Maillard Reaction Products of Stir Fried Hordei Fructus Germinatus Are Important for Its Efficacy in Treating Functional Dyspepsia

Abstract

Hordei Fructus Germinatus (HFG) has been used as a traditional medicine to treat functional dyspepsia (FD) in China. Stir fried HFG (F-HFG) containing Maillard reaction products (MRPs) is used more widely than the raw HFG (R-HFG). However, the exact mechanisms in its functionality remain unclear. This article investigated the effect of R-HFG, F-HFG, and MRPs on brain-gut peptides, gut microbiota, and digestive enzymes using an FD animal mode. After administration of R-HFG, F-HFG, and MRPs, higher mRNA expression level of gastrin (GAS) and lower mRNA expression level of vasoactive intestinal peptide (VIP) were exhibited in F-HFG and MRPs rats than R-HFG rats (P < .05). Furthermore, compared with the R-HFG group, the contents of motilin (MTL) and GAS showed an upward tendency, whereas the contents of VIP and chokcystokinin (CCK) showed a downward tendency in the F-HFG group. In addition, bacterial communities in the control, F-HFG, and MRPs groups clustered closely to one another, and bacterial communities in the model and recovery groups clustered together, whereas the bacterial communities in the R-HFG group were clustered into a category. Moreover, there were no apparent differences in brain-gut peptides and gut microbiota between the F-HFG and MRPs groups. However, after the oral administration of R-HFG, F-HFG, and MRPs, the level of digestive enzyme did not show a significant change as compared with the recovery group. These results indicated that the stronger effect of F-HFG could be attributed to the MRPs produced during stir frying, and MRPs possessed the effect of regulating brain-gut peptides and gut microbiota.

Introduction

Hordei Fructus Germinatus (HFG), also called Maiya in Chinese, is obtained by drying the germinated ripe fruits of barley (Hordeum vulgare L.). It is generally known that HFG is the main raw material for brewing beer, at the same time, HFG has been used as a traditional medicine for centuries. The medicinal application of HFG was first documented in Yaoxinglun. Now HFG has been listed in the Chinese Pharmacopoeia. HFG is widely used for the treatment of functional dyspepsia (FD) in China and frequently prescribed either alone or in combination with other herbs, such as Shanzha (Fructus Crataegi) and Shenqu (Massa Medicata Fermentata).^1,2

Under the theory of Traditional Chinese Medicine (TCM), crude herbs should be appropriately processed before medicinal use because it improves the therapeutic effect and reduces the toxicity and/or side effects.³ The common processing methods include stir frying, calcining, steaming, and boiling.⁴ In China the popular processing methods for raw HFG (R-HFG) is stir frying to prepare stir fried HFG (F-HFG), named as Chao-Maiya. F-HFG is more widely used in TCM than R-HFG. According to the standardized prescriptions of Chinese medicine, there are 15 Chinese patent drugs containing F-HFG, such as Xiaoer-Huazhi-San, Baikou-Tiaozhong-Wan, and Baohe-Pian. However, there are only seven Chinese patent drugs containing R-HFG, such as Shenqu-Cha. It is unclear what advantages F-HFG have over R-HFG for the treatment of FD and what mechanisms might be responsible for those advantages.

In the quality control of TCM research, digestive enzyme (e.g., amylase) and flavonoids (e.g., quercetin, tricine, kaempferol, and catechin) are regarded as the main maker compounds for quality control of R-HFG and F-HFG.⁵ Therefore, it is worth exploring whether the enhancement of digestive function of F-HFG is related to the digestive enzyme and flavonoids. On the one hand, it is widely accepted that the enzyme has an optimal temperature range and its activity will decrease under high temperature. That is to say, the content and activity of digestive enzyme in F-HFG will decrease in comparison with that in R-HFG. On the basis of that analysis, R-HFG should be selected to compose prescription for FD. On the other hand, our previous research had demonstrated that the content of total flavonoids did not change significantly during the stir frying process.⁶ In other words, there were no significant differences in the content of total flavonoids between R-HFG and F-HFG. Therefore, if only digestive enzyme and flavonoids are important for functionality, it cannot be explained scientifically why the F-HFG is more widely accepted than R-HFG in clinical prescriptions.

In recent years, the Maillard reaction, which occurs mainly between amino acids, peptides, or proteins with reducing sugars during heating, has received much attention of researchers on TCM.⁷ Our previous research demonstrated that the contents of amino acids and reducing sugars in R-HFG change significantly during the stir frying process, implying that the Maillard reaction has occurred.⁶ This reaction forms Maillard reaction products (MRPs) that contribute to aroma and an attractive appearance.⁸ Recently, many studies have focused on the activities of MRPs. Some investigations revealed that MRPs could result in multifarious chronic diseases, such as diabetic complications and atherosclerosis.^9,10 On the contrary, there were also other studies that showed that MRPs had multiple pharmacological actions, including antioxidant activities, anti-inflammatory effects, and antibacterial activities.^11
–13 Furthermore, TCM argues that aroma substances produced during the stir frying process can improve digestive capability.¹⁴ Since the main components of MRPs contain aroma substances, we preliminarily speculate that MRPs can also improve digestive capability.

FD, a common chronic gastrointestinal disease, is characterized by upper abdominal discomfort, sensation of fullness, and so on.^15,16 Although the exact pathogenesis of FD is unknown, previous studies have shown that gastrointestinal dysmotility, visceral hypersensitivity, and psychological anxiety factors are closely related to FD.^17
–19 In recent years, many studies have demonstrated that brain-gut peptides are deeply involved in the regulation of gastrointestinal motility.^20,21 It has also been suggested that gut microbiota can affect feeding and emotions.^22,23 Furthermore, digestive enzymes have been used to treat FD. Therefore, we can consider that FD may be closely related to brain-gut peptides, gut microbiota, and digestive enzyme to a certain extent, and further speculate that MRPs produced during stir frying process can regulate brain-gut peptides, gut microbiota, and digestive enzyme. Moreover, the reason why F-HFG is more widely used than R-HFG may be due to MRPs.

The purpose of this research is to compare the effects of R-HFG and F-HFG on the digestive function. Furthermore, the effect of MRPs on brain-gut peptides, gut microbiota, and digestive enzymes was also studied. To the best of our knowledge, few endeavors were made to investigate the mechanism of R-HFG and F-HFG on digestive function from the Maillard reaction perspective. Moreover, the effects of MRPs on brain-gut peptides, gut microbiota, and digestive enzyme were also seldom reported. This research may be useful for clarifying the mechanism of stir frying process from the Maillard reaction perspective, which will lay the foundation for the clinical application of R-HFG and F-HFG.

Materials and Methods

Materials

R-HFG and F-HFG were purchased from a local pharmacy (Nanchang, China), and identified by Professor Shouwen Zhang from Jiangxi University of Traditional Chinese Medicine. 5-Hydroxymethyl furfural (purity ≥98%) was obtained from the National Institute for Food and Drug Control (Beijing, China). Methanol was of high-performance liquid chromatography (HPLC) grade and obtained from E. Merck (Darmstadt, Germany). Ultrapure water was prepared through a Milli-Q system (Millipore, Bedford, MA) and used for all analyses. Glucose, maltose, fructose, glycine, histidine, arginine, γ-aminobutyric acid, threonine, alanine, proline, tyrosine, valine, methionine, isoleucine, leucine, phenylalanine, tryptophan, and lysine were purchased from Shanghai Aladdin Bio-Chem Technology Co., Ltd (Shanghai, China). All other chemicals used were analytical grade and commercially available.

Comparative analysis of F-HFG by HPLC fingerprint

R-HFG as well as F-HFG is included in the Chinese Pharmacopoeia (2015 edition). F-HFG can be obtained from local markets or by processing using R-HFG according to the procedure recorded in the Chinese Pharmacopoeia. To assess the similarity and the differences between the marketed F-HFG and self-made F-HFG, a fingerprint by using HPLC was established (Fig. 1).

FIG. 1.

HPLC fingerprints of marketed F-HFG and self-made F-HFG. Separation was carried out on a kromasil C18 column (4.6 × 250 mm, 5 μm). Detection wavelength: 283 nm; mobile phase A: water containing 0.1% acetic acid, mobile phase B: methanol; gradient program: 2% B (0–20 min), 2–35% B (20–60 min); flow rate: 0.8 mL/min; temperature: 30°C; injection volume: 20 μL. Seven common peaks monitored with DAD at 283 nm were 1, 2, 3, 4, 5, 6, and 7. S1–S6: marketed F-HFG; S7–S12: self-made F-HFG; R: reference chromatogram. DAD, diode array detector; F-HFG, fried Hordei Fructus Germinatus; HPLC, high-performance liquid chromatography.

As shown in Figure 1, seven common peaks were found in the 12 different batches of samples (6 batches of marketed F-HFG and 6 batches of self-made F-HFG). The peak 6 was chosen as the reference peak. The similarities between the marketed F-HFG and self-made F-HFG were analyzed by the Similarity Evaluation System for Chromatographic Fingerprint of Traditional Chinese Medicine (Version 2012; National Committee of Pharmacopoeia, China). The results are shown in Table 1. As shown in Table 1, all the correlation coefficients between the reference chromatogram and S1, S2, S3, S4, S5, S6, S7, S8, S9, S10, S11, and S12 were >0.8. Furthermore, the minimum value of correlation coefficients was observed between S4 and S12 (0.656). The results indicated that the marketed F-HFG and self-made F-HFG showed a certain similarity. Moreover, TCM clinics mostly purchased F-HFG from the markets. Therefore, F-HFG, which was short for the commercial F-HFG, was selected as the experimental drug.

Table 1.

Similarities of Marketed Fried Hordei Fructus Germinatus and Self-Made Fried Hordei Fructus Germinatus

Similarity	S1	S2	S3	S4	S5	S6	S7	S8	S9	S10	S11	S12	R
S1	1.000	0.974	0.935	0.907	0.891	0.871	0.902	0.904	0.760	0.738	0.855	0.685	0.898
S2	0.974	1.000	0.973	0.913	0.923	0.896	0.932	0.920	0.758	0.730	0.878	0.677	0.913
S3	0.935	0.973	1.000	0.962	0.917	0.890	0.935	0.918	0.752	0.726	0.874	0.674	0.911
S4	0.907	0.913	0.962	1.000	0.863	0.841	0.880	0.878	0.729	0.707	0.838	0.656	0.873
S5	0.891	0.923	0.917	0.863	1.000	0.991	0.985	0.975	0.901	0.887	0.984	0.848	0.983
S6	0.871	0.896	0.890	0.841	0.991	1.000	0.984	0.981	0.941	0.934	0.995	0.903	0.993
S7	0.902	0.932	0.935	0.880	0.985	0.984	1.000	0.991	0.908	0.899	0.981	0.865	0.990
S8	0.904	0.920	0.918	0.878	0.975	0.981	0.991	1.000	0.928	0.920	0.983	0.889	0.993
S9	0.760	0.758	0.752	0.729	0.901	0.941	0.908	0.928	1.000	0.980	0.952	0.970	0.945
S10	0.738	0.730	0.726	0.707	0.887	0.934	0.899	0.920	0.980	1.000	0.950	0.994	0.938
S11	0.855	0.878	0.874	0.838	0.984	0.995	0.981	0.983	0.952	0.950	1.000	0.925	0.993
S12	0.685	0.677	0.674	0.656	0.848	0.903	0.865	0.889	0.970	0.994	0.925	1.000	0.909
R	0.898	0.913	0.911	0.873	0.983	0.993	0.990	0.993	0.945	0.938	0.993	0.909	1.000

Preparation of the extracts of R-HFG and F-HFG

The R-HFG and F-HFG are shown in Figure 2a and b, respectively. The same weight of R-HFG and F-HFG, pulverized to a coarse powder, were, respectively, refluxed with water two times (0.1 g/mL crude drug), 1.5 h for each time, and the extraction solutions were combined and then filtered. The aqueous solution obtained was condensed to 0.5 g/mL crude drug under reduced pressure.

FIG. 2.

Photographs of R-HFG (a), F-HFG (b), and MRPs (c) prepared from three kinds of reducing sugar and 15 types of amino acids at 180°C in an oven for 0, 10, and 20 min. MRPs, Maillard reaction products; R-HFG, raw Hordei Fructus Germinatus.

Preparation of MRPs

Our previous experiments showed that the contents of glucose, maltose, fructose, glycine, histidine, arginine, γ-aminobutyric acid, threonine, alanine, proline, tyrosine, valine, methionine, isoleucine, leucine, phenylalanine, tryptophan, and lysine were 18,691, 15,969, 9872, 159.41, 131.22, 469.89, 157.79, 192.18, 481.60, 1186.45, 408.77, 468.81, 32.14, 286.47, 527.84, 387.85, 54.46, and 256.63 μg/g in R-HFG, respectively.^24,25 According to the aforementioned ratio, 3 kinds of reducing sugar and 15 types of amino acids were weighed and mixed uniformity in the weighing bottle, heated for 20 min at 180°C in an oven to form MRPs (Fig. 2c).Then MRPs were dissolved in distilled water at a concentration of 0.025 g/mL and administered to rats.

FD model construction and drug administration

Sprague-Dawley rats (100–120 g, male and female) of specific pathogen free-grade were provided by the Experimental Animal Center of Jiangxi University of Traditional Chinese Medicine, Jiangxi, SCXK20110001. The animal experiments performed here were based on the institutional guidelines for Care and Use of Laboratory Animals and approved by the Committee of Jiangxi University of Traditional Chinese Medicine. All animals were housed under controlled conditions (relative humidity 50% ± 5%, 25°C ± 2°C) and fed with standard diet pellets. They were fasted for 12 h before experiments with free access to tap water.

The rats were randomly divided into six groups (n = 6): control group, model group, recovery group, R-HFG group, F-HFG group, and MRPs group. The FD model was established by clamping the rats' tails and semistarvation as previously described with slight modification to all animals except those in the control group.^26,27 On the 15th day, the animals in the model group were anesthetized, and then the duodenum, hypothalamus, and fresh feces were collected. The blood samples were collected from the abdominal aorta. The whole blood samples were allowed to stand at room temperature for 1.5 h and centrifuged at 3000 g for 15 min at 4°C to get the serum sample.

The rats in the R-HFG, F-HFG, and MRPs groups were orally administrated with R-HFG (7.8 g/kg per day), F-HFG (7.8 g/kg per day), and MRPs (0.39 g/kg per day, equivalent to ∼7.8 g F-HFG/kg per day) for 14 days, respectively. The animal dose of F-HFG used in this study was converted from a human dose. In the meantime, the rats in the control group and the recovery group were administrated with the same volume of normal saline. After 2 weeks administration, all the rats were sacrificed. And as described in the model group, duodenum, hypothalamus, serum sample, and fresh feces were collected for the following analysis. The serum samples were prepared for determining the levels of pepsin (PP), trypsin (TRY), pancreaticamylase (PAMY), pancrelipases (PL), motilin (MTL), gastrin (GAS), vasoactive intestinal peptide (VIP), and chokcystokinin (CCK). Duodenum and hypothalamus were used for investigating the mRNA expression levels of MTL, GAS, VIP, and CCK. The feces were used for analysis of gut microbiota.

ELISA

The contents of digestive enzymes (PP, TRY, PAMY, and PL) and brain-gut peptides (MTL, GAS, VIP, and CCK) in the serum were measured by ELISA kit (Nanjing Jiancheng Bioengineering Institute Co., Ltd, Nanjing, China). The experiment was performed strictly in accordance with the manufacturer's instructions and run in triplicate. The optical density of each plate was determined using a microplate reader (Perlong Medical, Beijing, China) at 450 nm, and the standard curve was applied to calculate the concentrations of MTL, GAS, VIP, and CCK.

Reverse transcription-polymerase chain reaction

The mRNA expression levels of MTL, GAS, VIP, and CCK were investigated by RT-polymerase chain reaction (PCR). The total RNA was isolated from duodenum and hypothalamus using an Eastep^® Super Total RNA Extraction kit (Promega, WI) following the manufacturer's instructions. The purity of the RNA was determined by electrophoresis and the RNA concentration was measured using a Varioskan Flash (Thermo Scientific, Waltham, MA). Isolated total RNA was then reverse transcribed to generate cDNA using GoScript™ Reverse Transcription System (Promega).

The PCR was performed using the GoTaq^® Green Master Mix (Promega) with a thermal cycler (Hangzhou LongGene Scientific Instruments Co., Ltd, Hangzhou, China). Each reaction was performed for 30 cycles in a total volume of 25 μL (3 μL cDNA, 12.5 μL of 2 × GoTap Green Master Mix, 1 μL forward primer, 1 μL reverse primer, 7.5 μL Nuclease-Free Water). The primers were designed according to the cDNA sequences and synthesized commercially (Sangon Biotechniques, Shanghai, China).The primer sequences are shown in Table 2. Amplification conditions were as follows: predenaturation at 95°C for 5 min, 30 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 30 s, and a final extension at 72°C for 5 min and stored at 4°C.

Table 2.

Primer Sequences for Reverse Transcriptase-Polymerase Chain Reaction

Gene symbol	GeneBank accession	Sequence
VIP	NM_053991.1	Forward 5′-AATCCAGAAGCAAGCCTCAGTTCC-3′
VIP	NM_053991.1	Reverse 5′-GGCGTGTCATTCTCCGCTAAGG-3′
MTL	NM_031144	Forward 5′-CTGTGGTCATCTTGCTAGAGGTGTATG-3′
MTL	NM_031144	Reverse 5′-CCATTCGTGCTGGAGCAGTCAAC-3′
CCK	NM_012829.2	Forward 5′-GATACATCCAGCAGGTCCGC-3′
CCK	NM_012829.2	Reverse 5′-CCTATGGCTAGGGTCCAGGC-3′
GAS	NM_012849.1	Forward 5′-AAGGTCCGCAACACTTCATAGCAG-3′
GAS	NM_012849.1	Reverse 5′-CCATCCATCCGTATGCTTCCTCTTC-3′
β-Actin	NM_001110056.1	Forward 5′-CCCTAAGGCCAACCGTGAA-3′
β-Actin	NM_001110056.1	Reverse 5′-TGGTACGACCAGAGGCATACA-3′

CCK, chokcystokinin; GAS, gastrin; MTL, motilin; VIP, vasoactive intestinal peptide.

The resulting PCR products were further analyzed by 2% agarose gel electrophoresis. Then gels were photographed using a Molecular Imager^® Gel Doc™ XR+ Imaging System (Bio-Rad, Hercules, CA). Band intensities were quantified by densitometry, and each value was normalized against that of β-actin.

PCR-denaturing gradient gel electrophoresis analysis

The fecal microbial genomic DNA was extracted using the TIANamp Stool DNA Kit (TIANGEN Biotech CO., Ltd, Beijing, China) following the manufacturer's procedures. The V3 region of the bacterial 16S rDNA was amplified using the primers GC-338F (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG) and 518R (ATTACCGCGGCTGCTGG).²⁸ PCR was carried out in a thermal cycler (Hangzhou LongGene Scientific Instruments Co., Ltd) using the following parameters: predenaturation at 95°C for 2 min, 30 cycles of amplification (95°C for 30 s, 56°C for 30 s, and 72°C for 30 s) and a final extension at 72°C for 10 min.

Denaturing gradient gel electrophoresis (DGGE) was carried out using a DCode™ Universal Mutation Detection System (Bio-Rad) as described previously.²⁹ Gels were stained with SYBR Green I nucleic acid gel stain (Solarbio, Beijing, China) and subsequently were photographed using a Molecular Imager Gel Doc XR+ Imaging System (Bio-Rad).The DGGE bands were analyzed using the software Quantity One 4.6.2 (Bio-Rad). The diversity of the bacterial community was evaluated using the Shannon diversity index (SDI) and species richness index (SRI).^30,31 Meanwhile, cluster analysis was used to calculate and visualize the similarities between DGGE profiles using SPSS version 13.0 (SPSS, Inc., Chicago, IL).

Several predominant bands in the DGGE gel were excised. Then the DNA eluted from the excised bands was reamplified for sequencing using the primers 338F (without GC clamp) and 518R with the same PCR program. These amplified PCR products were sent to commercial sequencing companies (Shanghai Sangon Biotech, Inc., Shanghai, China) to sequence. The obtained sequences were compared with those in the GenBank database using BLAST program to determinate species.

HPLC analyses

HPLC method was used to investigate the differences of the main components in R-HFG, F-HFG, and MRPs. Analyses were performed on an Agilent Series 1260 liquid chromatograph (Agilent Technologies, Palo Alto, CA), equipped with a diode array detector. The separation was carried out on a kromasil C₁₈ column (5 μm particle size, 4.6 × 250 mm) from AKZO NOBEL company at a column temperature of 25°C. The mobile phase consisted of solvent A (0.1% acetic acid solution) and solvent B (methanol) at a flow rate of 0.8 mL/min. The gradient elution profile was 0–20 min, 2% B; 20–60 min, 2–35% B. The detector wavelength was 283 nm.

Statistical analysis

Experimental data were calculated and presented as mean ± standard deviation (mean ± SD). Statistical analysis was performed using analysis of variance and the Student's t-test with SPSS 13.0 (SPSS, Inc.). A value of P < .05 was regarded as statistically significant.

Results

The effect of R-HFG, F-HFG, and MRPs on the content of brain-gut peptides in serum

As illustrated in Table 3, the model group showed lower values of MTL and GAS and higher values of VIP and CCK than the control group, implying that the brain-gut peptides played an essential role in FD as compared with the control group. After the treatment of FD rats with F-HFG and MRPs, the levels of MTL and GAS increased significantly, and the levels of VIP and CCK decreased remarkably as compared with the recovery group (P < .05). Meanwhile, the levels of MTL in R-HFG increased significantly (P < .05), whereas no significant changes in the levels of GAS, CCK, and VIP were observed as compared with the recovery group. Moreover, the F-HFG group showed the higher values of MTL and GAS as well as the lower of VIP and CCK than the R-HFG group, suggesting F-HFG was more potent than R-HFG in regulating brain-gut peptides. At the same time, there were no obvious differences in the level of brain-gut peptides between the F-HFG and MRPs groups (P > .05), indicating that MRPs, produced during stir frying process, possess the effect to regulate brain-gut peptides.

Table 3.

The Effect of Raw Hordei Fructus Germinatus, Fried Hordei Fructus Germinatus, and Maillard Reaction Products on the Contents of Motilin, Gastrin, Vasoactive Intestinal Peptide, and Chokcystokinin

Groups	MTL (ng/L)	GAS (ng/L)	VIP (ng/L)	CCK (ng/L)
Control	524.32 ± 94.12	556.94 ± 88.89	482.02 ± 155.33	447.52 ± 56.06
Model	309.19 ± 42.61^*	287.7 ± 102.91^*	890.47 ± 287.03^*	664.98 ± 82.91^*
Recovery	383.54 ± 56.25	298.36 ± 96.44	858.80 ± 203.05	638.38 ± 130.26
R-HFG	492.82 ± 62.73^**	336.66 ± 84.44	721.48 ± 100.91	527.83 ± 86.29
F-HFG	518.66 ± 122.90^**	440.56 ± 83.74^**	621.70 ± 147.52^**	459.97 ± 143.17^**
MRPs	529.73 ± 98.84^**	439.03 ± 118.14^**	640.68 ± 41.01^**	486.95 ± 91.42^**

Mean ± SD, n = 6. Compared with control group,^* P < .05; compared with recovery group, ^** P < .05.

F-HFG, fried Hordei Fructus Germinatus; MRPs, Maillard reaction products; R-HFG, raw Hordei Fructus Germinatus.

The effect of R-HFG, F-HFG, and MRPs on the mRNA expression of MTL, GAS, VIP, and CCK in the duodenum and hypothalamus

Because of the effects of R-HFG, F-HFG, and MRPs on the content of brain-gut peptides in serum, the mRNA expression levels of brain-gut peptides in the duodenum and hypothalamus were further explored. As shown in Figure 3, the result was basically consistent with that of the effect of R-HFG, F-HFG, and MRPs on the content of brain-gut peptides in serum, suggesting that the content changes of MTL, GAS, VIP, and CCK were associated with regulation of the relevant mRNA expression. Especially, higher mRNA expression level of GAS and lower mRNA expression level of VIP was exhibited in the duodenum and hypothalamus of F-HFG rats than R-HFG rats (P < .05). Similarly, in comparison with the R-HFG group, treatment with MRPs increased markedly the mRNA expression levels of MTL and GAS, decreased the VIP mRNA expression level (P < .05), implying that F-HFG and MRPs showed a stronger regulatory effect on the mRNA expressions of MTL, GAS, and VIP, than R-HFG.

FIG. 3.

The effect of R-HFG, F-HFG, and MRPs on the mRNA expression of MTL (a), GAS (b), VIP (c), and CCK (d) in the duodenum and hypothalamus. MTL, GAS, VIP, and CCK were quantified with β-actin as an internal control.*P < .05, compared with the control group; ^▴ P < .05, compared with the recovery group; ^# P < .05, compared with the R-HGF group. CCK, chokcystokinin; GAS, gastrin; MTL, motilin; VIP, vasoactive intestinal peptide.

Analysis of DGGE fingerprint profiles

PCR-DGGE is widely used to investigate the gut microbiota. As shown in Table 4, compared with the control group, SDI and SRI in the model group decreased significantly (P < .05), revealing that changes of gut microbiota in FD rats could be observed. After the administration of F-HFG and MRPs, SDI and SRI increased significantly as compared with the recovery group (P < .05). Especially, compared with the R-HFG group, SDI and SRI in the F-HFG and MRPs groups increased significantly (P < .05). These results suggested that F-HFG and MRPs had a vital influence on gut microbiota. Meanwhile, there were no significant differences in the SDI and SRI between the F-HFG and MRPs treatment groups, implying that both F-HFG and MRPs played an importance role in regulating the gut microbiota.

Table 4.

Shannon Diversity Index and Species Richness Index of All the Six Groups

Groups	SDI	SRI
Control	2.97 ± 0.05	19.83 ± 0.98
Model	2.78 ± 0.06^*	17.17 ± 1.17^*
Recovery	2.83 ± 0.04	18.67 ± 0.52
R-HFG	2.83 ± 0.04	18.33 ± 0.82
F-HFG	2.96 ± 0.04^ ^, ^*	20.50 ± 0.84^ ^, ^*
MRPs	2.95 ± 0.03^ ^, ^*	20.33 ± 0.52^ ^, ^*

Mean ± SD, n = 6. Compared with control group, ^* P < .05; compared with recovery group, ^** P < .05; compared with R-HFG group, ^*** P < .05.

SDI, Shannon diversity index; SRI, species richness index.

Cluster analysis was applied to analyze the similarity of the gut microbiota in the six groups. The result is shown in Figure 4. The gut microbiota in the control, F-HFG, and MRPs groups clustered closely to one another, those in the model and recovery groups clustered together, whereas the gut microbiota in the R-HFG group was clustered into a category. According to the results of cluster analysis, there were obvious differences in the gut microbiota between the F-HFG and R-HFG treatment groups, whereas no obvious differences were found in the gut microbiota between the F-HFG and MRPs treatment groups. This indicated further that F-HFG and MRPs can regulate gut microbiota.

FIG. 4.

DGGE analysis of 16S rDNA fragments of total bacterial populations from rat feces. (a) DGGE image of two samples and schematic diagram of one sample. The predominant bands in the DGGE image are labeled, and the closest relatives are listed in Table 5. (b) Cluster analysis for bacterial communities from 36 samples. A₁–A₆, control; B₁–B₆, model; C₁–C₆, recovery; D₁–D₆, R-HFG; E₁–E₆, F-HFG; F₁–F₆, MRPs. DGGE, denaturing gradient gel electrophoresis.

Table 5.

Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis Fingerprinting of 16S rRibonucleic Acid V3 Region Major Band Gene Sequence Analysis Results

Band name	Closest relatives	Identity (%)	Accession no.
I	Bacteroides eggerthii strain JCM 12986	100	NR 112935.1
II	Ruminococcus flavefaciens strain C94	94	NR 025931.1
III	Clostridium sphenoides strain DSM 632	97	NR 119035.1
IV	Paraprevotella clara strain	96	NR 113077.1
V	Anaerostipes hadrus strain	98	NR 113179.2
VI	Lachnoanaerobaculum umeaense strain CD3: 22	98	NR 116814.1
VII	Porphyromonas crevioricanis	90	NR 104834.1
VIII	Eubacterium coprostanoligenes strain HL	96	NR 104907.1
IX	Prevotella pleuritidis strain JCM 14110	89	NR 041541.1
X	Prevotella buccalis strain JCM 12246	95	NR 113098.1

To identify the identities of the most prominent bacteria, 10 most distinct bands were excised, cloned, and sequenced. The closest relatives to the excised bands are summarized in Table 5. Compared with the control group, the relative abundance of Bacteroides, Ruminococci, Anaerostipes, and Lachnospira in FD model decreased, and the relative abundance of Clostridium, Prevotella, and Porphyromonas increased. After administration of F-HFG and MRPs, the relative abundance of Bacteroides, Ruminococci, and Eubacterium increased, and the relative abundance of Clostridium and Prevotella decreased obviously.

The effect of R-HFG, F-HFG, and MRPs on the content of digestive enzyme in serum

R-HFG and F-HFG contain digestive enzyme, which contribute to digesting the food in the stomach; the content of digestive enzyme in serum was determined. The results are shown in Table 6. Compared with the control group, no obvious differences were found in the levels of PP, TRY, PAMY, and PL in the model group (P > .05), which showed that the levels of digestive enzymes may be maintained at normal level in animal with FD. And after the oral administration of R-HFG, F-HFG, and MRPs, the levels of PP, TRY, PAMY, and PL did not show obvious change in the treatment group compared with the recovery group (P > .05), indicating that the digestive enzymes could not explain properly why the F-HFG was more widely used than R-HFG for the treatment of FD.

Table 6.

Effect of Raw Hordei Fructus Germinatus, Fried Hordei Fructus Germinatus, and Maillard Reaction Products on the Contents of Pepsin, Trypsin, Pancreaticamylase, and Pancrelipases

Groups	PP (ng/mL)	TRY (ng/mL)	PL (ng/mL)	PAMY (ng/mL)
Control	67.32 ± 13.22	134.40 ± 28.78	54.99 ± 13.40	81.54 ± 24.40
Model	51.80 ± 16.36	118.05 ± 27.79	44.87 ± 11.66	83.25 ± 12.09
Recovery	52.21 ± 18.44	117.03 ± 22.94	45.05 ± 6.71	81.04 ± 21.92
R-HFG	59.54 ± 9.66	123.14 ± 22.75	50.90 ± 7.72	80.29 ± 21.11
F-HFG	62.18 ± 7.95	128.08 ± 23.61	55.00 ± 17.66	79.36 ± 20.38
MRPs	60.36 ± 9.08	137.67 ± 45.77	53.33 ± 17.12	82.28 ± 10.31

PAMY, pancreaticamylase; PL, pancrelipases; PP, pepsin; TRY, trypsin.

Analyses of R-HFG, F-HFG, and MRPs by HPLC

The pharmacological effects of Chinese medicines are closely related to their chemical composition. Therefore, it is very important to examine the changes of chemical components during processing. As shown in Figure 5, peaks 1 and 2 were new chemical compounds that appeared in F-HFG. Meanwhile, peaks 1 and 2 appeared also in the chromatograms of MRPs, among which peaks 1 was determined to be 5-hydroxymethyl furfural based on retention time matching. These findings suggested that the new chemical components in F-HFG, produced during stir frying process, were mainly MRPs.

FIG. 5.

Constituent analysis of R-HFG, F-HFG, and MRPs by HPLC: (a) standard (5-hydroxymethyl furfural), (b) MRPs, (c) R-HFG, and (d) F-HFG.

Discussion

In this article, we focused on the potential differences between how R-HFG and F-HFG affect brain-gut peptides, gut microbiota, and digestive enzymes. The results revealed that there were significant differences in brain-gut peptides and gut microbiota between R-HFG and F-HFG, whereas no significant differences were found between F-HFG and MRPs. Therefore, the stronger effect of F-HFG was suggested to be mediated by the roles of MRPs. Since previous studies have mainly focused on the antioxidant and anti-inflammation activity of MRPs, it is suggested that this research is the first to focus on its effect of regulating brain-gut peptides and gut microbiota.

In TCM theory, FD is usually attributable to spleen deficiency (pixu) and liver depression (ganyu). The function of the spleen is mainly reflected in promoting digestion and absorption. The function of liver is related to storing the soul and controlling dispersion, which means that the liver has the effect of regulating emotional activities.^32,33 In our experiment, the FD model was established by clamping the tails of rats on a restricted diet. After being establishing the model, the rats appeared exhausted, sluggish, uncomfortable, irritable, and tense. These symptoms matched with the same description of FD with liver-depression and spleen-deficiency syndrome.^34,35

Brain-gut peptides, which play an important role in functional gastrointestinal disorders, have attracted considerable attention from researchers in recent years. MTL, GAS, VIP, and CCK are the most common brain-gut peptides clinically applied to judge the occurrence and recovery from FD. Studies have shown that MTL can promote gastrointestinal motility, and GAS has the effects of stimulating gastric acid secretion.^36,37 Meanwhile, many investigations have shown that VIP and CCK are also closely related to digestive function. VIP, which is an inhibitory neurotransmitter in the gut, can inhibit gastrointestinal motility by relaxing the gastrointestinal smooth muscle.^38,39 CCK can also inhibit gastric motility and slow gastric emptying.⁴⁰ In our study, the contents of MTL and GAS decreased remarkably, and the contents of VIP and CCK increased markedly in the model group. The results suggested that rats with FD had an obvious para secretion of brain-gut peptides, implying that the FD model was successfully established. Compared with the recovery group, F-HFG and MRPs were more potent than R-HFG in regulating the brain-gut peptides. Therefore, the reason why F-HFG was more widely used than R-HFG was that the MRPs possessed the effect of regulating brain-gut peptides.

In recent years, increasing numbers of researchers have begun to focus on gut microbiota. A number of scientific studies have suggested that the gut microbiota plays a principal role in the regulation of intestinal homeostasis, maintaining immune system and acting as a barrier to gut pathogens.^41,42 Moreover, many studies have also shown that the gut microbiota played a vital role in food digestion.⁴³ This study was carried out to investigate the effect of R-HFG, F-HFG, and MRPs on the gut microbiota in a rat model of FD. The result of cluster analysis suggested that the F-HFG, MRPs, and the control groups showed high similarity in the gut microbiota, implying that both F-HFG and MRPs had a regulatory effect on gut microbiota. However, R-HFG did not have obvious effect on gut microbiota.

On the basis of cluster analysis, the most prominent bacteria was sequenced and further analyzed by comparing band intensities. And the identified Bacteria are included in Bacteroides, Eubacterium, Prevotella, and Clostridium. To some extent, Bacteroides, as well as Eubacterium, may contribute to host health. The Bacteroidetes are major constituents of gut microbiota related with digestion and can establish stable long-term associations with their hosts for helping maintain a healthy gut.^44,45 The Eubacterium can produce short chain fatty acids, which play a critical role in the prevention and treatment of colorectal cancers and ulcerative colitis.^46
–48 But in contrast, overgrowth of Prevotella and Clostridium will likely lead to a potential threat to the health of the host. Emerging studies have linked increased abundance of Prevotella to inflammatory bowel disease.^49,50 Clostridium is also the most commonly isolated proinflammatory pathogen associated with inflammatory bowel diseases.^51,52 In this study, the FD model showed a lower proportion of Bacteroides, Ruminococci, Anaerostipes, and Lachnospira, and a higher proportion of Clostridium, Prevotella, and Porphyromonas than the control group. Administration of F-HFG and MRPs not only significantly suppressed the growth and expansion of Clostridium and Prevotella but also increased the amount of Bacteroidetes and Eubacterium. Consequently, the reason why F-HFG was more widely used than R-HFG was that the MRP possessed the effect of regulating gut microbiota.

It is generally recognized that the secretion of digestive enzymes is a direct response to the function of the digestive system. Moreover, the secretion of digestive enzymes is mainly controlled by the autonomic nervous system and regulated by brain-gut peptides.⁵³ As a result, studies on digestive enzymes will help explain the efficacy differences between R-HFG and F-HFG. In this experiment, there was no significant difference in the contents of digestive enzymes in serum among all groups, suggesting that regulating digestive enzyme secretion is not a mechanism of action of R-HFG and F-HFG. According to Rome criteria, dyspepsia can be divided into two classes: organic dyspepsia (OD) and FD.⁵⁴ The clinical investigation of OD may be identified by an underlying organic disease, which is characterized by damage to the intestinal microvilli and inhibition of digestive enzyme secretion. Therefore, the digestive enzymes could not explain properly why the F-HFG was more widely used than R-HFG for the treatment of FD.

In this study, the MRPs were found to be closely related to promoting digestion of F-HFG. Therefore, the MRPs, which are all regarded as ineffective components from the traditional view, should be regarded as the active ingredients for quality control of F-HFG. In other words, the roles of ineffective components should not be ignored in the research on the processing mechanism and pharmacodynamics. Furthermore, in this study, the MRPs were found to possess the effects of improving digestive capability by regulating brain-gut peptides and gut microbiota. Thus, the appropriate administration of MRPs may decrease the severity of FD. In brief, the research results provide a method of quality control of F-HFG, and provided direct experimental evidence to support the traditional use of MRPs in the treatment of FD. However, further studies regarding the pharmacological effect and action mechanism of MRPs in the treatment of FD are needed.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

Funding Information

The authors sincerely appreciate the financial support from National Natural Science Foundation of China (nos. 81560659 and 81760722), and the Science and Technology Plan Projects of Jiangxi Provincial Education Department (no. GJJ150836).

References

Zhao

, Gan

: Clinical and psychological assessment on Xinwei decoction for treating functional dyspepsia accompanied with depression and anxiety. AM J Chin Med, 2005; 33:249–257.

Chinese Pharmacopoeia Commission: Pharmacopoeia of the People's Republic of China. China Press of Traditional Chinese Medicine, Beijing, China, 2015.

Pan

, Liang

, Niu

, et al.: Comparative studies of pharmacokinetics and anticoagulatory effect in rats after oral administration of Frankincense and its processed products. J Ethnopharmacol, 2015; 172:118–123.

, Li

, Ji

, et al.: Pharmacokinetic comparisons of typical constituents in curcumae rhizoma and vinegar-processed curcumae rhizoma after oral administration to rats. Evid Based Complement Alternat Med, 2018; 2018:1–11.

Yang

, Tan

, Wei

, Li

, Wen

, Wu

: Dynamic change rules of active ingredients and inactive ingredients from Fructus Hordei Germinatus with frying process. Chin J Chin Mater Med, 2016; 41:4382–4388.

Yang

, Wei

, Tan

, et al.: Establishment of near-infrared on-line monitoring model and determination of endpoint in frying process of Hordei Fructus Germinatus . Chin J Chin Mater Med, 2017; 42:478–485.

Delgado-Andrade

, Seiquer

, Navarro

, Morales

: Maillard reaction indicators in diets usually consumed by adolescent population. Mol Nutr Food Res, 2007; 51:341–351.

, Chun

, Kim

, et al.: Anti-inflammatory effect of sugar-amino acid Maillard reaction products on intestinal inflammation model in vitro and in vivo. Carbohyd Res, 2017; 449:47–58.

Sun

, Yokoyama

, Ishiwata

, Asano

: Deposition of advanced glycation end products (AGE) and expression of the receptor for AGE in cardiovascular tissue of the diabetic rat. Int J Exp Pathol, 1998; 79:207–222.

10.

Yan

, Ramasamy

, Naka

, Schmidt

: Glycation, inflammation, and RAGE: A scaffold for the macrovascular complications of diabetes and beyond. Circ Res, 2003; 93:1159–1169.

11.

Kitts

, Chen

, Jing

: Demonstration of antioxidant and anti-inflammatory bioactivities from sugar–amino acid Maillard reaction products. J Agric Food Chem, 2012; 60:6718–6727.

12.

Lee

, Choi

, Seup

, et al.: Inhibitory effect of a tyrosine-fructose Maillard reaction product, 2,4-bis(p-hydroxyphenyl)-2-butenal on amyloid-b generation and inflammatory reactions via inhibition of NF- B and STAT3 activation in cultured astrocytes and microglial BV-2 cells. J Neuroinflamm, 2011; 8:132–144.

13.

Wang

, Guan

, Yu

, et al.: Study on the Maillard reaction enhanced by pulsed electric field in a glycin–glucose model system. Food Bioprocess Tech, 2011; 4:469–474.

14.

Zhong

, David

, Gong

: Processing of Chinese Materia Medica. China Press of Traditional Chinese Medicine, Beijing, China, 2015.

15.

Mahadeva

, Ford

: Clinical and epidemiological differences in functional dyspepsia between the East and the West. Neurogastroent Motil, 2016; 28:167–174.

16.

Zhao

, Zou

, Wang

, et al.: Dyspepsia and irritable bowel syndrome in China: A population-based endoscopy study of prevalence and impact. Aliment Pharm Therap, 2010; 32:562–572.

17.

Samsom

, Verhagen

MAMT

, VanBerge Henegouwen

, Smout

AJPM

: Abnormal clearance of exogenous acid and increased acid sensitivity of the proximal duodenum in dyspeptic patients. Gastroenterol, 1999; 116:515–520.

18.

Di Stefano

, Miceli

, Tana

, et al.: Fasting and postprandial gastric sensorimotor activity in functional dyspepsia: Postprandial distress vs. epigastric pain syndrome. Am J Gastroenterol, 2014; 109:1631–1639.

19.

Jiang

, Jia

, Lei

, et al.: Incidence and psychological-behavioral characteristics of refractory functional dyspepsia: A large, multi-center, prospective investigation from China. World J Gastroenterol, 2015; 21:1932–1937.

20.

Ogiso

, Asakawa

, Amitani

, Inui

: Ghrelin: A gut hormonal basis of motility regulation and functional dyspepsia. J Gastroenterol Hepatol, 2011; 26:67–72.

21.

Chen

, Tsai

: Ghrelin and motilin in the gastrointestinal system. Curr Pharm Des, 2012; 18:4755–4765.

22.

Sandoval

, Seeley

: The microbes made me eat it. Science, 2010; 328:179–180.

23.

Mayer

, Knight

, Mazmanian

, Cryan

, Tillisch

: Gut microbes and the brain: Paradigm shift in neuroscience. J Neurosci, 2014; 34:15490–15496.

24.

, Yang

, Wu

, et al.: Study on variation regularity of amino acids in malt with frying process from view of material basis of Chinese herbs property. Chin Arch Tradit Chin Med, 2018; 36:1084–1088.

25.

, Wu

, Tan

, et al.: Effect of temperature and time on change of carbohydrates in Hordei Germinatus Fructus with frying process. Chin Tradit Herbal Drugs, 2017; 48:1334–1339.

26.

Chang

, Zhao

, Wang

, Lu

, Zhang

: Sini-san improves duodenal tight junction integrity in a rat model of functional dyspepsia. BMC Complem Altern M, 2017; 17:432.

27.

Liang

, Yan

, Mao

, et al.: Evaluation of a modified rat model for functional dyspepsia. Saudi J Gastroenterol, 2018; 24:228–235.

28.

Tian

, Shi

, Ma

, et al.: The effect of Glomus intraradices on the physiological properties of Panax ginseng and on rhizospheric microbial diversity. J Ginseng Res, 2017:1–9.

29.

, Takahashi

, Kimura

, Kuda

: Comparison of PCR-DGGE and PCR-SSCP analysis for bacterial flora of Japanese traditional fermented fish products, aji-narezushi and iwashi-nukazuke. J Sci Food Agric, 2010; 90:1796–1801.

30.

Zhong

, Wu

, Dai

, et al.: Bacterial community analysis by PCR-DGGE and 454-pyrosequencing of horizontal subsurface flow constructed wetlands with front aeration. Appl Microbiol Biotechnol, 2015; 99:1499–1512.

31.

Zeng

, Zeng

, Zhang

, et al.: Characterization of the cellulolytic bacteria communities along the gastrointestinal tract of Chinese Mongolian sheep by using PCR-DGGE and real-time PCR analysis. World J Microbiol Biotechnol, 2015; 31:1103–1113.

32.

Wei

, Hou

, Chao

, Du

, Zong

: Analysis on content of serum monoamine neurotransmitters in macaques with anger-in-induced premenstrual syndrome and liver-qi depression syndrome. Chin J Integr Med, 2012; 10:925–931.

33.

, Xue

: Effects of jingqianshu granule on expression of 5-HT(1A)R of PMS model rats with liver-qi stagnation. Chin J Chin Mater Med, 2011; 36:3498–3501.

34.

Sun

, Sun

, Xu

, et al.: Clinical study of Shengjiang capsule for functional dyspepsia with liver-depression and spleen-deficiency syndrome. J Guangzhou Univ Tradit Chin Med, 2003; 20:99–101.

35.

Qiu

, Liu

, Zhao

, et al.: Gut microbial diversity analysis using Illumina sequencing for functional dyspepsia with liver depression-spleen deficiency syndrome and the interventional Xiaoyaosan in a rat model. World J Gastroenterol, 2017; 23:810–816.

36.

Yamagishi

, Debas

: Cholecystokinin inhibits gastric emptying by acting on both proximal stomach and pylorus. AM J Physiol, 1978; 234:375–378.

37.

Walsh

: Role of gastrin as a trophic hormone. Digestion, 1990; 47:11–16.

38.

Katsoulis

, Neumann

, Klomp

, Schmidt

, Fölsch

: PACAP and VIP relax human colonic smooth muscle cells by NO-independent pathways. Gastroenterology, 1998; 114:A775.

39.

Liddle

, Morita

, Conrad

, Williams

: Regulation of gastric emptying in humans by cholecystokinin. J Clin Invest, 1986; 77:992–996.

40.

Grider

: Role of cholecystokinin in the regulation of gastrointestinal motility. J Nutr, 1994; 124:1334S–1339S.

41.

Sudo

, Sawamura

, Tanaka

, Aiba

, Kubo

, Koga

: The requirement of intestinal bacterial flora for the development of an IgE production system fully susceptible to oral tolerance induction. J Immunol, 1997; 159:1739–1745.

42.

Finlay

: Cell adhesion and invasion mechanisms in microbial pathogenesis. Curr Opin Cell Biol, 1990; 2:815–820.

43.

Simrén

, Barbara

, Flint

, et al.: Intestinal microbiota in functional bowel disorders: A Rome foundation report. Gut, 2012; 62:159–176.

44.

Spence

, Wells

, Smith

: Characterization of the primary starch utilization operon in the obligate anaerobe Bacteroides fragilis: Regulation by carbon source and oxygen. J Bacteriol, 2006; 188:4663–4672.

45.

Faith

, Guruge

, Charbonneau

, et al.: The long-term stability of the human gut microbiota. Science, 2013; 341:1237439.

46.

Pryde

, Duncan

, Hold

, Stewart

, Flint

: The microbiology of butyrate formation in the human colon. Fems Microbiol Lett, 2002; 217:133–139.

47.

Van Immerseel

, Ducatelle

, De Vos

, et al.: Butyric acid-producing anaerobic bacteria as a novel probiotic treatment approach for inflammatory bowel disease. J Med Microbiol, 2010; 59:141–143.

48.

Afra

, Laupland

, Leal

, Lloyd

, Gregson

: Incidence, risk factors, and outcomes of Fusobacterium species bacteremia. BMC Infect Dis, 2013; 13:264.

49.

Dillon

, Lee

, Kotter

, et al.: Gut dendritic cell activation links an altered colonic microbiome to mucosal and systemic T-cell activation in untreated HIV-1 infection. Mucosal Immunol, 2016; 9:24–37.

50.

Larsen

: The immune response to prevotella bacteria in chronic inflammatory disease. Immunology, 2017; 151:363–374.

51.

Strauss

, Kaplan

, Beck

, et al.: Invasive potential of gut mucosa-derived fusobacterium nucleatum positively correlates with IBD status of the host. Inflamm Bowel Dis, 2011; 17:1971–1978.

52.

Loo

, Poirier

, Miller

, et al.: A predominantly clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high morbidity and mortality. Dig World Core Med J, 2005; 353:2442–2449.

53.

Williams

: Mechanism of action of cholecystokinin: A not atypical brain-gut peptide. Nihon Naibunpi Gakkai Zasshi, 1985; 61:533–540.

54.

Oustamanolakis

, Tack

: Dyspepsia organic versus functional. J Clin Gastroenterol, 2012; 46:175–190.