Standardized Siegesbeckia orientalis L. Extract Increases Exercise Endurance Through Stimulation of Mitochondrial Biogenesis

Abstract

Siegesbeckia orientalis has been reported to exhibit anti-allergic, anti-infertility, anti-inflammatory, anti-rheumatic, and immunosuppressive activities. However, there are very few studies describing its stimulatory effects on exercise capacity. This study elucidated whether S. orientalis extract (SOE) standardized to kirenol content can enhance exercise endurance by increasing mitochondrial biogenesis. SOE significantly improved the running distance and time in mice fed normal diet (ND) and high-fat diet (HFD). SOE also enhanced mitochondrial biogenesis by stimulating the mitochondrial regulatory genes including peroxisome proliferator-activated receptor gamma co-activator 1 alpha (PGC-1α), estrogen-related receptor α (ERRα), nuclear respiratory factor 1 (NRF-1), and mitochondrial transcription factor A (TFAM) in the skeletal muscles of ND and HFD mice. Furthermore, SOE upregulated the AMP-activated protein kinase (AMPK)/sirtuin 1 (SIRT1)/PGC-1α/peroxisome proliferator-activated receptor delta (PPARδ) signaling pathway in the skeletal muscles of ND and HFD mice. Kirenol markedly increased adenosine triphosphate production and mitochondrial activity by stimulating the expression of markers of mitochondrial biogenesis and upregulating the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway in L6 myotubes. These results show that SOE has the potential to be used to develop an exercise supplement capable of stimulating mitochondrial biogenesis through the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway.

Introduction

Regular exercise or physical activity is essential for maintaining a healthy lifestyle, and contributes to reducing the risk of developing metabolic diseases such as coronary heart disease, type 2 diabetes, hypertension, hyperlipidemia, and atherosclerosis as well as some cancers.^1
–3 It also increases functional exercise capacity, and hence, is needed to sustain a good quality of life.^4,5

Exercise endurance affects the metabolic characteristics of skeletal muscles by increasing the number of mitochondria, thus, enhancing oxidative metabolism and respiratory capacity.^6
–8 Exercise endurance also dominates the physiological induction of mitochondrial biogenesis in skeletal muscles.⁹ Mitochondrial biogenesis is the process of mitochondria synthesis in the cell, characterized by an increase in relative mitochondrial DNA (mtDNA) content and mitochondrial function, owing to decreased oxygen consumption and increased adenosine triphosphate (ATP) production.¹⁰

The peroxisome proliferator-activated receptor gamma co-activator 1α (PGC-1α) is a key regulator of mitochondrial biogenesis, and it controls processes involved in energy metabolism, such as muscle fiber type switching, energy substrate transport, and fatty acid oxidation in skeletal muscles.^1,9 Two major proteins, AMP-activated protein kinase (AMPK) and sirtuin 1 (SIRT1), stimulate PGC-1α through phosphorylation and deacetylation, resulting in increased mitochondrial biogenesis and improved exercise endurance.⁴ Furthermore, peroxisome proliferator-activated receptor delta (PPARδ) activity is controlled by AMPK and SIRT1, which are key exercise-related markers, essential for exercise-induced adaptive responses.^8,11 Thus, exercise capacity can be regulated by activating mitochondrial biogenesis and upregulating the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway.

Siegesbeckia orientalis L. is widely distributed in the tropics and subtropics and has been used as a traditional Chinese medicine against rheumatic arthritis, hypertension, malaria, and inflammation. It has also been known to possess anti-allergic, anti-infertility, anti-inflammatory, anti-rheumatic, and immunosuppressive properties.^12
–14 However, there are very few studies on the effects of its extract on exercise capacity. S. orientalis contains bioactive compounds such as ent-kaurane, ent-pimarane diterpenoids, and sesquiterpenoids.¹⁵ Kirenol is the main ent-pimarane diterpenoid in S. orientalis, possessing anti-adipogenic, osteoblastogenic, and anti-photoaging activities.^15
–17 In this study, we examined the stimulatory effects of the standardized S. orientalis extract (SOE) and kirenol on exercise capacity, by observing the enhancement of mitochondrial biogenesis and the activation of the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway.

Materials and Methods

Preparation of the standardized SOE

The aerial parts of S. orientalis were purchased from Radian Inc. (Chuncheon, Korea), dried, ground (100 g), and extracted with 95% ethanol for 2 days at room temperature. Then, the extract was filtered and concentrated using a rotary evaporator (Laborata 4000 Efficient; Heidolph Instruments GmbH & Co. KG., Schwabach, Germany) to obtain the SOE with a yield of 10.81% (w/w). The identification and quantification of kirenol (molecular weight: 338.48 g/mol) (Fig. 1) in the standardized SOE was performed using high-performance liquid chromatography and calculated based on the standard curve using pure kirenol (Institute for Korea Traditional Medical Industry, Daegu, Korea). The SOE contained 1.05% (w/w) kirenol as a bioactive compound.

FIG. 1.

Chemical structure of kirenol.

Chemical reagents

Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), and horse serum were purchased from Hyclone Laboratories, Inc. (Logan, UT, USA). Protease inhibitor cocktail and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) were supplied by Sigma-Aldrich (St. Louis, MO, USA). Primary antibodies against phosphorylated AMPK (p-AMPK), total AMPK (t-AMPK), SIRT1, and α-tubulin were supplied by Cell Signaling Technology (Beverly, MA, USA). Primary antibodies against PGC-1α and PPARδ were supplied by Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

Animal experiments

Four-week-old male C57BL/6J mice (Central Lab Animals, Inc., Seoul, Korea) were maintained at 25°C ± 2°C and 55% ± 5% relative humidity with a 12 h light–dark cycle and were provided food and tap water ad libitum during the course of the experiment at the Yonsei Laboratory Animal Research Center (Seoul, Korea). After acclimatizing for 1 week, the mice were separately fed either normal diet (ND; 10% kcal fat, D12450B; Research Diets, Inc., New Brunswick, NJ, USA) or high-fat diet (HFD; 60% kcal fat, D12492; Research Diets, Inc.) for 6 weeks. Then, they were randomly assigned to the following treatment groups: (1) ND; (2) ND with SOE: 250 mg/kg/day (ND+SOE); (3) HFD; and (4) HFD with SOE: 250 mg/kg/day (HFD+SOE). SOE was administered using oral gavage for 6 weeks.

Throughout the experimental period, food intake and body weight were monitored twice per week. After killing the mice, their hindlimb skeletal muscles, including soleus and gastrocnemius muscles, were separated and stored at −70°C until further use. This study adhered to the guidelines for animal experiments that were approved by the Institutional Animal Care and Use Committee (IACUC-201401-120-01) of Yonsei University.

Exercise endurance test

Before the killing, exercise performance of each mouse was tested by assessing its running capacity, as previously described.¹⁸ A variable speed belt treadmill (Columbus Instruments, Columbus, OH, USA), enclosed in a plexiglass chamber, with a stimulus device, consisting of a shock grid attached to the rear of the belt (Panlab, Barcelona, Spain) was used to obtain measurements.

Reverse transcription–polymerase chain reaction

Total RNA from homogenized skeletal muscle tissues and L6 cells were analyzed by reverse transcription–polymerase chain reaction (RT-PCR), as previously described.¹⁸ The sequences of primer pairs used (Bioneer, Daejeon, Korea) are listed in Table 1. PCR was carried out in a Gene Amp PCR System 2700 (Applied Biosystems, Foster City, CA, USA). Gene expression was visualized and analyzed using a G:BOX EF imaging system (Syngene, Cambridge, United Kingdom) and the Gene Snap program.

Table 1.

Primer Sequences Used for Reverse Transcription–Polymerase Chain Reaction Analysis

Origin	Gene	Direction	Sequence (5′-3′)
Rat	PGC-1α	Forward	ATGTGTCGCCTTCTTGCTCT
	PGC-1α	Reverse	ATCTACTGCCTGGGGACCTT
	NRF-1	Forward	TGGACCCAAGCATTACGGAC
	NRF-1	Reverse	GGTCATTTCACCGCCCTGTA
	ERRα	Forward	GCTGGTGGTTGAACCTGAGA
	ERRα	Reverse	GGGCTAACACCCTATGCCAG
	TFAM	Forward	TCGCCTGTCAGCCTTATCTG
	TFAM	Reverse	CCGGGCTTCCTTCTCTAA C
	β-actin	Forward	TAACCAACTGGGACGATATG
	β-actin	Reverse	ATACAGGGACAGCACAGCCT
Mouse	PGC-1α	Forward	GTCCTTCCTCCATGCCTGAC
	PGC-1α	Reverse	GACTGCGGTTGTGTATGGGA
	NRF-1	Forward	CTTCATGGAGGAGCACGGAG
	NRF-1	Reverse	ATGAGGCCGTTTCCGTTTCT
	ERRα	Forward	GAGGTGGACCCTTTGCCTTT
	ERRα	Reverse	GGCTAACACCCTATGCTGGG
	TFAM	Forward	GAGCGTGCTAAAAGCACTGG
	TFAM	Reverse	CCACAGGGCTGCAATTTTCC
	β-actin	Forward	GCTCCGGCATGTGCAA
	β-actin	Reverse	AGGATCTTCATGAGGTAGT
	mtDNA	Forward	CCGCAAGGGAAAGATGAAAGAC
	mtDNA	Reverse	TCGTTTGGT TTCGGGGTTTC
	Genomic DNA	Forward	GCCAGCCTCTCCTGATTTTAGTGT
	Genomic DNA	Reverse	GGGAACACAAAAGACCTCTTCTGG

ERRα, estrogen-related receptor α; mtDNA, mitochondrial DNA; NRF-1, nuclear respiratory factor 1; PGC-1α, peroxisome proliferator-activated receptor gamma co-activator 1 alpha; TFAM, mitochondrial transcription factor A.

Western blot analysis

The molecular mechanism of the exercise-related signaling pathway was confirmed by Western blotting analysis, as previously described.¹⁸ Primary antibodies (1:1000 dilution) against p-AMPK, t-AMPK, SIRT1, PGC-1α, PPARδ, and α-tubulin were used. Protein expression levels were visualized and analyzed using a G:BOX EF imaging system (Syngene) and the Gene Snap program.

Cell culture and differentiation

COS-7 monkey kidney cells and L6 rat skeletal muscle cells (American Type Culture Collection, Manassas, VA, USA) were maintained in DMEM with 1% antibiotics (100 U/mL penicillin A and 100 μg/mL streptomycin) and 10% FBS in a humidified atmosphere of 5% CO₂ at 37°C. To stimulate differentiation of L6 cells, serum was changed to 2% horse serum. Differentiation medium containing kirenol was replaced every 2 days till day 6. Kirenol was used at various nontoxic concentrations (10, 20, and 40 μM).

Intracellular ATP content

The ATP analysis kit (Molecular Probes, Eugene, OR, USA) was used to quantify intracellular ATP in L6 cells, following the manufacturer's instructions. Luminescence intensity was detected using a MicroLumat Plus LB 96V luminometer (Berthold, Wildbad, Germany).

Luciferase reporter gene assay

PGC-1α and SIRT1 activities were assessed using the luciferase assay, by transfecting cells with the reporter plasmids, such as pGL3-PGC-1α-Luc and pTA-Luc-SIRT1 (Addgene, Cambridge, MA, USA). COS-7 cells were seeded onto a 24-well plate (4 × 10⁶ cells/plate) and incubated for 24 h. Transfection reagent, Lipofectamine (Invitrogen, Grand Island, NY, USA) was used to co-transfect the reporter plasmids into COS-7 cells. After treatment with kirenol, transcriptional activities were determined by using the luciferase assay substrate (Promega, Madison, WI, USA) and readings were obtained with a MicroLumat Plus LB 96 V luminometer (Berthold).

Quantification of mtDNA content

Skeletal muscle mtDNA content was measured using RT-PCR, as previously described.¹⁸ The primer pairs (Bioneer) are listed in Table 1. Results were calculated as the relative number of mitochondrial genomes per diploid nuclei. The ratio of mtDNA:genomic DNA was estimated by detecting the relative density of the expression of DNA.

Statistical analysis

Data are represented as mean ± standard deviation of three independent experiments (in vitro) or 5–7 mice per group (in vivo). Statistical analysis was conducted using SPSS version 21.0 (SPSS, Inc., Chicago, IL, USA). Differences between groups were analyzed using unpaired Student's t-tests for in vivo experiments and one-way analysis of variance (ANOVA) followed by a Scheffe's test for in vitro experiments. Results were considered statistically significant at a value of P < .05.

Results and Discussion

SOE enhances exercise endurance in mice

Before measuring the exercise endurance, we measured the body weight and food intake. The body weight gain and food intake in the SOE-treated ND group were not significantly different, as compared with the untreated ND group. In contrast, SOE treatment markedly reduced the body weight gain in HFD-induced obese mice without affecting food intake (Fig. 2).

FIG. 2.

Effects of SOE treatment on body weight and food intake in mice. Mice were orally administered ND, ND with SOE (250 mg/kg/day) (ND+SOE), HFD, and HFD with SOE (250 mg/kg/day) (HFD+SOE) for 6 weeks. Body weight and food intake were measured twice per week. All the data are expressed as mean ± SD (n = 7). ^## P < .01 versus ND control mice; **P < .01 versus HFD obese mice. HFD, high-fat diet; ND, normal diet; SOE, Siegesbeckia orientalis extract.

To determinate whether SOE could increase exercise endurance, a treadmill was used to measure the running distance and time of ND and HFD mice. The running distance and time of HFD mice were markedly decreased compared with those of ND mice. However, the running distance of SOE-treated HFD and ND mice was significantly different, as they were ∼2.3 and 1.2 times longer than that of HFD and ND mice, respectively (Fig. 3).

FIG. 3.

Effect of SOE treatment on exercise endurance in mice. Mice were orally administered ND, ND with SOE (250 mg/kg/day) (ND+SOE), HFD, and HFD with SOE (250 mg/kg/day) (HFD+SOE) for 6 weeks. Mice were subjected to a treadmill test. All the data are expressed as mean ± SD (n = 5). ^## P < .01 versus ND control mice; *P < .05 versus HFD obese mice. SD, standard deviation.

High fat intake causes mitochondrial dysfunction and decreases energy metabolism in the skeletal muscle.¹⁹ Impairment of energy metabolism in the skeletal muscle may be because of mitochondrial dysfunction, which is closely related to poor exercise endurance and obesity.²⁰ Mitochondrial biogenesis in the skeletal muscle is closely linked to exercise endurance and energy metabolism. In this study, SOE treatment in HFD-induced obese mice increased exercise endurance and reduced body weight, which can be attributed to its ability to stimulate mitochondrial biogenesis and improve mitochondria function in the skeletal muscle. In addition, SOE treatment enhanced exercise endurance in the ND group, suggesting that SOE can stimulate mitochondrial biogenesis under normal conditions as well.

Thus, these results suggest that SOE effectively enhances exercise endurance capacity by activating skeletal muscle mitochondrial biogenesis.

SOE upregulates mitochondrial biogenesis in the skeletal muscles of mice

The beneficial effects of exercise endurance are related to the maintenance of homeostatic energy metabolism through skeletal muscle mitochondrial biogenesis and oxidative capacity. Mitochondrial biogenesis is controlled by the activation of PGC-1α.⁶ PGC-1α mediates mtDNA replication and transcription through increased expression of mitochondrial transcription factor A (TFAM) because of the co-activation of nuclear respiratory factor 1 (NRF-1) and estrogen-related receptor α (ERRα), which are major regulators of mitochondrial biogenesis.^6,9

To ensure that the increase in exercise endurance in the SOE-treated mice is because of improvement of mitochondrial biogenesis, we evaluated the molecular mechanisms and mtDNA content in skeletal muscles. The mtDNA content in skeletal muscles was markedly increased in ND and HFD mice after SOE treatment (Fig. 4A). Mitochondrial biogenesis-related transcriptional factors such as NRF-1, ERRα, TFAM, and PGC-1α were upregulated in the skeletal muscles of SOE-treated ND and HFD mice (Fig. 4B).

FIG. 4.

Effect of SOE treatment on the expression of mitochondrial biogenesis markers in the skeletal muscles of mice. (A) mtDNA content in skeletal muscles of mice was denoted as the ratio of mtDNA and genomic DNA. (B) The mRNA expression of PGC-1α, NRF-1, ERRα, and TFAM was analyzed by RT-PCR. β-actin was used as internal control. All the data are expressed as mean ± SD (n = 5). ^## P < .01 versus ND control mice; **P < .01 versus HFD obese mice. ERRα, estrogen-related receptor α; mtDNA, mitochondrial DNA; mtDNA, mitochondrial DNA; NRF-1, nuclear respiratory factor 1; PGC-1α, peroxisome proliferator-activated receptor gamma co-activator 1 alpha; RT-PCR, reverse transcription–polymerase chain reaction; TFAM, mitochondrial transcription factor A.

The PGC-1α gene in skeletal muscle promotes mitochondrial biogenesis in response to physical performance. It indicates several hallmarks of exercise endurance-induced changes, including increases in mitochondrial function and density, and conversion of muscle fiber type toward a more oxidative form with enhanced oxidation of fat.^6,9 SOE treatment significantly upregulated the mRNA expression of PGC-1α in the skeletal muscles of ND and HFD mice, which enhanced mitochondrial biogenesis by stimulating mitochondrial regulatory genes and mtDNA content.

The stimulation of mitochondrial biogenesis-related factors can be effective in treating and delaying obesity and age-related metabolic diseases, by alleviating mitochondrial dysfunction.²¹ A previous study indicated that mtDNA content, which is a biomarker for mitochondrial density, was lower in patients with metabolic syndrome than in lean controls.²² SOE treatment inhibited HFD-induced mitochondrial dysfunction by improving mitochondrial biogenesis, which resulted in elevated exercise endurance in the HFD+SOE mice.

These results demonstrate that SOE treatment increases mtDNA content and stimulates mitochondrial biogenesis-related factors in the skeletal muscles of ND and HFD mice, suggesting its ability to mimic exercise response and enhance exercise capacity.

SOE activates the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway in the skeletal muscles of mice

AMPK phosphorylation, SIRT1 protein induction, PGC-1α deacetylation, and PPARδ protein stimulation in skeletal muscles are important participants in exercise-induced adaptive responses and mitochondrial biogenesis.^8,23 The key factors related to exercise, such as AMPK, SIRT1, PGC-1α, and PPARδ, have been observed to enhance exercise endurance without actual exercise leading to an increase in oxidative muscle fibers.²⁴

To investigate whether SOE could activate these proteins, we assessed the protein expression levels of AMPK, SIRT1, PGC-1α, and PPARδ in the skeletal muscles of mice. As given in Figure 5, SOE treatment enhanced the protein levels of p-AMPK, SIRT1, PGC-1α, and PPARδ in the skeletal muscles of ND and HFD mice, suggesting that SOE can activate the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway.

FIG. 5.

Effect of SOE treatment on the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway in skeletal muscles of mice. Total protein was isolated from skeletal muscles of mice. The protein levels of AMPK, SIRT1, PGC-1α, and PPARδ were evaluated by Western blotting. α-Tubulin was used as an internal control. All the data are expressed as mean ± SD (n = 5). ^## P < .01 versus ND control mice; **P < .01 versus HFD obese mice. AMPK, AMP-activated protein kinase; SIRT1, sirtuin 1; PGC-1α, peroxisome proliferator-activated receptor gamma co-activator 1 alpha; PPARδ, peroxisome proliferator-activated receptor delta.

AMPK and SIRT1 promote the activity of important transcriptional regulators, such as PGC-1α. These factors regulate energy expenditure and mitochondrial function in response to exercise and prevent diseases related to mitochondrial dysfunction.^7,21,25 The overexpression of active PPARδ increases oxidative muscle fibers through muscle remodeling and enhances exercise performance. The interaction between AMPK and PPARδ interaction acts as a key regulator of type I fiber specification and endurance adaptations.^24,26 SOE treatment increased the activation of PGC-1α and PPARδ in the skeletal muscles of ND and HFD mice, which was mediated by AMPK and SIRT1, resulting in enhanced mitochondrial biogenesis, increased muscle fiber type switching, and upregulation of the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway. This eventually led to a boost in exercise endurance.^7,27

In addition, the SOE-treated HFD mice had upregulated expression of exercise-related markers, which are closely associated with reduction in body weight and glucose transport stimulation through the modulation of energy expenditure, lipid accumulation, thermogenesis, and metabolic homeostasis.^28,29 Mimicking exercise and activating the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway are essential for alleviating metabolic disease, and SOE activates these exercise-related signal cascades, suggesting its potential as an exercise mimetic.

Kirenol increases mitochondrial biogenesis in L6 myotubes

Exercise endurance increases mitochondrial ATP production rates that are determined by the oxidative phosphorylation in mitochondria.²² The presence of kirenol may explain the efficacy of SOE in enhancing exercise endurance through increased mitochondrial biogenesis in skeletal muscles of mice.

To elucidate the stimulatory effect of kirenol on mitochondrial biogenesis, we measured ATP production and the underlying mechanism of mitochondrial biogenesis in L6 myotubes. Kirenol treatment elevated ATP production in a dose-dependent manner (Fig. 6A). The maximal effect was seen at 40 μM of kirenol, which increased ATP production by 76% compared with the controls. Mitochondria are crucial for the production of ATP, because they support physical activity by increasing skeletal muscle function.³⁰ Thus, kirenol stimulates mitochondrial activity by increasing ATP production, which may contribute to enhancing exercise endurance in the SOE-treated mice.

FIG. 6.

Effect of kirenol treatment on mitochondrial biogenesis in L6 myotubes. The cells were cultured in differentiation media with different concentrations of kirenol for 6 days. (A) Intercellular ATP content. (B) The mRNA expression of PGC-1α, NRF-1, ERRα, and TFAM was analyzed by RT-PCR. β-actin was used as an internal control. All the data are expressed as mean ± SD (% control) of three independent experiments. *P < .05 and **P < .01 versus control cells. ATP, adenosine triphosphate.

Kirenol treatment was also effective in stimulating the mRNA expression of PGC-1α, which in turn activated mitochondrial transcription factors, such as NRF-1, ERRα, and TFAM (Fig. 6B). Thus, kirenol promotes mitochondrial biogenesis by increasing the mRNA expression of mitochondrial transcription factors that mediate mitochondrial function. These results confirm that mitochondrial biogenesis is enhanced in the skeletal muscles of SOE-treated mice.

Studies show that several natural active compounds, such as resveratrol and chitooligosaccharides, increase exercise endurance by stimulating mitochondrial biogenesis.^7,8 Likewise, kirenol can enhance exercise endurance by promoting mitochondrial biogenesis. The stimulatory effect of kirenol on mitochondrial biogenesis may contribute to the increased physical activity of SOE-treated mice.

Kirenol stimulates the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway in L6 myotubes

Exercise-related markers, such as AMPK, SIRT1, PGC-1α, and PPARδ are activated during exercise and play a critical role in exercise-induced adaptive responses.^8,11 Kirenol treatment stimulated protein expression of p-AMPK, SIRT1, PGC-1α, and PPARδ in L6 myotubes (Fig. 7A). Kirenol treatment also significantly activated SIRT1 and PGC-1α in a dose-dependent manner (Fig. 7, C). Kirenol treatment increased SIRT1 and PGC-1α activation by 50% and 79%, respectively, compared with the controls. PGC-1α activity is regulated by AMPK and SIRT1, which control energy expenditure and mitochondrial biogenesis in response to exercise.^7,25 Kirenol activated the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway, which led to improved mitochondrial biogenesis through PGC-1α activation in L6 myotubes. These results indicate that kirenol directly activates the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway by increasing SIRT1 and PGC-1α activation.

FIG. 7.

Effect of kirenol treatment on the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway in L6 myotubes. The cells were cultured in differentiation media with different concentrations of kirenol for 6 days. (A) The protein levels of the AMPK, SIRT1, PGC-1α, and PPARδ in L6 myotubes were evaluated by Western blotting. The cells were transfected with each reporter plasmid and then treated with various concentrations of kirenol. (B) Binding activity of SIRT1 in COS-7 cells. (C) Binding activity of PGC-1α in COS-7 cells. α-Tubulin was used as an internal control. All the data are expressed as mean ± SD (% control) of three independent experiments. **P < .01 versus control cells.

To the best of our knowledge, this is the first study to report the significant effect of standardized SOE on running distance and time, by stimulating mitochondrial regulatory genes and effectively upregulating the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway in the skeletal muscles of ND and HFD mice. Furthermore, kirenol, a major bioactive constituent of SOE, increased ATP production and mitochondrial activity by upregulating the expression of biomarkers of mitochondrial biogenesis and by activating the AMPK/SIRT1/PGC-1α/PPARδ signaling pathway in L6 myotubes. These results suggest that SOE and kirenol can be potentially effective nutraceutical candidates for enhancing exercise capacity.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

Funding Information

No funding was received for this article.

References

Kim

, Yoo

, Chae

, Jung

, Choi

: Omija fruit extract improves endurance and energy metabolism by upregulating PGC-1α expression in the skeletal muscle of exercised rats. J Med Food, 2014; 17:28–35.

Pratt

, Norris

, Lobelo

, Roux

, Wang

: The cost of physical inactivity: Moving into the 21st century. Br J Sports Med, 2014; 48:171–173.

Booth

, Roberts

, Laye

: Lack of exercise is a major cause of chronic diseases. Compr Physiol, 2012; 2:1143–1211.

Higashida

, Kim

, Jung

, Asaka

, Holloszy

, Han

: Effects of resveratrol and SIRT1 on PGC-1α activity and mitochondrial biogenesis: A reevaluation. PLoS Biol, 2013; 11:e1001603.

Alkerwi

, Schuh

, Sauvageot

, et al.: Adherence to physical activity recommendations and its associated factors: An interregional population-based study. J Public Health Res, 2015; 4:406.

Safdar

, Little

, Stokl

, Hettinga

, Akhtar

, Tarnopolsky

: Exercise increases mitochondrial PGC-1α content and promotes nuclear-mitochondrial cross-talk to coordinate mitochondrial biogenesis. J Biol Chem, 2011:286:10605–10617.

Jeong

, Cho

, Kim

, et al.: Chitooligosaccharide induces mitochondrial biogenesis and increases exercise endurance through the activation of Sirt1 and AMPK in rats. PLoS One, 2012; 7:e40073.

Hart

, Sarga

, Csende

, et al.: Resveratrol enhances exercise training responses in rats selectively bred for high running performance. Food Chem Toxicol, 2013; 61:53–59.

Rowe

, El-Khoury

, Patten

, Rustin

, Arany

: PGC-1α is dispensable for exercise-induced mitochondrial biogenesis in skeletal muscle. PLoS One, 2012; 7:e41817.

10.

Sun

, Qi

, He

, et al.: The effect of treadmill training and N-acetyl-L-cysteine intervention on biogenesis of cytochrome c oxidase (COX). Free Radic Biol Med, 2015; 87:326–335.

11.

Matsakas

, Narkar

: Endurance exercise mimetics in skeletal muscle. Curr Sports Med Rep, 2010; 9:227–232.

12.

Wang

, Hu

: Chemical constituents of Siegesbeckia orientalis L. J Integr Plant Biol, 2006; 48:991–995.

13.

Sun

, Wang

: Immunosuppressive activity of the ethanol extract of Siegesbeckia orientalis on the immune responses to ovalbumin in mice. Chem Biodivers, 2006; 3:754–761.

14.

Mun

: Anti-photoaging effects of Siegesbeckia orientalis L. extract on UVB-induced skin damage in human skin fibroblasts and hairless mice [MS thesis]. Yonsei University, Seoul, Korea, 2012.

15.

Kim

, Song

, Kim

, Hwang

: Kirenol inhibits adipogenesis through activation of the Wnt/β-catenin signaling pathway in 3T3-L1 adipocytes. Biochem Biophys Res Commun, 2014; 445:433–438.

16.

Kim

, Song

, Hwang

: Kirenol stimulates osteoblast differentiation through activation of the BMP and Wnt/β-catenin signaling pathways in MC3T3-E1 cells. Fitoterapia, 2014; 98:59–65.

17.

Kim

, Kim

, Yun

, Hwang

: Protective effects of standardized Siegesbeckia glabrescens extract and its active compound kirenol against UVB-induced photoaging through inhibition of MAPK/NF-κB pathways. J Microbiol Biotechnol, 2017; 27:242–250.

18.

Kim

, Kim

, Jung

, Hwang

: Standardized Boesenbergia pandurata extract stimulates exercise endurance through increasing mitochondrial biogenesis. J Med Food, 2016; 19:692–700.

19.

Gomes

, Duarte

, Nunes

, et al.: Berberine protects against high fat diet-induced dysfunction in muscle mitochondria by inducing SIRT1-dependent mitochondrial biogenesis. Biochim Biophys Acta, 2012; 1822:185–195.

20.

Vázquez-Medina

, Popovich

, Thorwald

, et al.: Angiotensin receptor-mediated oxidative stress is associated with impaired cardiac redox signaling and mitochondrial function in insulin-resistant rats. Am J Physiol Heart Circ Physiol, 2013; 305:H599–H607.

21.

Price

, Gomes

, Ling

, et al.: SIRT1 is required for AMPK activation and the beneficial effects of resveratrol on mitochondrial function. Cell Metab, 12; 15:675–690.

22.

Hoeks

, Schrauwen

: Muscle mitochondria and insulin resistance: A human perspective. Trends Endocrinol Metab, 2012; 23:444–450.

23.

, Mühlfeld

, Niemann

, et al.: Mitochondrial biogenesis and PGC-1α deacetylation by chronic treadmill exercise: Differential response in cardiac and skeletal muscle. Basic Res Cardiol, 2011; 106:1221–1234.

24.

Narkar

, Downes

, Ruth

, et al.: AMPK and PPARδ agonists are exercise mimetics. Cell, 2008; 134:405–415.

25.

Cantó

, Auwerx

: PGC-1alpha, SIRT1 and AMPK, an energy sensing network that controls energy expenditure. Curr Opin Lipidol, 2009; 20:98–105.

26.

Barish

, Narkar

, Evans

: PPARδ: A dagger in the heart of the metabolic syndrome. J Clin Invest, 2006; 116:590–597.

27.

Smith

, Mukai

, Lally

, et al.: AMP-activated protein kinase is required for exercise-induced peroxisome proliferator-activated receptor γ co-activator 1α translocation to subsarcolemmal mitochondria in skeletal muscle. J Physiol, 2013; 591:1551–1561.

28.

Summermatter

, Handschin

: PGC-1α and exercise in the control of body weight. Int J Obes, 2012; 36:1428–1435

29.

Carey

, Kingwell

: Novel pharmacological approaches to combat obesity and insulin resistance: Targeting skeletal muscle with ‘exercise mimetics'. Diabetologia. 2009; 52:2015–2026.

30.

Russell

, Foletta

, Snow

, Wadley

: Skeletal muscle mitochondria: A major player in exercise, health and disease. Biochim Biophys Acta, 2014; 1840:1276–1284.