Generating a Battery of Monoclonal Antibodies Against Firefly Luciferase for Dot Blot Analysis,Western Blot Analysis,and Immunostaining of Cells in Culture and Paraffin Sections

Abstract

Firefly luciferase (FLuc) is commonly used as a reporter gene PpyLuc1 in bioanalytical assays. We have produced five mouse-derived monoclonal antibodies (mAbs) that recognize FLuc. The mAbs, DSHB-LUC-2, DSHB-LUC-3, DSHB-LUC-9, DSHB-LUC-16, and DSHB-LUC-24, were generated by immunizing mice with purified 6xHIS-tagged FLuc (6xHis-FLuc) in suspension with an adjuvant. All five were validated by dot blots. Four of the mAbs provided strong signals in western blot analysis, and one a weak signal. All five were validated for immunostaining in fixed cell culture. Only one stained cells embedded in paraffin. The five mAbs are available at cost through the Developmental Studies Hybridoma Bank (DSHB), a nonprofit National Resource created by the National Institutes of Health.

Introduction

Luciferases belong to a diverse class of bioluminescent molecules commonly exploited as genetic reporters both in vivo and in vitro.^(1,2) Since its initial cloning by de Wet et al. in 1985,⁽³⁾ firefly luciferase (FLuc), from the North American firefly (Photinus pyralis), has become the most popular bioluminescent molecule used in bioanalytical assays. FLuc is ∼62 kDa^(3,4) and is comprised of N-terminal and C-terminal domains consisting of alpha+beta sheet structures, linked by a flexible hinge-like region near the active site of the enzyme.⁽⁵⁾ FLuc catalyzes the oxidation of d-luciferin in the presence of ATP, Mg²⁺, and O₂, resulting in the emission of predominantly yellow–green light, with a peak emission wavelength between 550 and 580 nm at 25°C and an optimal pH of 7.8.^(6–8) Light-sensitive applications (e.g., illuminometers, charge-coupled device [CCD] cameras, etc.) are able to detect the photons emitted by the enzyme–substrate reaction. FLuc autofluoresces in the absence of substrate, but emits minimal light and, therefore, little background fluorescence. This affords accurate quantification of minute amounts of the active enzyme, resulting in high FLuc assay sensitivity.⁽⁹⁾ In addition to the high sensitivity of FLuc-based bioluminescent assays, assays can also be dynamic due to the relatively short half-life of FLuc (∼3 hours in mammalian cells) compared with luciferases produced by other organisms.^(2,10) An excellent example of how the sensitivity and dynamic nature of FLuc have been exploited is its application to bioluminescent imaging (BLI) in vivo. BLI allows the location and quantification of cells expressing the FLuc reporter gene within living organisms. FLuc can be visualized multiple times by CCD cameras as long as fresh substrate is provided. This noninvasive technique is evolving into a common way to track disease progression and responses to treatment in models, such as mice, of pathogenic microorganisms, and tumorigenesis.^(11–14) However, the resolution of BLI in vivo is far lower than that of immunostaining and immunohistostaining of reporter proteins. Combining the two technologies, however, is synergistic.

In this study, we detail the generation and validation of five new mouse anti-FLuc monoclonal antibodies (mAbs). Their utility is demonstrated in dot and western blot hybridization, immunostaining of fixed mammalian cell preparations, and immunostaining of paraformaldehyde-fixed paraffin-embedded cell preparations. Each of the five mAbs is effective for dot blotting and immunostaining of cells in culture. Four of the mAbs (DSHB-LUC-2, DSHB-LUC-9, DSHB-LUC-16, and DSHB-LUC-24) are effective for western blotting. Only one of the mAbs (DSHB-LUC-3), which provided only a weak western blot signal, was highly effective in immunostaining of paraffin-embedded cells. All five mAbs are available for basic research purposes at cost through the Developmental Studies Hybridoma Bank (DSHB), a nonprofit National Resource created by the National Institutes of Health and housed at the University of Iowa.

Materials and Methods

Recombinant protein immunogen production

Production of recombinant 6x histidine-tagged FLuc (6xHis-FLuc) was carried out as previously described by Park et al.⁽¹⁵⁾ for recombinant maltose-binding protein (MBP), with minor modifications. The FLuc-containing vector plasmid, pLIFE-3’UTR, was obtained from the DNASU plasmid repository at the Biodesign Institute of Arizona State University. The FLuc open reading frame (ORF) was amplified from pLIFE-3’UTR by polymerase chain reaction (PCR) with the primers FLuc-F (ATATGGTACCATGGAAGACGCCAAAAACATAAAG) and FLuc-R (TATACTCGAGTTACAATTTGGACTTTCCGCCCTTC). The purified PCR products were digested with KpnI and SacI, and ligated into the plasmid pDB.His.MBP (DNASU), which had been treated with the same restriction enzymes. The resulting plasmid, pDB.His.FLuc, contained the 6xHis-FLuc ORF under the control of the lac operon, allowing the induction of 6xHis-FLuc expression in Escherichia coli in the presence of Isopropryl β-d-1-thiogalactopyranoside (IPTG). Recombinant 6xHis-FLuc used as immunogen in the production of the anti-FLuc mAbs was expressed in the BL21 pLysS strain of E. coli (Invitrogen, Carlsbad, CA). A second plasmid, pDB.WT.FLuc, was constructed using the primers, WTFLuc-F (TAATCCATGGAAGACGCCAAAAACATAAAG) and FLuc-R, for PCR amplification of the FLuc ORF and NcoI and SacI for digestion of the purified PCR products before ligation into the plasmid pDB.His.MBP (DNASU). The pDB.WT.FLuc plasmid allowed IPTG-induced expression of untagged wild-type FLuc in the BL21 pLysS strain of E. coli (Invitrogen). Whole cell lysate from the wild-type FLuc-expressing E. coli strain was used for mAb screening.

Mice and immunization

Two 8-week-old female BALB/c mice (Envigo, Indianapolis, IN) were initially immunized by intraperitoneal injection of 50 μg of 6xHis-FLuc, 50 μg of poly(I:C) HMW VacciGrade (InvivoGen, San Diego, CA), and 50 μg of adjuvant anti-CD40 mAb (BioXCell, West Lebanon, NH),^(15–17) in 200 μL phosphate-buffered solution (PBS; Gibco, Grand Island, NY). Two weeks after the initial immunization, both mice were boosted with 50 μg of 6xHis-FLuc and 50 μg of poly(I:C) in 200 μL of PBS. Serum was obtained from each mouse 2 weeks after the boost and tested at ≥1:500 dilutions by western blot analysis. Based on the results of the western blot analysis, the mouse with the highest anti-FLuc antibody titer was identified, and that mouse was injected intravascularly with 50 μg of 6xHis-FLuc and 50 μg of poly(I:C) in 100 μL of PBS 3 days before hybridoma fusion.

Hybridoma fusion

Hybridoma fusion was performed as described by Sanchez et al.⁽¹⁷⁾ with minor modification. Spleen cells from the immunized mouse and Sp2/0-Ag14 myeloma cells (CRL-1581; ATCC, Manassas, VA)⁽¹⁸⁾ were washed, passed through a 70 μm filter, resuspended in serum-free RPMI 1640 medium (HyClone, Logan, UT) at a ratio of five nucleated splenocytes to one myeloma cell (5:1), and pelleted. The pelleted cells were dispersed with gentle mixing and warmed to 37°C for 1 minute, followed by the addition of 0.5 mL of prewarmed 50% (v/v) PEG-RPMI 1640 medium. Then the cells were mixed gently at 37°C for an additional 2 minutes. During the subsequent 90 seconds, 15 mL of prewarmed serum-free Iscove's modified Dulbecco's medium (IMDM) (HyClone) was added dropwise to the fusion mixture, and the cells incubated at room temperature for 8 minutes without agitation.

The cells were once again incubated at 37°C for 2 minutes, and then pelleted by centrifugation at 200 g for 5 minutes. After centrifugation, the supernatant was removed and the pellet dispersed by mixing gently and pipetting into 30 mL of hybridoma culture medium IMDM, which contained 15% fetal bovine serum (FBS; HyClone), 20% RPMI 1640 medium conditioned by giant cell tumor (TIB-223; ATCC),⁽¹⁹⁾ and 1× HT-HybriMax. The cell suspension was then transferred to T75 flasks and incubated overnight at 37°C. The following day, 100 μL of the cell suspension was added to each well of 96-well tissue culture plates. After 2 days incubation at 37°C, 100 μL of 2× hypoxanthine–aminopterin–thymidine (HAT; Sigma-Aldrich, St. Louis, MO) medium was added to each well to select for hybridomas. Cells were then weaned from the 2× HAT medium by exchanging 100 μL of the medium with 100 μL of 1× HAT medium twice every 3 days. Once cells had grown to between 25% and 50% confluency, supernatants were tested for the presence of mouse IgG production by a dot blot analysis (Bio-Rad, Hercules, CA). Hybridoma clones that yielded positive results were expanded and the supernatants retested for anti-FLuc activity by western blot analysis. Hybridomas confirmed to be producing anti-FLuc antibodies were expanded and subcloned using fluorescence-activated cell sorting with Propidium Iodide (Life Technologies) staining for viability. The Mouse mAb Isotyping Test Kit (AbD Serotec, Raleigh, NC) was used according to the manufacturer's protocols to determine antibody isotypes from the culture supernatants.

Dot blot

Five microliters of lysate from E. coli strains expressing either the untagged wild-type FLuc protein or the 6xHis-tagged MBP (6xHis-MBP) were applied to dry nitrocellulose membranes. Once the membranes had dried completely, they were subsequently blocked with 5% (w/v) nonfat milk in 1× Tris-buffered saline containing Tween-20 (TBST: 50 mM Tris–HCl, 150 mM NaCl, pH 7.6, 0.005% Tween-20) for 1 hour at room temperature. The membranes were then incubated in blocking buffer containing 0.1 μg/mL of the anti-FLuc mAbs or the rabbit polyclonal anti-FLuc antibody (RBpAB), L0159 (Sigma-Aldrich), for 1 hour at room temperature. The membranes were then washed three times with 1× TBST and incubated at room temperature with IR Dye 800-conjugated goat anti-mouse or goat anti-rabbit secondary antibody (LI-COR Biosciences, Lincoln, NE) at a 1:10,000 dilution for 1 hour. The membranes were washed three times with 1× TBST and scanned in an Odyssey Scanner (LI-COR Biosciences).

Western blot

Samples containing 15 μL of lysate from FLuc-expressing 4T1 murine breast carcinoma cells^(20,21) or NTera2 (NT2) human teratocarcinoma cells (ATCC) were denatured and separated in a Tris/Glycine/sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gel (Bio-Rad) with dual color molecular weight markers (Bio-Rad). Proteins were transferred from the gel to nitrocellulose membranes, and the membranes blocked with 5% (w/v) nonfat milk in TBST for 1 hour at room temperature. The blocked membranes were then incubated in a blocking buffer containing 1 μg/mL of anti-FLuc antibodies for 1 hour at room temperature. A rabbit-derived anti-FLuc polyclonal antibody (RBpAB), L0159 (Sigma-Aldrich), was used as a positive control at a dilution of 1:10,000. After incubation with the respective primary antibody, membranes were washed three times with 1× TBST and subsequently incubated for 1 hour, at room temperature in the dark with either IR Dye 800-conjugated goat anti-mouse or goat anti-rabbit secondary antibody (LI-COR Biosciences) at a 1:10,000 dilution. Then, the membranes were once again washed three times with 1× TBST and scanned in an Odyssey Scanner (LI-COR Biosciences).

Immunostaining fixed cells

FLuc-expressing 4T1 cells^(20,21) were released from the sides of culture flasks by treating them for 30 minutes with 10 mM EDTA in Dulbecco's PBS without calcium or magnesium (DPBS; Gibco) at 37°C. Released cells were washed and resuspended in IMDM (HyClone), then replated in sterile 12-well Teflon-coated microscope slides (Tekdon, Myakka City, FL) at 2.5 × 10⁴ cells per well. Cells were incubated for up to 48 hours at 37°C to allow cell attachment and spreading. The optimized cell fixation protocol utilized by the Human Cell Atlas was used (Stadler et al.,²² www.humancellatlas.org). Briefly, the slides were rinsed with ice-cold DPBS, then incubated for 15 minutes in ice-cold 4% paraformaldehyde (PF; Electron Microscopy Sciences, Hatfield, PA) in IMDM containing 10% FBS. The fixative was removed, and the cells rinsed in DPBS and subsequently permeabilized in 0.05% Triton X-100 for 3 minutes at room temperature. Slides were washed five times in DPBS and then blocked in DPBS containing 10% normal goat serum (Sigma-Aldrich). Following the block, 25 μL test-conditioned supernatant adjusted to a final concentration of 5 μg/mL of IgG antibody was added to each well. Slides were incubated for 1 hour at 37°C and then washed five times with DPBS. Twenty-five microliters of secondary Alexa Fluor 488 goat anti-mouse IgG (5 μg/mL; Jackson ImmunoResearch, West Grove, PA) were added to each well and the slides incubated for 30 minutes at room temperature in the dark. After a brief wash with DPBS, the slides were counter-stained with 3 U/mL of rhodamine phalloidin (Life Technologies; 5 U/mL DPBS) for 15 minutes at room temperature. The phalloidin was removed by rising with DPBS and a coverslip mounted using ProLong Gold (Thermo Fisher). Stained cells were imaged with a Nikon TE2000 inverted fluorescence microscope (Nikon Instruments, Inc., Melville, NY) and images captured with an attached Canon EOS Rebel T3i Digital SLR Camera (Canon USA, Inc., Melville, NY).

Paraffin-embedded cells

The 4T1 mouse mammary cell line gently released as above was rinsed in DPBS and resuspended in 4% PF-DPBS for 15 minutes at room temperature. The fixative was removed and the cells were washed by gentle centrifugation in a 1.5-mL Eppendorf tube. The DPBS was removed and the cell pellet was covered with 100 μL of warm 2% agarose–DPBS and the cell pellet disrupted and dispersed by tapping. After the agarose hardened, the sample was cut from the tube and processed for paraffin embedding using standard tissue processing protocols in an RMC Paraffin Tissue Processor 1530. Paraffin sections (7 μm) were placed on Superfrost Plus slides (Fisher Scientific), dried overnight at 37°C, baked for 30 minutes at 65°C, deparaffinized in xylene, and rehydrated through graded alcohols. Sections were blocked with 10% normal goat serum (Sigma-Aldrich) in Tris-buffered saline ([TBS] 50 mM Tris, 150 mM NaCl, pH 8.0) before staining with anti-luciferase-conditioned culture supernatant diluted with TBS to a final concentration of 5 μg/mL at 37°C for 1 hour. After extensive TBS rinsing, preparations were incubated in Alexa Fluor 488-conjugated goat anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA) at 37°C for 45 minutes. Sections were rinsed with TBS, coverslips mounted, and imaged as described above. Control sections were stained using medium containing 5 μg/mL normal mouse IgG (Jackson ImmunoResearch, West Grove, PA).

Results

Generating anti-FLuc monoclonals

To generate anti-FLuc mAbs, mice were immunized against recombinant native 6xHis-FLuc in combination with a water-soluble adjuvant cocktail containing poly(I:C) and anti-CD40 antibody.⁽¹⁷⁾ A booster immunization consisting of 6xHis-FLuc and poly(I:C) was administered 2 weeks after the initial injection. Two weeks after the boost, serum from each mouse was tested and the effects of immunization against FLuc confirmed by immunoblot analysis at ≥1:500 sera dilution. Three days before the fusion process, one mouse was given a final boost with 6xHis-FLuc. The immunization process was completed within 6 weeks, at which point B cells from the spleen of the immunized mouse were fused with Sp2/0-Ag14 myeloma cells.^(18,23) After selection with HAT, cloning, and screening hybridomas for anti-FLuc antibody production, five clones (DSHB-LUC-2, DSHB-LUC-3, DSHB-LUC-9, DSHB-LUC-16, and DSHB-LUC-24), exhibiting the most intense levels of anti-FLuc antibody production by western blot analysis, were expanded and the performance of the antibodies they produced tested. The immunoglobulin isotypes of all five hybridomas were demonstrated to be IgG1.

Dot blot

The five mAbs were first tested for their ability to detect native FLuc by a dot blot assay. E. coli cell lysate containing the wild-type FLuc protein was spotted on nitrocellulose membranes. Lysate from an E. coli strain expressing the 6xHis-MBP fusion protein was used as a negate control. The membranes were incubated with either the anti-FLuc mAbs or the anti-FLuc rabbit polyclonal antibody. The polyclonal antiserum RBpAB provided a strong signal against the lysate expressing FLuc and an artificial edge effect against the lysate expressing 6xHis-MBP (Fig. 1A). All five of the generated mAbs produced strong signals with the FLuc-expressing cell lysates, but not with the 6xHis-MBP-expressing cell lysates (Fig. 1B–F). Results indicate that each of the five anti-FLuc mAbs was effective in recognizing the native FLuc protein. These results also rule out the possibility that the five anti-FLuc mAbs recognize the 6xHis tag, which was present on the 6xHis-tagged FLuc immunogen used to generate the mAbs.

FIG. 1.

Dot blot analysis of the five anti-FLuc mAbs. Lysates from Escherichia coli strains expressing either the untagged wild-type FLuc or 6xHis-MBP (maltose-binding protein) recombinant proteins were spotted onto nitrocellulose membranes. (A) Detection with a rabbit polyclonal antibody (RBpAB) obtained from Thermo Fisher Scientific. (B–F) The FLuc-containing lysate was stained by each of the five anti-FLuc mAbs, whereas the lysate containing 6xHis-MBP remained unstained. The ring of staining by the polyclonal antiserum RBpAB is a peripheral staining artifact presumably resulting from the polyclonal nature of the antiserum. FLuc, firefly luciferase; mAb, monoclonal antibody; MBP, maltose-binding protein.

Western blot

Each of the five anti-FLuc mAbs was then tested by western blot analysis for the ability to bind denatured FLuc peptides in cell lysates of FLuc-expressing 4T1 cells. The results were also compared with those of the commercially available rabbit polyclonal antibody, (RBpAB), L0159. Each antibody was also tested against the FLuc-free lysate of Ntera2 (NT2) cells. The polyclonal antibody RBpAB recognized in the 4T1 cells a signal protein of 62 kDa, the molecular mass of the FLuc gene product (Fig. 2A). RBpAB recognized no bands in the NT2 cell lysate (Fig. 2A). All of the mAbs we generated (DSHB-LUC-2, DSHB-LUC-3, DSHB-LUC-9, DSHB-LUC-16, and DSHB-LUC-24) also recognized a single band at 62 kDa, contained in the FLuc-expressing 4T1 cell lysate and no bands in the NT2 lysates (Fig. 2B–F). In the case of DSHB-LUC-3, a higher detergent stringency was necessary to remove an increased background signal. The results demonstrate that the five aforementioned anti-FLuc mAbs were able to recognize denatured wild-type FLuc enzyme, although DSHB-LUC-3 exhibited diminished recognition.

FIG. 2.

Western blot analysis using whole cell lysates of an (A) anti-FLuc rabbit pAb (RBpAB) and the five anti-FLuc mAbs (DSHB-LUC-2, DSHB-LUC-3, DSHB-LUC-9, DSHB-LUC-16, and DSHB-LUC-24) (B–F). Wild-type FLuc has a molecular mass of 62 kDa. The cell lysates used for the western blots were obtained from two mammalian cell lines, a 4T1 cell line in which FLuc is constitutively expressed, and the NTera2 (NT2) cell line lacking FLuc. In each of the western blots, 15 μL of the FLuc-containing 4T1 cell lysate was loaded into the first lane with an equal amount of the FLuc-free NT2 cell lysate loaded into the second lane. Because of background problems, the level of detergent in the western blot buffer for DSHB-LUC-3 was increased 10-fold. pAb, polyclonal antibody.

Immunostaining fixed cells

The five anti-FLuc mAbs were tested for immunostaining, using fixed, permeabilized FLuc-expressing 4T1 cells. Cells were treated with each mAb, then with Alexa Fluor 488 goat anti-mouse antibody (green), and then counterstained with the rhodamine-conjugated phalloidin (red). Phalloidin stains F-actin.⁽²⁴⁾ Each of the five anti-FLuc mAbs stained the cytoplasm of fixed cells (Fig. 3A–E, respectively). Punctate staining was observed within the cytoplasm, as is obvious in enlarged images of stained cells (Fig. 4). Punctate staining reflects localization of FLuc in peroxisomes mediated by a C-terminal peptide-targeting signal.⁽²⁵⁾ When FLuc expression is higher than the maximum level the peroxisomes can incorporate, as is the case in the FLuc-expressing 4T1 cells, FLuc accumulates in the nonpunctate cytoplasm (Figs. 3 and 4). These results demonstrate that each of the five anti-FLuc mAbs is effective in recognizing FLuc enzyme in cells fixed with paraformaldehyde and permeabilized.

FIG. 3.

Immunostaining of fixed, permeabilized FLuc-expressing 4T1 murine mammary cell line cells by mAbs. The 4T1 murine breast carcinoma cells constitutively expressing the wild-type FLuc enzyme were fixed with paraformaldehyde, permeabilized, treated with each of the five anti-FLuc mAbs (A–E), and subsequently stained with Alexa Fluor 488 goat anti-mouse IgG antibody (green). Samples were then counterstained with the F-actin dye rhodamine phalloidin (red). The control lacked a primary antibody, and therefore only stained for F-actin (F). Scale bar 10 μM.

FIG. 4.

Increased magnification of FLuc staining of a spread 4T1 cell, in this case by DSHB-LUC-3, reveals both peroxisome staining and diffuse cytoplasmic staining. Fixed, permeabilized cells were stained with the mAb DSHB-LUC-3 (green) and counterstained with rhodamine phalloidin (red) for F-actin localization. Scale bar 10 μM.

Paraffin-embedded cells

FLuc-expressing 4T1 cells were suspended in agarose, fixed with paraformaldehyde, embedded in paraffin, and sectioned for staining. Sections were treated with each mAb and then stained with Alexa Fluor 488 goat anti-mouse antibody. Of the five mAbs, four (DSHB-LUC-2, DSHB-LUC-9, DSHB-LUC-16, and DSHB-LUC-24) either did not stain or very weakly stained paraffin-embedded cell preparations (Fig. 5A, C–E, respectively). Only one mAb, DSHB-LUC-3, provided a strong signal in paraffin-embedded cell preparations (Fig. 5B). Control 4T1 cells not expressing FLuc did not stain in paraffin with DSHB-LUC-3 (Fig. 5F). Control preparations lacking DSHB mAbs did not stain. Therefore, although DSHB-LUC-3 provided only a weak signal in western blot analysis, it provided a strong signal when employed in fixed cell preparations and in cell preparations embedded in paraffin.

FIG. 5.

Immunofluorescent staining of sections of paraformaldehyde-fixed, paraffin-embedded cells by anti-FLuc mAbs. FLuc-expressing 4T1 mouse mammary cells were suspended in agarose, fixed with paraformaldehyde, embedded in paraffin, sectioned, and treated with the five anti-FLuc mAbs (A–E). Subsequent treatment with the Alexa Fluor 488-conjugated goat anti-mouse IgG allowed visualization of mAb-FLuc interactions (green). Each preparation was analyzed by DIC microscopy (left) and secondary antibody fluorescence (right). The 4T1 wild-type control (F) did not express luciferase and was negative when stained with DSHB-LUC-3 mAb.

Discussion

We have generated five mAbs against the purified native FLuc enzyme and characterized their effectiveness in four distinct applications, dot blot staining of native FLuc, western blot analysis of denatured FLuc, and both immunostaining and immunofluorescent staining of paraffin-embedded cells. For immunostaining of fixed cells and immunofluorescent staining of paraffin-embedded cells, we employed a FLuc-expressing mouse cell line derived from the 4T1 mouse mammary carcinoma cell line.^(20,21) Table 1 shows a summary of the efficacy of the five mAbs in each of the applications tested. All five mAbs successfully recognized the native protein in dot blot analyses. Four of the five anti-FLuc mAbs provided strong signals in recognizing denatured FLuc in western blotting of cell lysates. All five mAbs were highly effective in staining fixed, permeabilized cells. One of the anti-FLuc mAbs, DSHB-LUC-3, which provided a very weak signal in western blot analyses, was effective in recognizing FLuc in paraffin-embedded cell preparations.

Table 1.

Validated Applications

	Anti-FLuc mAB
Application	DSHB-LUC-2	DSHB-LUC-3	DSHB-LUC-9	DSHB-LUC-16	DSHB-LUC-24
Dot blot	+	+	+	+	+
Western blot	+	+^a	+	+	+
Immunostaining of cells	+	+	+	+	+
Immunostaining of paraffin-embedded cells	−	+	−	−	−

Detergent increased 10-fold to remove nonspecific background binding.

Footnotes

Acknowledgments

This research was funded by the Developmental Studies Hybridoma Bank, a National Resource created by the NIH and housed at the UIOWA. All antibodies can be obtained at cost from the DSHB for use in basic research (http://dshb.biology.uiowa.edu).

Author Disclosure Statement

No competing financial interests exist.

References

Smirnova

, and Ugarova

: Firefly luciferase-based fusion proteins and their applications in bioanalysis. J Photochem Photobiol, 2017; 93:436–447.

Thorne

, Inglese

, and Auld

: Illuminating insights into firefly luciferase and other bioluminescent reporters used in chemical biology. Chem Biol, 2010; 17:646–657.

de Wet

, Wood

, Helinski

, and DeLuca

: Cloning of firefly luciferase cDNA and the expression of active luciferase in Escherichia coli. Proc Natl Acad Sci U S A, 1985; 82:7870–7873.

Wood

, de Wet

, Dewi

, and DeLuca

: Synthesis of active firefly luciferase by in vitro translation of RNA obtained from adult lanterns. Biochem Biophys Res Commun, 1984; 124:592–596.

Conti

, Franks

, and Brick

: Crystal structure of firefly luciferase throws light on a superfamily of adenylate-forming enzymes. Structure, 1996; 4:287–298.

Lall

, Seliger

, Biggley

, and Lloyd

: Ecology of colors of firefly bioluminescence. Science, 1980; 210:560–562.

Ando

, Niwa

, Yamada

, Enomoto

, Irie

, Kubota

, Ohmiya

, and Akiyama

: Firefly bioluminescence quantum yield and colour change by pH-sensitive green emission. Nat Photonics, 2008; 2:44–47.

Baggett

, Roy

, Momen

, Morgan

, Tisi

, Morse

, and Gillies

: Thermostability of firefly luciferases affects efficiency of detection by in vivo bioluminescence. Mol Imaging, 2004; 3:324–332.

Williams

, Burlein

, Ogden

, Kricka

, and Kant

: Advantages of firefly luciferase as a reporter gene: Application to the interleukin-2 gene promoter. Anal Biochem, 1989; 176:28–32.

10.

Thompson

, Hayes

, and Lloyd

: Modulation of firefly luciferase stability and impact on studies of gene regulation. Gene, 1991; 103:171–177.

11.

Doyle

, Nawotka

, Kawahara

, Francis

, and Contag

: Visualizing fungal infections in living mice using bioluminescent pathogenic Candida albicans strains transformed with the firefly luciferase gene. Microb Pathog, 2006; 40; 82–90.

12.

Andreu

, Zelmer

, and Wiles

: Noninvasive biophotonic imaging for studies of infectious disease. FEMS Microbiol Rev, 2011; 35:360–394.

13.

Edinger

, Sweeney

, Tucker

, Olomu

, Negrin

, and Contag

: Noninvasive assessment of tumor cell proliferation in animal models. Neoplasia, 1999; 1:303–310.

14.

Kim

, Urban

, Cochran

, Lee

, Ang

, Rice

, Bata

, Campbell

, Coffee

, Gorodinsky

, Lu

, Zhou

, Kishimoto

, and Lassota

: Non-invasive detection of a small number of bioluminescent cancer cells in vivo. PLoS One, 2010; 5:e9364.

15.

Park

, Glover

, Daniels

, and Soll

: Generation and validation of monoclonal antibodies against the maltose binding protein. Monoclon Antib Immunodiagn Immunother, 2016; 34:104–108.

16.

Llopiz

, Dotor

, Zabaleta

, Lasarte

, Prieto

, BorrasCuesta

, and Sarobe

: Combined immunization with adjuvant molecules poly(I:C) and anti-CD40 plus a tumor antigen has potent prophylactic and therapeutic antitumor effects. Cancer Immunol Immunother, 2008; 57:19–29.

17.

Sanchez

, Daniels

, Park

, and Soll

: Generating a battery of monoclonal antibodies against native green fluorescent protein for immunostaining, FACS, IP, and ChIP using a unique adjuvant. Monoclon Antib Immunodiagn Immunother, 2014; 33:80–88.

18.

Shulman

, Wilde

, and Kohler

: A better cell line for making hybridomas secreting specific antibodies. Nature, 1978; 276:269–270.

19.

Abboud

, DiPersio

, Brennan

, and Lichtman

: Erythropoietic enhancing activity (EEA) secreted by the human cell line, GCT. J Supramol Struct, 1980; 13:199–209.

20.

Aslakson

, and Miller

: Selective events in the metastatic process defined by analysis of the sequential dissemination of subpopulation of a mouse mammary tumor. Cancer Res, 1992; 52:1399–1405.

21.

Zhou

, Gibson-Corley

, Herndon

, Sun

, Gustafson-Wagner

, Teoh-Fitzgerald

, Domann

, Henry

, and Stipp

: Integrin α3β1 can function to promote spontaneous metastasis and lung colonization of invasive breast carcinoma. Mol Cancer Res, 2013; 12:143–154.

22.

Stadler

, Skogs

, Brismar

, Uhlen

, and Lundberg

: A single fixation protocol for proteome-wide immunofluorescence localization studies. J Proteomics, 2010; 73:1067–1078.

23.

Johnson

, Winterwood

, DeMali

, and Stipp

: Tetraspanin CD151 regulates RhoA activation and the dynamic stability of carcinoma cell-cell contacts. J Cell Sci, 2009; 122:2263–2273.

24.

Cooper

: Effects of cytochalasin and phalloidin on actin. J Cell Biol, 1987; 150:1473–1478.

25.

Gould

, Keller

, and Subramani

: Identification of a peroxisomal targeting signal at the Carboxy Terminus of Firefly Luciferase. J Cell Biol, 1987; 105:2923–2931.