss extracts as potential antagonist candidates for UTP-stimulated receptors.

FIG. 5.

J. princeps and Peixotoa A. Juss extracts partially inhibited calcium responses induced by UTP. Peritoneal macrophages stained with 2 μM of Fluo-4 were pretreated with RB2 [20 μM], Suramin [300 μM], PPADS [300 μM], and extracts [50 μg/mL] during 30 min. Then, cells were stimulated with UTP [10 μM] and monitored for 90 sec. Data are presented as Mean ± SDM of three independent experiments performed in triplicate. Data analyses were made using one-way ANOVA and Holm-Sidak post-test; P < .05. (*) indicates significant differences in relation to UTP (A). J774.G8 cells were pretreated with increasing concentrations of candidate extracts: J. princeps (B), Peixotoa A. Juss (flower) (C) and Peixotoa A. Juss (leaf) (D) during 30 min, then were stimulated with UTP [10 μM]. Data are presented as Mean ± SEM of four (B) and three (C, D) independent experiments performed in triplicate. J774.G8 cells were pretreated with RB2 [20 μM], PPADS [300 μM], and J. princeps and Peixotoa A. Juss extracts [50 μg/mL] in the presence or absence of UTP [10 μM] during 1 h. Then, cell viability was assessed by MTT technique (E). Data are presented as Mean ± SDM of three independent experiments performed in triplicate. Data analyses were made using one-way ANOVA and Holm-Sidak post-test; P < .05. Asterisks indicates significant differences in relation to UTP. ns, not significant.

Table 2.

Mini High-Throughput Screening Application with Extracts from Brazilian Plants: Inhibition Effect on Calcium Mobilization Induced by UTP Through P2Y2 and P2Y4 Receptors

Sample	ΔFU mean ± SDM	ΔFU of control (UTP) ± SDM	Sample	ΔFU mean ± SDM	ΔFU of control (UTP) ± SDM
A2	84.00 ± 39.67	136.3 ± 22.41	F6	140.1 ± 15.32	131.1 ± 17.41
A3	96.11 ± 34.83	136.3 ± 22.41	F9	131.4 ± 19.00	131.1 ± 17.41
A4	93.64 ± 23.63	136.3 ± 22.41	G4	125.9 ± 22.93	131.1 ± 17.41
A5	121.50 ± 26.98	136.3 ± 22.41	G6	116.6 ± 34.57	131.1 ± 17.41
A6	114.70 ± 25.68	136.3 ± 22.41	H2	99.88 ± 26.96	131.1 ± 17.41
A7	118.20 ± 25.61	136.3 ± 22.41	H7	120.60 ± 26.54	131.1 ± 17.41
A8	114.60 ± 28.77	136.3 ± 22.41	H8	128.60 ± 30.45	131.1 ± 17.41
A9	103.80 ± 19.04	136.3 ± 22.41	H9	122.50 ± 24.30	131.1 ± 17.41
A10	102.00 ± 37.68	136.3 ± 22.41	H10	121.00 ± 22.07	131.1 ± 17.41
A11	90.91 ± 23.84	136.3 ± 22.41	H11	118.80 ± 25.45	131.1 ± 17.41
B2	103.20 ± 31.93	136.3 ± 22.41	JA2^a	52.97 ± 29.48 ^***	117.2 ± 21.81
B3	96.54 ± 30.47	136.3 ± 22.41	JA4	87.34 ± 17.22	117.2 ± 21.81
B4	98.59 ± 32.42	136.3 ± 22.41	JA5	69.73 ± 12.95 ^**	117.2 ± 21.81
B5	104.40 ± 31.61	136.3 ± 22.41	JA8	88.61 ± 17.55	117.2 ± 21.81
B6	112.00 ± 32.86	136.3 ± 22.41	JA9	101.4 ± 16.28	117.2 ± 21.81
B7	101.30 ± 42.64	136.3 ± 22.41	JA10	106.8 ± 20.23	117.2 ± 21.81
B8	101.10 ± 45.63	136.3 ± 22.41	JA11	113.6 ± 21.24	117.2 ± 21.81
B9	79.80 ± 32.15	136.3 ± 22.41	JB2	68.70 ± 25.67 ^**	117.2 ± 21.81
B10	83.52 ± 38.49	136.3 ± 22.41	JB3	103.3 ± 22.15	117.2 ± 21.81
B11	81.18 ± 39.85	136.3 ± 22.41	JB4	83.31 ± 15.39	117.2 ± 21.81
C2	97.98 ± 28.62	136.3 ± 22.41	JB5	95.08 ± 23.12	117.2 ± 21.81
C3	86.42 ± 33.81	136.3 ± 22.41	JB7	72.98 ± 27.89 ^*	117.2 ± 21.81
C4	84.02 ± 32.69	136.3 ± 22.41	JB9	94.51 ± 15.21	117.2 ± 21.81
C5	89.70 ± 32.30	136.3 ± 22.41	JC4	80.44 ± 21.36	117.2 ± 21.81
C7	128.40 ± 35.47	136.3 ± 22.41	JC7	104.4 ± 23.61	117.2 ± 21.81
C8	114.90 ± 34.39	136.3 ± 22.41	P2B6	88.47 ± 7.95 ^**	133.0 ± 24.81
C9	123.10 ± 23.62	136.3 ± 22.41	P5C1	90.14 ± 19.28 ^*	133.0 ± 24.81
C10	126.30 ± 16.57	136.3 ± 22.41	P5F3	94.78 ± 26.75 ^*	133.0 ± 24.81
C11	129.20 ± 16.79	136.3 ± 22.41	RA2	47.18 ± 72.71	99.71 ± 62.55
D2	130.90 ± 16.78	136.3 ± 22.41	RA3^b	11.15 ± 10.11 ^**	99.71 ± 62.55
D3	121.60 ± 21.87	136.3 ± 22.41	RA4	126.00 ± 41.12	99.71 ± 62.55
D4	128.00 ± 20.63	136.3 ± 22.41	RA5	121.10 ± 47.06	99.71 ± 62.55
D5	119.90 ± 26.90	136.3 ± 22.41	RA6	92.82 ± 38.43	99.71 ± 62.55
D6	101.00 ± 36.11	136.3 ± 22.41	RA7	64.31 ± 19.61	99.71 ± 62.55
D7	98.50 ± 21.90	136.3 ± 22.41	RA8	101.40 ± 34.38	99.71 ± 62.55
D8	111.70 ± 28.66	136.3 ± 22.41	RA9	105.90 ± 26.27	99.71 ± 62.55
D9	123.80 ± 11.76	136.3 ± 22.41	RA10	100.80 ± 39.60	99.71 ± 62.55
D10	109.60 ± 21.55	136.3 ± 22.41	RA11	117.30 ± 30.47	99.71 ± 62.55
D11	127.00 ± 36.18	136.3 ± 22.41	RB2	51.19 ± 27.55	99.71 ± 62.55
E2	117.40 ± 20.61	142.0 ± 18.04	RB3^c	19.96 ± 31.03 ^**	99.71 ± 62.55
E3	103.20 ± 18.34	142.0 ± 18.04	RB4	106.90 ± 32.81	99.71 ± 62.55
E4	102.30 ± 47.03	142.0 ± 18.04	RB5	85.30 ± 15.44	99.71 ± 62.55
E5	100.10 ± 36.62	142.0 ± 18.04	RB6	110.50 ± 37.21	99.71 ± 62.55
E6	95.00 ± 36.32	142.0 ± 18.04	RB7	110.80 ± 36.12	99.71 ± 62.55
E7	91.00 ± 41.39	142.0 ± 18.04	RB8	97.02 ± 29.97	99.71 ± 62.55
E8	115.30 ± 41.97	142.0 ± 18.04	RB9	114.70 ± 37.33	99.71 ± 62.55
E9	108.00 ± 45.52	142.0 ± 18.04	RB10	91.47 ± 35.80	99.71 ± 62.55
E10	129.80 ± 45.93	142.0 ± 18.04	RB11	99.84 ± 51.68	99.71 ± 62.55
E11	91.27 ± 30.64	142.0 ± 18.04	RC2	60.97 ± 23.75	99.71 ± 62.55
F2	132.1 ± 23.55	131.1 ± 17.41	RC3	59.46 ± 21.70	99.71 ± 62.55

J774.G8 cells labeled with 2 μM Fluo-4 were pretreated with extracts [50 μg/mL] for 30 min. Then, cells were stimulated with UTP [10 μM] and were monitored for 90 sec. Mean ± SDM of three independent experiments. Data analyses were made using one-way ANOVA and Tukey post-test; P < .05.

Asterisks Indicates significant differences in relation to UTP.

Joannesia princeps Vell. stem extract.

Peixotoa A. Juss. flower extract.

Peixotoa A. Juss. leaf extract.

Discussion

P2Y2 and P2Y4 are purinergic receptors physiologically activated by UTP, which promote an increase of intracellular calcium through PLCβ/IP₃ when activated.² They are expressed in many cell types, such as epithelial cells and leukocytes, and even in organs, such as the brain, heart, kidneys, liver, spleen, and muscle,³ where they play important roles. Likewise, these P2Y receptors are associated with certain diseases, such as cystic fibrosis, dry eye disease, Alzheimer, and cancer.^2,4,5 Thus, pharmaceutical companies have been developing drugs that act on these P2Y receptors, especially P2Y2, to treat these related diseases.^37
–39 However, the lack of selective ligands that act on P2Y2 and P2Y4 receptors compromises the discovery of new functions associated with these receptors, which can be solved by the search for new antagonist compounds.¹⁷ Therefore, the aim of this study was to improve a methodology for the detection of intracellular calcium mobilization to discover new molecules with antagonistic activity on UTP-activated P2Y receptors. For this reason, we established a protocol to evaluate intracellular calcium mobilization.

First, the calcium indicator concentration was optimized. Fluo-4 is widely applied in HTS assays of metabotropic receptors that induce an increase of intracellular calcium.³² We chose 2 μM as the final concentration, due to the apparent homogenous cellular loading in cells and the fact that no significant differences were observed compared with other concentrations. In addition, it is important to use the lowest concentration that results in an adequate signal, thereby reducing reagent consumption and expenses during screening.³¹ Gee et al. also demonstrated that the use of the lowest concentrations of calcium indicators can reduce the buffer effect on calcium, as well as minimize the levels of toxic products, such as formaldehyde and acetic acid, which are produced through the hydrolysis of acetoxymethyl esters.⁴⁰ Furthermore, using this concentration, we demonstrated that cells were able to react to different stimuli, which increase intracellular calcium levels in a concentration-dependent manner, such as P2R agonists, including ATP and UTP. The EC₅₀ found for ATP (11 μM) is slightly higher than that reported by Li et al. when they performed calcium experiments using the FlexStation III (1.1 μM and 58 nM for HEK293 and CHO-K1 cells, respectively).³² This could be a sum of responses from various ATP-activated P2R, such as P2Y2, P2Y11, P2X1, P2X2, and P2X7 subtypes. The latter could have displaced the EC₅₀, since its activation occurs at concentrations higher than 100 μM. Meanwhile, the EC₅₀ found for ionomycin (103 nM) was lower than that reported by Valentin et al. (2011), that is, 1.5 μM when they performed a calcium assay using a microplate reader with human endothelial cells from the umbilical vein (HUVEC).⁴¹

We also observed some expected calcium signal characteristics, such as the uniformity of the basal signal, a signal peak after the ATP stimulus, indicating an increasing of [Ca²⁺]_i and its return to basal levels after a response time, which, in calcium events, usually occurs in seconds. In addition, a decrease of calcium responses in the presence of EGTA, a calcium chelating agent, was also observed. A similar response profile was obtained through calcium imaging (data not shown). Ionomycin stimulation also induced an increase in intracellular calcium levels, although with no return to basal levels during the experiment period (90 sec). However, a longer measurement time concerning the ionomycin response could be required to observe this return. However, increasing the well-measurement time could lead to a decrease in the number of samples to assess in an established period of time. Therefore, we opted to maintain the set time at 90 sec.

Moreover, we calculated the z′-factor, a measure for assay robustness, obtaining a value of 0.645, indicating that our protocol was adequate for use. Ito et al. performed an HTS campaign to identify novel P2Y6R antagonists using P2Y6-1321N1 cells, and obtained a z′-factor of 0.80,²⁸ whereas Valentin et al. (2011) used primary cells (HUVEC) to perform a HTS based on calcium measurement and obtained a z′-factor of 0.60.⁴¹ These findings suggest that the use of transfected cells could improve the performance of the assay. However, the use of transfected cells can add costs to the screening. Thus, we suggest that it be applied in a second research moment, to verify hit responses.

J774.G8 murine macrophage cell line expresses P2Y activated by UTP, targets of the screening assay proposed herein. Using the RT-PCR technique, we detected cDNA for P2X1, P2X2, P2X7, P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, and P2Y12 subtypes. These P2R subtypes have been described in macrophages in many studies applying molecular and pharmacological methods.^42

–45 Furthermore, all are associated with intracellular calcium increase signaling pathways through the opening of a nonselective cation ion channel (P2X) or PLCβ/IP₃ (P2Y), with the exception of P2Y12. Therefore, we characterized these subtypes using the following agonists: ATP, a nonselective P2 receptor agonist; UTP, a P2Y2 and P2Y4 receptor agonist; ADP for the P2Y1 receptor; UDP for the P2Y6 receptor; BzATP, a selective P2X7 agonist; and αβmeATP for P2X receptors. These data showed the functional expression of these receptors. Calcium responses decreased in the absence of extracellular calcium, suggesting the participation of store-operated calcium channels and ionotropic receptors in the amplification of intracellular calcium mobilization.⁴⁶

We also obtained the profiles of P2Y2 and P2Y4 agonist and antagonists. J774.G8 cells were stimulated with increasing concentrations of UTP and the EC₅₀ obtained was 1.021 μM. It was similar to that cited by King et al.: 1.1 μM for P2Y2 and 0.20 μM for P2Y4 receptors.⁴⁷ In relation to the antagonists, we observed that Suramin and RB2 partially block intracellular UTP-induced calcium mobilization, whereas PPADS was more effective. King et al. cited that PPADS (100 μM) and RB2 (100 μM) inhibited approximately 30% of P2Y4R, whereas Suramin is ineffective.^47,48 von Kügelgen cited that P2Y2 is blocked by Suramin and RB2, but not by PPADS.⁴⁸ We also hypothesize that the participation of store-operated calcium channels could have influenced their inhibition at some level.

It is worth mentioning that our study is one of the pioneers in the search for novel antagonists using natural products, which present significant diversity concerning number of species and chemical structures, both acquired over millions of years of evolution. Thus, we tested 100 extracts from a natural library at a cutoff concentration established at 50 μg/mL. First, nine extracts demonstrated partial inhibition of UTP-induced calcium responses in J774.G8 cells. After a repetition of this experiment with a primary cell, that is, peritoneal macrophages, which express P2Y2 and P2Y4 receptors,⁴⁴ we found that only J. princeps Vell. extract inhibited this activity. Two other extracts (Peixotoa A. Juss leaf and flower) were not tested in these cells due to sample scarcity. However, aiming at observing the occurrence of this inhibition at higher doses, we treated J774.G8 cells with increasing concentrations of the assessed extracts, and observed that calcium responses were inhibited in a concentration-dependent manner, suggesting potential ability to block UTP-activated P2Y receptors. We then asked if inhibition could be due to cell toxicity. To answer this question, we performed a cell viability assay applying the MTT technique and observed no cytotoxicity.

J. princeps Vell. is a tree approximately 20 m in height belonging to the Euphorbiaceae family. In Brazil, it is found in the Atlantic Rainforest and Caatinga biomes, and can also be found in some regions of Africa and Asia. It is popularly known as “cotieira” in Brazil, with economic value in landscaping, wood extraction, and medicinal applications.^49,50 The only part of the plant used for medicinal purposes is its seed. The seed oil is used as a laxative, whereas its extract displays antihelminthic activity.⁵⁰ Recently, Donato-Trancoso et al. demonstrated that J. princeps Vell. seed oil can improve cutaneous wound closure in an experimental mice model.⁵¹ Sousa et al. cite that the use of J. princeps Vell. in folk medicine is indicated to treat menstrual and digestive disorders, pernicious fever, microbial diseases, syphilis, scrofulous, and swelling.⁵⁰ In relation to chemical profile, Achenbach and Benirschke, in their work using J. princeps Vell. root bark, stem bark, and leaves, demonstrated that this species presents compounds belonging to the following classes: sesquiterpenes, bis-sesquiterpenes, diterpenes, triterpenes, and steroids.⁵² Waibel et al. demonstrated that the methanol extract of the seeds presents secondary metabolites, such as lignans, neolignans, and sesquineolignans.⁵³ Recently, Camero et al. isolated 28 secondary metabolites from J. princeps Vell. leaves for the first time, including gallic acid derivatives, gallotannins, flavonoids, α-ionones, glycosylated monoterpenes, lignan, and other phenolic derivatives.⁵⁴ However, scarce reports in the literature are available concerning J. princeps Vell. stem phytochemistry, which was used in this work.

Peixotoa A. Juss is a bush belonging to the botanical family Malpighiaceae, which, in Brazil is represented by 32 genera and 300 species. The Peixotoa A. Juss genus comprises shrubs, subshrubs, and creepers, which grow on rocky and earthy substrates. It is a native plant presenting widespread distribution in Brazil.⁵⁵ Only one species belonging to this botanical genus presents folk medicinal use reported in the literature. The roots of Peixotoa cordistipula A Juss, popularly known as “joão-da-costa” are used to treat spine disorders in the west-central region of Brazil.⁵⁶ The scarcity of information about this botanical genus is also reflected in the phytochemistry field, since no studies are available in the literature concerning the characterization of its metabolites. Some information about the chemical profile of other Malpighiaceae family members is, however, available. For example, De Frias and collaborators evaluated the chemical profile of leaves of Banisteriopsis anisandra A. Juss., belonging to the Banisteriopsis genus, and found alkaloids, anthraquinones, flavonoids, and tannins.⁵⁷ Andrade et al. analyzed the chemical profile of another Malpighiaceae family member, Byrsonima crassifolia, which belongs to the Byrsonima genus, and found that barks produce the following secondary metabolites: flavonoids, anthraquinones, reducing sugars, phenolic compounds, tannins, and cardiotonic glycosides.⁵⁸ Therefore, based on the presence of metabolites in these two genera, it is possible that Peixotoa A. Juss may also synthesize some of these substances.

Despite this information, scarce studies demonstrating the potential medicinal use of other plant parts, such as leaf, stem, root, and flower, are available. In the present study, we demonstrate the potential antagonistic activity of a stem extract from J. princeps Vell. and flower and leaf extracts from Peixotoa A. Juss on P2Y2 and P2Y4 receptors, inhibiting UTP-induced calcium responses in a dose–concentration manner without causing cytotoxic effects. However, it is important to understand and characterize the active molecules from these extracts responsible for the observed inhibitory effect, which will be carried out in further studies by our group.

In conclusion, our results point to the discovery of potential antagonists for P2Y2 and P2Y4 receptors from Brazilian botanical species J. princeps Vell. and Peixotoa A. Juss. This discovery may significantly contribute to purinergic pharmacology and the application of P2 receptor antagonists in clinical therapy.

Footnotes

Acknowledgments

This work was supported by grants from Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and Instituto Oswaldo Cruz (IOC). The authors thank Dr. Vinícius Cotta, who kindly donated the J774.G8 cell line, Fátima Regina Marques for technical assistance with extracts, and the Program for Technological Development in Tools for Health PDTIS-FIOCRUZ/RPT-FIOCRUZ for the use of its facilities.

This article is based on the author's dissertation and thesis, which is available in a repository in Brazil. The authors thank the Oswaldo Cruz Institute and the Postgraduate Program in Cellular and Molecular Biology for providing all the necessary conditions to complete this work.

Author Disclosure Statement

No competing financial interests exist.

References

Ralevic

, Burnstock

: Receptors for purines and pyrimidines. Pharmacol Rev, 1998; 50:413–492.

Jacobson

, Boeynaems

J-M

: P2Y nucleotide receptors: Promise of therapeutic applications. Drug Discov Today, 2010; 15:570–578.

Peterson

, Camden

, Wang

, et al.: P2Y2 nucleotide receptor-mediated responses in brain cells. Mol Neurobiol, 2010; 41:356–366.

Burnstock

: Pathophysiology and therapeutic potential of purinergic signalling. Pharmacol Rev, 2006; 58:58–86.

Weisman

, Wang

, Kong

, et al.: Molecular determinants of P2Y2 nucleotide receptor function: Implications for proliferative and inflammatory pathways in astrocytes. Mol Neurobiol, 2005; 31:169–184.

Jacob

, Pérez Novo

, Bachert

, Van Crombruggen

: Purinergic signaling in inflammatory cells: P2 receptor expression, functional effects, and modulation of inflammatory responses. Purinergic Signal, 2013; 9:285–306.

Thevananther

, Sun

, Li

, et al.: Extracellular ATP activates c-jun N-terminal kinase signaling and cell cycle progression in hepatocytes. Hepatology, 2004; 39:393–402.

Tackett

, Sun

, Mei

, et al.: P2Y2 purinergic receptor activation is essential for efficient hepatocyte proliferation in response to partial hepatectomy. Am J Physiol Gastrointest Liver Physiol, 2014; 307:G1073–G1087.

Degagné

, Grbic

, Dupuis

A-A

, et al.: P2Y2 receptor transcription is increased by NF-kappa B and stimulates cyclooxygenase-2 expression and PGE2 released by intestinal epithelial cells. J Immunol, 2009; 183:4521–4529.

10.

Zhang

, Kohan

, Nelson

, Carlson

, Kishore

: Potential involvement of P2Y2 receptor in diuresis of postobstructive uropathy in rats. Am J Physiol Renal Physiol, 2010; 298:F634–F642.

11.

Vanderstocken

, Bondue

, Horckmans

, et al.: P2Y2 receptor regulates VCAM-1 membrane and soluble forms and eosinophil accumulation during lung inflammation. J Immunol, 2010; 185:3702–3707.

12.

Ayata

, Ganal

, Hockenjos

, et al.: Purinergic P2Y2 receptors promote neutrophil infiltration and hepatocyte death in mice with acute liver injury. Gastroenterology, 2012; 143:1620–1629.e4.

13.

Inoue

, Chen

, Hirsh

, Yip

, Junger

: A3 and P2Y2 receptors control the recruitment of neutrophils to the lungs in a mouse model of sepsis. Shock, 2008; 30:1.

14.

Marcus

, Scofield

: Apical P2Y4 purinergic receptor controls K+ secretion by vestibular dark cell epithelium. Am J Physiol Cell Physiol, 2001; 281:C282–C289.

15.

Ghanem

, Robaye

, Leal

, et al.: The role of epithelial P2Y2 and P2Y4 receptors in the regulation of intestinal chloride secretion. Br J Pharmacol, 2005; 146:364–369.

16.

Kim

C-H

, Kim

H-Y

, Lee

, Chang

, Oh

S-H

, Lee

: P2Y4-Mediated Regulation of Na+ Absorption in the Reissner's Membrane of the Cochlea. J Neurosci, 2010; 30:3762–3769.

17.

Maruoka

, Jayasekara

MPS

, Barrett

, et al.: Pyrimidine nucleotides with 4-alkyloxyimino and terminal tetraphosphate δ-ester modifications as selective agonists of the P2Y(4) receptor. J Med Chem, 2011; 54:4018–4033.

18.

Koehn

, Carter

: The evolving role of natural products in drug discovery. Nat Rev Drug Discov, 2005; 4:206–220.

19.

Balunas

, Kinghorn

: Drug discovery from medicinal plants. Life Sci, 2005; 78:431–441.

20.

Itokawa

, Morris-Natschke

, Akiyama

, Lee

K-H

: Plant-derived natural product research aimed at new drug discovery. J Nat Med, 2008; 62:263–280.

21.

Galvez-Llompart

, Zanni

, García-Domenech

: Modeling natural anti-inflammatory compounds by molecular topology. Int J Mol Sci, 2011; 12:9481–9503.

22.

Liu

, Zou

, Liu

, Jiang

L-H

, Li

: Inhibition of ATP-induced macrophage death by emodin via antagonizing P2X7 receptor. Eur J Pharmacol, 2010; 640:15–19.

23.

Santos

JAA

, Fidalgo-Neto

, Faria

, et al.: Effect of Rheedia longifolia leaf extract and fractions on the P2X7 receptor in vitro: Novel antagonists?. J Med Food, 2011; 14:920–929.

24.

Sullivan

, Tucker

, Dale

: Measurement of [Ca2+] using the Fluorometric Imaging Plate Reader (FLIPR). Methods Mol Biol, 1999; 114:125–133.

25.

Hansen

, Bräuner-Osborne

: FLIPR assays of intracellular calcium in GPCR drug discovery. Methods Mol Biol, 2009; 552:269–278.

26.

Arkin

, Connor

, Emkey

, et al.: FLIPR^™ Assays for GPCR and Ion Channel Targets. In: Assay Guidance Manual. Eli Lilly & Company and the National Center for Advancing Translational Sciences, Bethesda, 2004, pp.433–464.

27.

Kaulich

, Streicher

, Mayer

, Müller

: Flavonoids - novel lead compounds for the development of P2Y₂ receptor antagonists. Drug Dev Res, 2003; 59:72–81.

28.

Ito

, Egashira

, Yoshida

, et al.: Identification of novel selective P2Y6 receptor antagonists by high-throughput screening assay. Life Sci, 2017; 180:137–142.

29.

Salkind

: Single-Blind Study. In: Encyclopedia of Research Design. www.methods.sagepub.com/reference/encyc-of-research-design/n423.xml (accessed January 2018 ).

30.

Huang

, Ojcius

, Young

, et al.: The anti-tumorigenic mushroom agaricus blazei murill enhances IL-1β production and activates the NLRP3 inflammasome in human macrophages. PLoS One, 2012; 7:1–11.

31.

Zhang

J-H

, Chung Oldenburg: A simple statistical parameter for use in evaluation and validation of high throughput screening assays. J Biomol Screen, 1999; 4:67–73.

32.

, Llorente

, Brasch

: Improvements in live cell analysis of G protein coupled receptors using second generation BD calcium assay kits. Curr Chem Genomics, 2008; 2:10–15.

33.

Molecular Devices: Measuring Intracellular Calcium with the FLIPR I and FL IPR 384 Fluorometric Imaging Plate Reader Systems. www.moleculardevices.com/resources/application-notes/measuring-intracellular-calcium-flipr-i-and-flipr-384-fluorometric (accessed July 2017 ).

34.

Luo

, Zhu

, Hu

: Cell-based calcium assay for medium to high throughput screening of TRP channel functions using FlexStation 3. J Vis Exp, 2011; 54: pii:3149.

35.

Camarda

, Fischetti

, Anzellotti

, et al.: Pharmacological profile of NOP receptors coupled with calcium signaling via the chimeric protein Gαqi5. Naunyn Schmiedebergs Arch Pharmacol, 2009; 379:599–607.

36.

Namovic

, Jarvis

, Donnelly-Roberts

: High Throughput Functional Assays for P2X Receptors. In: Current Protocols in Pharmacology. John Wiley & Sons, New Jersey, 2012, pp. Unit 9.15.1-9.15.21.

37.

Accurso

, Moss

, Wilmott

, et al.: Denufosol tetrasodium in patients with cystic fibrosis and normal to mildly impaired lung function. Am J Respir Crit Care Med, 2011; 183:627–634.

38.

Nakamura

, Imanaka

, Sakamoto

: Diquafosol Ophthalmic solution for dry eye treatment. Adv Ther, 2012; 29:579–589.

39.

Lau

OCF

, Samarawickrama

, Skalicky

: P2Y2 receptor agonists for the treatment of dry eye disease: A review. Clin Ophthalmol, 2014; 8:327–334.

40.

Gee

, Brown

, Chen

W-NU

, Bishop-Stewart

, Gray

, Johnson

: Chemical and physiological characterization of fluo-4 Ca2+-indicator dyes. Cell Calcium, 2000; 27:97–106.

41.

Valentin

, Ortmann

, Atze

, et al.: New Tools for Drug Discovery: Monitoring Intracellular Ca 2 + Fluxes in Primary Cell Types with High-Throughput Formats. www.bio.lonza.com/uploads/tx_mwaxmarketingmaterial/Lonza_Posters_New_Tools_for_Drug_Discovery_Monitoring_Intracellular_Ca2_Fluxes_in_Primary_Cell_Types_with_High-Throughput_Formats.pdf (accessed October 2017 ).

42.

Buell

, Michel

, Lewis

, Collo

, Humphrey

, Surprenant

: P2X1 receptor activation in HL60 cells. Blood, 1996; 87:2659–2664.

43.

Adrian

, Bernhard

, Breitinger

, Ogilvie

: Expression of purinergic receptors (ionotropic P2X1-7 and metabotropic P2Y1-11) during myeloid differentiation of HL60 cells. Biochim Biophys Acta, 2000; 1492:127–138.

44.

Coutinho-Silva

, Ojcius

, Górecki

, et al.: Multiple P2X and P2Y receptor subtypes in mouse J774, spleen and peritoneal macrophages. Biochem Pharmacol, 2005; 69:641–655.

45.

Sakaki

, Tsukimoto

, Harada

, Moriyama

, Kojima

: Autocrine regulation of macrophage activation via exocytosis of ATP and activation of P2Y11 receptor. PLoS One, 2013; 8:e59778.

46.

Azimi

, Roberts-Thomson

, Monteith

: Calcium influx pathways in breast cancer: Opportunities for pharmacological intervention. Br J Pharmacol, 2014; 171:945–960.

47.

King

, Townsend-Nicholson

, Burnstock

, King

, Townsend-Nicholson

, Burnstock

: Metabotropic receptors for ATP and UTP: Exploring the correspondence between native and recombinant nucleotide receptors. Trends Pharmacol Sci, 1998; 19:506–514.

48.

von Kügelgen

: Pharmacological profiles of cloned mammalian P2Y-receptor subtypes. Pharmacol Ther, 2006; 110:415–432.

49.

Centro Nacional de Conservação da Flora: Joannesia princeps. In: Lista Vermelha da flora brasileira versão 2012.2. www.cncflora.jbrj.gov.br/portal/pt-br/profile/Joannesia princeps (accessed May 2018 ).

50.

Sousa

OV de

, Fioravante

, Yamamoto

, Alves

, Del-Vechio-Vieira

, Araújo

ALA

: Biological properties of the seeds of Joannesia princeps Vellozo. HU Rev, 2007; 33:23–27.

51.

Donato-Trancoso

, Gonçalves

, Monte-Alto-Costa

, Silva

, Romana-Souza

: Seed oil of Joannesia princeps improves cutaneous wound closure in experimental mice. Acta Histochem, 2014; 116:1169–1177.

52.

Achenbach

, Benirschke

: Joannesialactone and other compounds from Joannesia princeps . Phytochemistry, 1997; 45:149–157.

53.

Waibel

, Benirschke

, Achenbach

: Sesquineolignans and other constituents from the seeds of Joannesia princeps . Phytochemistry, 2003; 62:805–811.

54.

Camero

, Temraz

, Braca

, De Leo

: Phytochemical study of Joannesia princeps Vell. (Euphorbiaceae) leaves. Biochem Syst Ecol, 2017; 70:69–72.

55.

Flora do Brasil. 2020: Peixotoa A Juss www.reflora.jbrj.gov.br/reflora/floradobrasil/FB8933 (accessed May 2018 ).

56.

Carneiro

MRB

: The medicinal flora in the center-west of Brazil: a case study with an ethnobotanical approach in Campo Limpo of Goias. UniEvangélica University Center, 2009; 1–243.

57.

Amâncio de Frias

, Mendes Costa

, Aparecida Takahashi

: Phytochemical characterization and evaluation of antibacterial and anticholinesterase activities of extracts of Banisteriopsis anisandra A. Juss. (Malpighiaceae). Cuban Journal of Medicinal Plants, 2011; 16:60–71.

58.

Andrade

, Matias

, Corrêa

, Oliveira

AKM

, Guidolin

DGF

, Roel

: Phytochemistry, antioxidant potential and antifungal of Byrsonima crassifolia on soil phytopathogen control. Brazilian J Biol, 2017; 78:140–146.