Chrysanthemum coronarium L. Extract Attenuates Homocysteine-Induced Vascular Inflammation in Vascular Smooth Muscle Cells

Abstract

Hyperhomocysteinemia is a main risk factor for phenotypic modulation of vascular smooth muscle cells (VSMCs) and atherosclerosis. Phenotypic switching and proliferation of VSMCs are related to the progression of vascular inflammation. Chrysanthemum coronarium L. is a leafy vegetable with various biological functions, such as antioxidative, anti-inflammatory, and antiproliferative effects. In this study, we aimed to identify the mechanisms underlying the therapeutic and preventive effects of C. coronarium L. extract (CC) in regulating homocysteine (Hcy)-induced vascular inflammation in human aortic VSMCs. CC did not exhibit cytotoxicity and inhibited Hcy-stimulated VSMC proliferation and migration. In addition, CC promoted Hcy-induced expression of VSMC contractile phenotype proteins, including alpha-smooth muscle actin, calponin, and smooth muscle 22α. CC also decreased Hcy-induced accumulation of reactive oxygen species and expression of inflammatory markers nicotinamide adenine dinucleotide phosphate oxidase-4 and soluble epoxide hydrolase. These results showed that CC attenuates Hcy-induced inflammatory responses, highlighting its potential as a therapeutic or preventive target for Hcy-induced vascular inflammation.

INTRODUCTION

Atherosclerosis (AS) is a slow progressive cardiovascular disease correlated with high mortality rates worldwide.¹ Vascular smooth muscle cells (VSMCs) are related involved in AS pathophysiology.² In inflammatory stimuli or oxidative stress conditions, VSMCs can change to a de-differentiated, proliferative, and migratory phenotype, that is, a contractile to synthetic shift, by suppressing their contractility, thereby promoting proliferation and migration.^3,4 This phenotype switching is associated with excessive proliferation and migration of VSMCs, which is a major factor in the pathological process of AS.^5,6 Although increasing evidence has revealed the phenotypic modulation of VSMCs, the mechanisms underlying this phenotypic transition and its modulation in AS are unknown.

Homocysteine (Hcy) is an amino acid metabolite produced from methionine. Hyperhomocysteinemia (HHcy) is defined as an elevated blood Hcy concentration exceeding 15 μmol/L. For every 5 μmol/L increment in blood Hcy concentrations, there is an independent risk of a 500 μmol/L increase in cholesterol levels, and the cardiovascular disease risk is increased by ∼1/3.⁷ Therefore, HHcy is a high-risk factor for AS.⁸ Moreover, VSMCs are the major cells of the artery and are converted to foam cells in AS plaques.

Accumulating evidence shows that Hcy-induced oxidative stress, endothelial dysfunction, and VSMC migration and proliferation are associated with the progression of AS.^9
–11 Moreover, HHcy increases VSMC phenotype modulation by increasing VSMC proliferation and inflammation, ultimately promoting the development of AS.⁴ Therefore, given their role in the development of AS, understanding the molecular mechanisms underlying Hcy-stimulated VSMC conversion is important. Although a few strategies have been shown to suppress VSMC proliferation, migration, and phenotype conversion in AS, no effective therapy has been established yet.

Glebionis coronaria (Chrysanthemum coronarium L., crown daisy), called “ssukgat” in Korea, is an annual herbaceous weed widely distributed in the Mediterranean region. It is a valuable vegetable and a medicinal and ornamental plant. C. coronarium L. extract (CC) has various biological functions, including antioxidative, antihypercholesterolemic, and antihyperglycemic activities.^12
–14 CC also exhibits anti-inflammatory and antiproliferative activities in vitro. ^12,15

We have previously found that CC has preventive properties on osteoporotic bone loss.¹⁶ However, the mechanisms underlying Hcy-mediated suppression of VSMC proliferation, migration, and phenotype modulation remain unexplored. In this study, we hypothesized that CC exhibits inhibitory effects on Hcy-induced vascular inflammation and discuss the underlying mechanisms.

MATERIALS AND METHODS

Chemicals and reagents

Human aortic VSMCs (HA-VSMCs) and Dulbecco's modified Eagle's medium (DMEM) were provided from ATCC (Manassas, VA, USA). Fetal bovine serum (FBS), penicillin, streptomycin, bicinchoninic acid (BCA) assay kit, and CellROX^® Deep Red Oxidative Stress reagent were provided from Gibco (Thermo Fisher Scientific, Waltham, MA, USA). Hcy, 2′,7′-dichlorofluorescein diacetate (DCFH-DA), and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solutions were obtained from Sigma-Aldrich (St. Louis, MO, USA).

Bromodeoxyuridine (BrdU) was provided from Millipore (Burlington, MA, USA). A transwell chamber assay (8 μm pore size) was purchased from Costar (Corning, Inc., Corning, NY, USA). Radioimmunoprecipitation assay (RIPA) buffer was obtained from Beyotime (Los Altos, CA, USA). Anti-α-smooth muscle actin (α-SMA), anti-calponin, anti-smooth muscle-α, and reactive oxygen species (ROS) assay kits were provided from Abcam (Cambridge, UK).

Intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule (VCAM)-1 were provided from Santa Cruz Biotechnology (Dallas, TX, USA). Nicotinamide adenine dinucleotide phosphate oxidase-4 (Nox4) was obtained from OriGene (Rockville, MD, USA). Soluble epoxide hydrolase (sEH) was provided by Cayman (Ann Arbor, MI, USA). β-actin and secondary antibodies were purchased by Cell Signaling Technology (Danvers, MA, USA).

Preparation of CC

The air-dried plants (1 kg, traditional Korean market, Jeonju) were washed and extracted once with 9 volumes of 50% ethanol for 24 h. CC was filtered and evaporated by freeze-drying at −70°C. The recovery yield was ∼8% (w/w).

Cell culture and cell viability

HA-VSMCs were maintained in DMEM with 10% FBS at 37°C in a 5% CO₂. Cells were seeded at 3000 per well of a 96-well plate and pretreated with several CC concentrations (10, 25, 50, and 100 μg/mL) for 24 h. MTT solution (0.5 mg/mL) was added to VSMCs for 2 h and the signal was quantified in absorbance at 450 nm using a microplate reader (Molecular Devices, San Jose, CA, USA).

Cell proliferation

The BrdU cell proliferation assay was used to detect VSMC proliferation. VSMCs were seeded in 96-well plates and pretreated with the indicated CC d (10, 25, and 50 μg/mL) with or without Hcy for 24 h. The BrdU assay was estimated following the manufacturer's protocols to analyze the cell proliferation.

Scratch wound-healing assay

VSMCs were seeded at 300,000 per well of a six-well plate. Next, cells scratched with a 200 μm sterile tip and VSMCs were incubated with the indicated CC concentrations with or without Hcy. Photographs were taken using a microscope (Leica, Wetzlar, Germany) at 0 and 24 h. The wound healing was measured based on the wound area at 24 h compared with 0 h.

Transwell migration assay

For the transwell migration assay, VSMCs were cultured in the upper surface of the membrane with 8 μm-pore membranes (Corning) and incubated with several CC concentrations with or without Hcy for 24 h. VSMCs that moved to the lower surface were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The migrated VSMCs was analyzed under a light microscope. The mean was calculated from five random visual fields.

ROS measurement

To assess intracellular ROS generation, VSMCs were maintained with several CC concentrations and Hcy for 24 h. VSMCs were treated with 10 μM DCFH-DA at 37°C in the dark for 30 min. The fluorescence signals were detected using a fluorescence reader (Molecular Devices). Images were taken with a fluorescence microscope (Olympus Corporation, Tokyo, Japan). In addition, after incubation with the CC with or without Hcy for 24 h, HA-VSMCs were maintained with CellROX Deep Red Oxidative Stress reagent for 30 min. Cells were then washed and fluorescence signals were analyzed at 640/665 nm with a microplate reader (Molecular Devices).

Immunoblotting

Total protein was extracted from lysed cells in RIPA buffer. We measured the concentration of protein using a BCA assay. Proteins were separated by sodium dodecyl-sulfate polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membranes. Blots were immunoprobed with specific primary antibodies against anti-α-SMA, anti-calponin, anti-SM22-α, anti-ICAM-1, anti-VCAM-1, anti-Nox4, anti-sEH, and anti-β-actin overnight. The blots were then probed with horseradish peroxidase-conjugated secondary antibodies. Signals were analyzed using the ChemiDoc™ Imaging System (Bio-Rad Laboratories, Hercules, CA, USA). Densities of specific bands were estimated using Image J software.

Quantitative reverse-transcription polymerase chain reaction

Total RNA was extracted from VSMCs using TRIzol reagent and converted to cDNA. Quantitative reverse-transcription PCR (qRT-PCR) was performed using 2 × Taq polymerase chain reaction MasterMix and the iTaq universal SYBR Green I Supermix (Bio-Rad Laboratories). The thermal cycling conditions were as follows: initial denaturation at 95°C for 3 min, followed by 39 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C. The melting curve was acquired by increasing the temperature from 65°C to 95°C with a temperature transition rate of 0.1°C/s using the Bio-Rad RT-QPCR software. The internal reference gene was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The specific primers used are provided in Table 1.

Table 1.

List of Primers Used in the Study

Gene	Primer sequence (5′-3′)
TNF-α	F: GTGCTTGTTCCTCAGCCTCT
TNF-α	R: ATGGGCTACAGGCTTGTCAC
IL-1β	F: TGAGCTCGCCAGTGAAATGAT
IL-1β	R: TCCATGGCCACAACAACTGA
IL-6	F: TGAGAGTAGTGAGGAACAAG
IL-6	R: CGCAGAATGAGATGAGTTG
MCP-1	F:AGCAGCAAGTGTCCCAAAGA
MCP-1	R:TTTGCTTGTCCAGGTGGTCC
GAPDH	F: AAATGGTGAAGGTCGGTGTG
GAPDH	R: TGAAGGGGTCGTTGATGG

GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL, interleukin; MCP-1, monocyte chemoattractant protein-1; TNF-α, tumor necrosis factor-alpha.

Statistical analysis

Data are shown as the means ± standard deviation. Statistical analysis was determined using GraphPad Prism software version 10.0 (GraphPad, Inc., La Jolla, CA, USA). Statistical differences were determined using one-way analysis of variance. P < .05 was regarded as significant.

RESULTS

CC inhibits Hcy-induced VSMC proliferation

To evaluate the cytotoxic effect of CC on VSMCs, we assessed the cell viability after treatment with various CC concentrations using the MTT assay. Compared with control cells, treatment with the CC (10, 25, 50, and 100 μg/mL) for 24 h did not show cytotoxicity in HA-VSMCs (Fig. 1A). Moreover, the effect of the CC on VSMC proliferation was assessed using the BrdU assay; HA-VSMCs were pretreated with the CC at different dosages (10, 25, and 50 μg/mL) and then with Hcy. We found that Hcy significantly induced VSMC proliferation. However, CC suppressed Hcy-induced VSMC proliferation in a concentration-dependent manner (Fig. 1B).

FIG. 1.

CC inhibits Hcy-induced VSMC proliferation. Cells were pretreated with CC at different concentrations (10, 25, and 50 μg/mL) for 30 min and then with Hcy for 24 h. (A) MTT assay was performed to determine cell viability. (B) BrdU assay was performed to assess cell proliferation. All data are represented as mean ± SD (n = 3). ****P < .0001 versus control groups. ^### P < .001 and ^#### P < .0001 versus Hcy groups. BrdU, bromodeoxyuridine; CC, Chrysanthemum coronarium L. extract; Hcy, homocysteine; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; SD, standard deviation; VSMC, vascular smooth muscle cell.

CC inhibits the Hcy-induced VSMC migration

To evaluate the effect of CC on VSMC migration, HA-VSMCs were incubated with the CC (10, 25, and 50 μg/mL) and then with Hcy. Wound-healing and transwell assays were performed. Our results showed that Hcy significantly promoted VSMC migration. Although treatment with 10 μg/mL of CC did not inhibit VSMC migration, 25 and 50 μg/mL CC inhibited migration in a dosage-dependent manner (Fig. 2). These findings show that the CC suppresses Hcy-induced VSMC migration.

FIG. 2.

CC inhibits Hcy-induced VSMC migration. Cells were pretreated with CC at different concentrations (10, 25, and 50 μg/mL) for 30 min and then with Hcy for 24 h. (A) Wound healing assay was performed to assess the migration of VSMCs at 0 and 24 h (scale bar = 500 μm). (B) Transwell assay was performed to examine VSMC migration (scale bar = 200 μm). (C) Quantitative analysis of the migration rate. (D) Quantitative analysis of migrating cells. All data are shown as mean ± SD (n = 3). ****P < .0001 versus control groups. ^# P < .05, and ^#### P < .0001 versus Hcy groups.

CC abrogates Hcy-induced expression of VSMC contractile markers

To identify the effect of the CC on VSMC differentiation, VSMCs were pretreated with the CC (10, 25, and 50 μg/mL) and then with Hcy, and the levels of contractile phenotype proteins, including α-SMA, smooth muscle 22α (SM22α), and calponin, were assessed. Hcy-triggered VSMC phenotype modulation from a differentiated to a de-differentiated condition, shown by decreased α-SMA, calponin, and SM22-α expression, whereas these effects were reversed by the CC (Fig. 3). These findings indicate that the CC ameliorates Hcy-stimulated VSMC differentiation.

FIG. 3.

CC abrogates Hcy-induced VSMC differentiation. The cells were pretreated with the CC at different concentrations (10, 25, and 50 μg/mL) for 30 min and then with Hcy for 24 h. (A) Western blotting of the expression of the VSMC contractile phenotype marker proteins α-SMA, calponin, and SM22-α. (B) Representative western blots for α-SMA, calponin, and SM22-α expression. The relative expression was normalized to that of β-actin. All data are shown as the mean ± SD (n = 3). *P < .05, **P < .01 versus control groups. ^# P < .05, and ^## P < .01 versus Hcy groups. α-SMA, alpha-smooth muscle actin.

CC decreases Hcy-induced ROS production

To assess the effect of the CC on ROS production, HA-VSMCs were incubated with the CC (10, 25, and 50 μg/mL) and then with Hcy, and ROS levels were assessed using DCFH-DA staining and CellROX Deep Red Oxidative Stress reagent. Hcy-treated cells exhibited significantly higher levels of DCFH-DA fluorescence (P < .001) and CellROX Deep Red Oxidative Stress staining (P < .001) compared with control cells. However, CC significantly reduced Hcy-stimulated ROS production in a dosage-dependent manner (Fig. 4). Our findings show that the CC suppressed Hcy-induced ROS production.

FIG. 4.

CC decreases Hcy-induced ROS production. Cells were pretreated with the CC at different concentrations (10, 25, and 50 μg/mL) for 30 min and then with Hcy for 24 h. (A) DCFH-DA staining was performed to assess ROS production (scale bar = 200 μm). (B) Quantification of DCFH-DA fluorescence in the control cells. (C) CellRox deep red oxidative stress assay was performed to assess ROS production. Data are shown as the mean ± SD (n = 3). ****P < .0001 versus control groups. ^# P < .05, ^## P < .01, and ^#### P < .0001 versus Hcy groups. DCFH-DA, 2′,7′-dichlorofluorescein diacetate; ROS, reactive oxygen species.

CC inhibits Hcy-stimulated inflammation and Nox4 and sEH expression

To assess the effects of the CC on Hcy-stimulated inflammation and Nox4 and sEH expression, HA-VSMCs were pretreated with the CC (10, 25, and 50 μg/mL) and then with Hcy. We analyzed the protein levels of Nox4, sEH, ICAM-1, and VCAM-1 by immune blotting and the mRNA levels of tumor necrosis factor (TNF)-α, interleukin (IL)-6, IL-1β, and monocyte chemoattractant protein-1 (MCP-1) using quantitative reverse-transcription polymerase chain reaction. Hcy significantly increased Nox4, sEH, ICAM-1, and VCAM-1 protein levels, as well as TNF-α, IL-6, IL-1β, and MCP-1 mRNA levels. However, these effects were markedly suppressed by the CC (Fig. 5). These findings show that the CC inhibits Nox4 and sEH expressions and vascular inflammation.

FIG. 5.

CC reduces Hcy-induced inflammation in VSMCs. Cells were pretreated with CC at different concentrations (10, 25, and 50 μg/mL) for 30 min and then with Hcy for 24 h. (A) Western blotting was performed to assess the relative expression of the inflammatory proteins Nox4 and sEH. (B) Representative western blotting images of Nox4 and sEH. (C) Western blotting of the relative expression of the inflammatory proteins ICAM-1 and VCAM-1. (D) Representative western blotting images of ICAM-1 and VCAM-1. The relative expression was normalized to that of β-actin. (E) Real-time PCR was performed to determine the expression of TNF-α, IL-16, IL-1β, and MCP-1. The relative expression was normalized to that of GAPDH. All data are shown as the mean ± SD (n = 3). *P < .05, **P < .01, ***P < .001, and ****P < .0001 versus control groups. ^# P < .05, ^## P < .01, ^### P < .001, and ^#### P < .0001 versus Hcy group. n = 3. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ICAM-1, intercellular adhesion molecule-1; IL, interleukin; MCP-1, monocyte chemoattractant protein-1; Nox4, nicotinamide adenine dinucleotide phosphate oxidase-4; PCR, polymerase chain reaction; sEH, soluble epoxide hydrolase; TNF-α, tumor necrosis factor-alpha; VCAM-1, vascular cell adhesion molecule-1.

DISCUSSION

AS is a slow progressive vascular disease of the arteries. There is abundant evidence that abnormal VSMC proliferation and migration are pathological events that mediate AS development^17
–19 and that the phenotypic transition of VSMCs is a requirement for their proliferation and migration.^10,20 Moreover, HHcy induces phenotypic switching of VSMCs.²¹ Ji et al.²² reported that liraglutide attenuates Hcy-triggered VSMC proliferation, migration, and phenotypic conversion in vitro. Furthermore, artemisinin attenuates the progression of AS by regulating the phenotypic change of VSMCs.²³

Thus, in this study, we focused on the suppression of VSMC phenotypic transition as a potential pharmacological target for AS in vitro. We have recently shown that 1-trifluoromethoxyphenyl-3-(1-propionylpiperidin-4-yl) urea (TPPU) attenuates the progression of vascular inflammation by inhibiting VSMC phenotypic switching in vitro and in vivo.²⁴ In this study, our findings suggested that the CC affected Hcy-induced proliferation, migration, and de-differentiation in HA-VSMCs, suggesting that the CC attenuates the progress of vascular inflammation by modulating VSMC phenotype conversion.

Increasing evidence indicates that AS is most commonly caused by Hcy²⁵; HHcy triggers the initial development of AS^26,27 and can stimulate VSMC proliferation and migration, which promotes VSMC inflammation.²⁸ Moreover, HHcy promotes phenotypic transition. Physiologically, mature VSMCs have a contractile phenotype, which is expressed by high levels of contractile markers α-SMA, SM22α, and calponin.

However, Hcy stimulates contractile VSMCs to switch to a synthetic type.^29,30 Similarly, we have previously found that HHcy promotes VSMC phenotypic transition.²⁴ Our findings showed that Hcy increased VSMC proliferation and migration and reduced the levels of contractile proteins, such as α-SMA, calponin, and SM22-α, whereas CC supplementation normalized these parameters.

Moreover, Liu et al.⁹ suggested that Hcy stimulates vascular inflammation and increases ICAM-1 and VCAM-1 expression in VSMCs and mouse aorta. In our study, the CC inhibited Hcy-stimulated adhesion molecules, such as ICAM-1 and VCAM, and the mRNA expression of inflammatory markers, such as TNF-α, IL-6, IL-1β, and MCP-1, in VSMCs. Therefore, our findings indicate that the effects of CC may be related to the suppression of vascular inflammation.

ROS plays a role in promoting inflammation. NOX are the main factors of ROS, among which Nox4 is required for the phenotypic switching of VSMCs.^29,30 Moreover, epoxyeicosatrienoic acids (EETs) have protective effects against vascular diseases, and sEH, which metabolizes EETs to less active diols, is associated with VSMC phenotype modulation.²⁴ Therefore, several lines of evidence show that sEH inhibition can suppress the progression of vascular inflammation in vivo and VSMCs.

In addition, Hcy stimulates oxidative stress in VSMCs; Hcy-induced intercellular ROS is mediated by modulating the proliferation, migration, and phenotype switching of VSMCs and is associated with vascular inflammation. Liu et al.⁹ have reported total ROS and H₂O₂ production in Hcy-treated VSMCs, showing that ROS neutralization can abolish the effects of Hcy on VSMCs. Among ROS factors, Hcy has been known to modulate p47phox, Nox1, Nox2, and Nox4 in VSMCs. Nox4 is the main NADPH oxidase in VSMCs.^9,31

Notably, TPPU, an sEH inhibitor, can suppress Hcy-induced vascular inflammation through the Nox4 pathway.²⁴ Hcy also increases sEH expression, and Hcy-induced sEH regulates Nox-4-mediated ROS production, indicating that sEH and Nox4 are partially associated with Hcy-induced inflammation in VSMCs.^9,29,30 Therefore, several studies have focused on inhibiting sEH and/or Nox4 to protect against vascular inflammation.^32,33 In this study, these findings suggested that the CC inhibited Hcy-induced ROS production and sEH and Nox4 expression in VSMCs, suggesting that the CC might attenuate vascular inflammation by regulating Nox4 and sEH expression.

Epidemiological evidence has indicated that the intake of vegetables, plants, or their derived flavonoids delays the development of AS.¹² CC contains caffeic and chlorogenic acids,¹⁵ and in our previous study we showed that CC contains rutin, cynarin, 3,4-dicaffeoylquinic acid, and 3,5-dicaffeoyl-4-succinoyl quinic acid.¹⁶ Rutin possess several functional effects, such as anti-inflammatory and antioxidative properties, and inhibits premature senescence, proliferation, and migration of VSMCs and in AS in vivo.^34,35 Caffeic acid has beneficial activities, including antioxidant and anti-inflammatory effects, and inhibits VSMC proliferation.^36,37 Chlorogenic acid has antioxidant, cardioprotective, and anti-inflammatory effects.³⁸

Furthermore, 3,4-dicaffeoylquinic acid reduces VSMC proliferation and migration.³⁹ Therefore, we investigated if the CC, which contains various bioactive compounds, would possess a suppressive activity on Hcy-stimulated inflammation in VSMCs. Herein, treatment with CC suppressed VSMC proliferation, migration, and phenotypic modulation during Hcy-induced inflammation, suggesting that the CC may exert a potential therapeutic effect for vascular inflammation-associated AS.

There are some limiting factors in this study. First, this study did not determine the effect of the CC on VSMC proliferation, migration, and phenotype switching in vivo. Second, this study did not define the preventive effects of several CC-derived compounds. Third, further studies will be required to investigate the mechanistic differences in the effects of the CC and CC-derived components.

In conclusion, our findings revealed that the CC inhibited Hcy-induced VSMC proliferation, migration, and phenotypic conversion in vitro, suggesting its potential as a therapeutic strategy for vascular inflammation-associated AS.

Footnotes

AUTHORs' CONTRIBUTIONS

Conceptualization, writing—review and editing, and funding acquisition by M.J.S. Methodology and writing—original draft by Y.K. and M.J.S. Investigation by A.S.L. and Y.K. Visualization by H.J.H. and S.H.L. Software by H.J.H.

AUTHOR DISCLOSURE STATEMENT

No competing financial interests exist.

FUNDING INFORMATION

This study was supported by a grant from the Korea Food Research Institute (E0210102-03).

References

Weber

, von Hundelshausen

. CANTOS trial validates the inflammatory pathogenesis of atherosclerosis: Setting the stage for a new chapter in therapeutic targeting. Cir Res, 2017; 121(10):1119–1121; doi: 10.1161/CIRCRESAHA.117.311984

Lacolley

, Regnault

, Nicoletti

, et al. The vascular smooth muscle cell in arterial pathology: A cell that can take on multiple roles. Cardiovasc Res, 2012; 95(2):194–204; doi: 10.1093/cvr/cvs135

Gao

, Xu

, Zhang

, et al. Salusin-α inhibits proliferation and migration of vascular smooth muscle cell via Akt/mTOR signaling. Cell Physiol Biochem, 2018; 50(5):1740–1753; doi: 10.1159/000494792

Lin

, Ni

, Zhang

, et al. Knockdown of Herp alleviates hyperhomocysteinemia mediated atherosclerosis through the inhibition of vascular smooth muscle cell phenotype switching. Int J Cardiol, 2018; 269:242–249; doi: 10.1016/j.ijcard.2018.07.043

Torella

, Iaconetti

, Tarallo

, et al. miRNA regulation of the hyperproliferative phenotype of vascular smooth muscle cells in diabetes. Diabetes, 2018; 67(12):2554–2568; doi: 10.2337/db17-1434

Chistiakov

, Orekhov

, Bobryshev

. Vascular smooth muscle cell in atherosclerosis. Acta Physiol, 2015; 214(1):33–50; doi: 10.1111/apha.12466

Zhang

. Mechanisms of VSMC proliferation, migration, and phenotypic transformation in homocysteine-induced atherosclerosis: A review. Am J Biomed Sci, 2023; 19:98–103; doi: 10.3429/7/AJBSR.2023.19.002554

Mujumdar

, Tummalapalli

, Aru

, et al. Mechanism of constrictive vascular remodeling by homocysteine: Role of PPAR. Am J Physiol Cell Physiol, 2002; 282(5):C1009–C1015; doi: 10.1152/ajpcell.00353.2001

Liu

, Qin

, Liu

, et al. Nox4 and soluble epoxide hydrolase synergistically mediate homocysteine-induced inflammation in vascular smooth muscle cells. Vascul Pharmacol, 2019; 120:106544; doi: 10.1016/j.vph.2019.01.001

10.

Jiang

, Zhang

, et al. Homocysteine promotes vascular smooth muscle cell migration by induction of the adipokine resistin. Am J Physiol Cell Physiol, 2009; 297(6):C1466–C1476; doi: 10.1152/ajpcell.00304.2009

11.

Guo

, Zhang

, Yang

, et al. Homocysteine accelerates atherosclerosis by inhibiting scavenger receptor class B member1 via DNMT3b/SP1 pathway. J Mol Cell Cardiol, 2020; 138:34–48; doi: 10.1016/j.yjmcc.2019.11.145

12.

Kim

, Lee

, Kim

, et al. Comparison of physicochemical properties and antioxidant activity between raw and heat-treated vegetables. Korean J Commun Living Sci, 2014; 25(1):5–18; doi: 10.1100/2/kjfp.2022.29.6.873

13.

M. Donia AER. Biological activity of Chrysanthemum coronarium L. extracts. Annu Res Rev Biol, 2014; 4(16):2617–2627; doi: 10.9734/ARRB/2014/10112

14.

Abd-Alla

, Albalawy

, Aly

, et al. Flavone composition and antihypercholesterolemic and antihyperglycemic activities of Chrysanthemum coronarium L. Zeitschrift für Naturforschung C, 2014; 69(5–6):199–208; doi: 10.5560/znc.2013-0115

15.

Takenaka

, Nagata

, Yoshida

. Stability and bioavailability of antioxidants in garland (Chrysanthemum coronarium L.). Biosci Biotechnol Biochem, 2000; 64(12):2689–2691; doi: 10.1271/bbb.64.2689

16.

Kim

, Lee

, Hur

, et al. Preventive effects of Chrysanthemum coronarium L. extract on bone metabolism in vitro and in vivo. Evid Based Complement Alternat Med, 2020; 2020:6975646; doi: 10.1155/2020/6975646

17.

Zhang

, Xie

, Chen

, et al. Homocysteine upregulates soluble epoxide hydrolase in vascular endothelium in vitro and in vivo. Cir Res, 2012; 110(6):808–817; doi: 10.1161/CIRCRESAHA.111.259325

18.

Zargham

, Touyz

, Thibault

. α8 integrin overexpression in de-differentiated vascular smooth muscle cells attenuates migratory activity and restores the characteristics of the differentiated phenotype. Atherosclerosis, 2007; 195(2):303–312; doi: 10.1016/j.atherosclerosis.2007.01.005

19.

Loppnow

, Werdan

, Buerke

. Vascular cells contribute to atherosclerosis by cytokine-and innate-immunity-related inflammatory mechanisms. Innate Immun, 2008; 14(2):63–87; doi: 10.1177/1753425908091246

20.

Chawla

, Simionescu

, Langan III

, et al. Influence of clinically relevant mechanical forces on vascular smooth muscle cells under chronic high glucose: An in vitro dynamic disease model. Ann Vasc Surg, 2016; 34:212–226; doi: 10.1016/j.avsg.2016.04.003

21.

, Gao

, Zhang

, et al. Impaired autophagy mediates hyperhomocysteinemia-induced HA-VSMC phenotypic switching. J Mol Histol, 2019; 50:305–314; doi: 10.1007/s10735-019-09827-x

22.

, Feng

, Niu

, et al. Liraglutide blocks the proliferation, migration and phenotypic switching of homocysteine (Hcy)-induced vascular smooth muscle cells (VSMCs) by suppressing proprotein convertase subtilisin kexin9 (PCSK9)/low-density lipoprotein receptor (LDLR). Bioengineered, 2021; 12(1):8057–8066; doi: 10.1080/21655979.2021.1982304

23.

, Zhao

, Zang

, et al. Artemisinin attenuates the development of atherosclerotic lesions by the regulation of vascular smooth muscle cell phenotype switching. Life Sci, 2019; 237:116943; doi: 10.1016/j.lfs.2019.116943

24.

Kim

, Lee

, et al. Soluble epoxide hydrolase inhibitor, TPPU, attenuates progression of atherosclerotic lesions and vascular smooth muscle cell phenotypic switching. Vascul Pharmacol, 2022; 145:107086; doi: 10.1016/j.vph.2022.107086

25.

Chen

, Su

, Qin

, et al. New insights into phenotypic switching of VSMCs induced by hyperhomocysteinemia: Role of endothelin-1 signaling. Biomed Pharmacother, 2020; 123:109758; doi: 10.1016/j.biopha.2019.109758

26.

Lawrence de Koning

, Werstuck

, Zhou

, et al. Hyperhomocysteinemia and its role in the development of atherosclerosis. Clin Biochem, 2003; 36(6):431–441; doi: 10.1016/S0009-9120(03)00062-6

27.

Guo

, Xu

, Lv

, et al. Hyperhomocysteinemia independently causes and promotes atherosclerosis in LDL receptor-deficient mice. J Geriatr Cardiol, 2014; 11(1):74; doi: 10.3969/j.issn.1671-5411.2014.01.013

28.

Bao

, Zheng

. Atorvastatin attenuates homocysteine-induced migration of smooth muscle cells through mevalonate pathway involving reactive oxygen species and p38 MAPK. Clin Exp Pharmacol, 2015; 42(8):865–873; doi: 10.1111/1440-1681.12435

29.

Clempus

, Griendling

. Reactive oxygen species signaling in vascular smooth muscle cells. Cardiovasc Res, 2006; 71(2):216–225; doi: 10.1016/j.cardiores.2006.02.033

30.

Wang

, Shi

, Chen

. Manganese superoxide dismutase inhibits neointima formation through attenuation of migration and proliferation of vascular smooth muscle cells. Free Radic Biol Med, 2012; 52(1):173–181; doi: 10.1016/j.freeradbiomed.2011.10.442

31.

Badran

, Nasser

, Mesmar

, et al. Reactive oxygen species: Modulators of phenotypic switch of vascular smooth muscle cells. Int J Mol Sci, 2020; 21(22):8764; doi: 10.3390/ijms21228764

32.

Zhou

, Huang

, Li

, et al. Soluble epoxide hydrolase inhibition protected against angiotensin II-induced adventitial remodeling. Sci Rep, 2017; 7(1):6926; doi: 10.1038/s41598-017-07512-1

33.

Bao

, Wu

, Lu

. Atorvastatin inhibits homocysteine-induced oxidative stress and apoptosis in endothelial progenitor cells involving Nox4 and p38MAPK. Atherosclerosis, 2010; 210(1):114–121; doi: 10.1016/j.atherosclerosis.2009.11.032

34.

, Yu

, Yoo

, et al. Anti-proliferative effects of rutin on OLETF rat vascular smooth muscle cells stimulated by glucose variability. Yonsei Med J, 2016; 57(2):373–381; doi: 10.3349/ymj.2016.57.2.373

35.

, Qin

, Yan

, et al. Inhibition of vascular smooth muscle cells premature senescence with rutin attenuates and stabilizes diabetic atherosclerosis. J Nutr Biochem, 2018; 51:91–98; doi: 10.1016/j.jnutbio.2017.09.012

36.

, Xu

, Ikeda

, et al. Caffeic acid inhibits vascular smooth muscle cell proliferation induced by angiotensin II in stroke-prone spontaneously hypertensive rats. Hypertens Res, 2005; 28(4):369–377; doi: 10.1291/hypres.28.369

37.

Silva

, Lopes

NMF

. Cardiovascular effects of caffeic acid and its derivatives: A comprehensive review. Front Physiol, 2020; 11:595516; doi: 10.3389/fphys.2020.595516

38.

Naveed

, Hejazi

, Abbas

, et al. Chlorogenic acid (CGA): A pharmacological review and call for further research. Biomed Pharmacother, 2018; 97:67–74; doi: 10.1016/j.biopha.2017.10.064

39.

Chiou

, Chen

, Wei

. 3, 4-di-O-caffeoylquinic acid inhibits angiotensin-II-induced vascular smooth muscle cell proliferation and migration by downregulating the JNK and PI3k/AKT signaling pathways. Evid Based Complement Alternat Med, 2011; 2011:364502; doi: 10.1093/ecam/nep140