Evaluation of Fluoroquinolone Resistance Mechanisms in Pseudomonas aeruginosa Multidrug Resistance Clinical Isolates

Abstract

Efflux transporters have a considerable role in the multidrug resistance (MDR) of Pseudomonas aeruginosa, an important nosocomial pathogen. In this study, 45 P. aeruginosa clinical strains, with an MDR phenotype, have been isolated in a hospital of Northern Italy and characterized to identify the mechanisms responsible for their fluoroquinolone (FQ) resistance. These isolates were analyzed for clonal similarity, mutations in genes encoding the FQ targets, overexpression of specific Resistance Nodulation-cell Division efflux pumps, and search for mutations in their regulatory genes. The achieved results suggested that the mutations in genes encoding ciprofloxacin targets represented the main mechanism of FQ resistance of these strains; 97.8% of these isolates showed mutations in gyrA, 28.9% in gyrB, 88.9% in parC, and 6.7% in parE. Another mechanism of resistance was overexpression of the efflux pumps in some representative strains. In particular, overexpression of MexXY-OprM drug transporter was found in five isolates, whereas overexpression of MexCD-OprJ was detected in two isolates; surprisingly, in one of these last two isolates, also overexpression of MexAB-OprM pump was identified.

Introduction

P seudomonas aeruginosa is an opportunistic pathogen that causes serious and often life-threatening infections in immunocompromised and cystic fibrosis patients. Surveillance of these infections has revealed an alarming increase of antimicrobial resistance, evolving to a multidrug resistance (MDR) phenotype.^8,32 Recently, the emergence of P. aeruginosa pan-drug-resistant strains has been reported.^14,24 These strains are resistant to a plethora of antimicrobial compounds, including penicillins, cephalosporins, carbapenems, monobactam, aminoglycosides, fluoroquinolones (FQs), and polymyxins (such as colistin). Fortunately, these strains have been rarely described,^14,24 whereas those sensitive only to colistin are the most spreading ones.^8,17

The resistance of P. aeruginosa to several antibiotics relies on different mechanisms, such as the low permeability of its outer-membrane, the constitutive expression of various efflux pumps, mutations in target genes, and the production of antibiotic-inactivating enzymes.^3,26 For example, the resistance to FQs has been associated with target-site mutations within DNA gyrase (gyrA and gyrB) and topoisomerase IV (parC and parE), which are critical enzymes involved in regulating DNA topology during replication.¹⁸ In addition to this, overexpression of multidrug efflux pumps has been suggested as a further mechanism of resistance to FQs. Four efflux pumps belonging to the Resistance Nodulation-cell Division family (RND), MexAB-OprM, MexCD-OprJ, MexEF-OprN, and MexXY-OprM, have been shown to extrude the FQs giving rise to a resistant phenotype among P. aeruginosa clinical isolates.¹² It is quite possible that these last two mechanisms described might act synergistically in increasing the degree of FQ resistance; this idea relies on previous studies demonstrating that the high level of FQ resistance resulted from the combination of active efflux with DNA gyrase or topoisomerase IV mutations.^11,38 Moreover, the efflux systems could favor the emergence of target mutations by lowering the intra-bacterial antibiotic concentration.³

Until now, only MexAB-OprM and MexXY-OprM have been shown to be involved in intrinsic MDR because of constitutive (MexAB-OprM)^5,34,35 and antibiotic inducible (MexXY-OprM)^13,22,28 gene expression in P. aeruginosa wild-type cells. The MexAB-OprM efflux system is negatively regulated by MexR whose encoding gene is located upstream of the mexAB-oprM operon and divergently transcribed. Mutations in mexR are associated with the increased expression of MexAB-OprM efflux pump and the concomitant MDR phenotype.^1,7 Overexpression of MexXY-OprM confers resistance to aminoglycosides, erythromycin, tetracycline, FQs, penicillins, and aztreonam,²² and the operon is negatively regulated by MexZ.²³

The mexCD-oprJ operon is strongly repressed by NfxB and mutations in its coding sequence are responsible for MexCD-OprJ overproduction associated with a significant cross-resistance to quinolones, macrolides, and zwitterionic cephems such as cefepime.³⁰ MexEF-OprN can expel FQs, trimethoprim, and chloramphenicol.²¹ It is positively regulated by MexT, whose gene is located upstream of mexEF-oprN and transcribed in the same direction.¹⁵ Another regulator, referred to as MvaT, is involved in the regulation of this transporter, which is a global regulator of P. aeruginosa virulence genes, and modifies the resistance to chloramphenicol, imipenem, and norfloxacin, by enhancing the expression of the mexEF-oprN operon.³⁷

The objective of this study was to shed additional light on the mechanisms determining FQ resistance in P. aeruginosa strains, especially those with an MDR phenotype. To this purpose, 45 P. aeruginosa MDR clinical isolates have been isolated at “Policlinico San Matteo” in Pavia (Italy). All the strains were resistant to FQs, and some of them showed resistance to many classes of drugs and were sensitive only to colistin. The employed experimental strategy was (i) to analyze the strains for clonal similarity, (ii) to search for mutations in genes encoding the FQ targets, and (iii) to investigate both overexpression of well-known RND efflux pumps and the presence of mutations in genes encoding their regulators.

Materials and Methods

P. aeruginosa clinical isolates and collection data

From March 2006 to December 2008, about 833 P. aeruginosa clinical isolates were collected from different Units of “San Matteo” hospital in Pavia, such as Cardiac Surgery, Intensive Care, Infectious Disease Unit, and Nephrology. P. aeruginosa isolates originated from the following samples: urinoculture, respiratory samples, blood, urethra swab, wound swab, skin swab, pus, pleural liquid, drainage liquid, and prosthesis sample. All the samples came from noncystic fibrosis patients. All these P. aeruginosa strains were isolated from different patients and were identified through both culture methods and oxidase test, using P. aeruginosa ATCC 27853 as a control. The antimicrobial agents utilized in routine antimicrobial susceptibility tests (antimicrobial disk susceptibility test–CLSI approved Standards)⁶ included chloramphenicol, β-lactams (ampicillin and piperacillin), and β-lactam-inhibitors (amoxicillin/clavulanic acid, piperacillin/tazobactam), cephalosporins (ceftriaxone, cefalotin, ceftazidime, cefotaxime), carbapenems (meropenem, imipenem), monobactam (aztreonam), aminoglycosides (amikacin, gentamicin), sulfonamides (cotrimoxazole), and FQs (ciprofloxacin).

Determination of minimal inhibitory concentrations to colistin by E-test method

The minimal inhibitory concentration (MIC) of colistin was determined for 45 FQ-resistant strains and for 2 FQ-sensitive isolates by E-test method, according to the manufacturer's guidelines (AB Biodisk) (EUCAST-approved Standards). A suspension of each strain in Mueller-Hinton broth diluted to 0.5 MacFarland was swabbed onto Mueller-Hinton agar. Once the agar surface was completely dry, an E-test colistin strip (ranging from 0.016 to 256 μg/ml) was applied to each plate with sterile forceps, and the plates were incubated at 35°C for 16 to 20 hr. The MIC was read where inhibition of growth intersected the E-test strip.

Growth conditions

P. aeruginosa strains were grown onto blood-agar or MacKonkey agar. The cultures were performed in Mueller-Hinton broth. Strains were grown for 48 hr at 37°C.

Generation of random amplification of polymorphic DNA (RAPD) profiles

Random amplification of polymorphic DNA (RAPD) fingerprinting was performed as described previously²⁷ using the oligonucleotide 1253 (Table 1) and GOTaq DNA polymerase (Promega). The experiments were carried out in two different laboratories to evaluate the reproducibility of the method. For amplification experiment the bacterial lysate from each isolate was utilized as template. A dH₂O-negative control was incorporated into each set of polymerase chain reaction (PCR). Clonality was defined as >90% similarity among RAPD patterns. In particular, isolates differing by two or more major bands were considered sufficiently divergent to warrant separate clone designations. Isolates with profiles differing in at most one band or having same profiles were considered in a common RAPD type.

Table 1.

Oligonucleotides Used in This Work

Oligonucleotide	Sequence 5′–3′	Product (bp)	Purpose
1253	GTTTCCGCCC	–	RAPD amplification²⁷
GyrA1	GACGGCCTGAAGCCGGTGCAC	416	gyrA sequence
GyrA2	GCCCACGGCGATACCGCTGGA
GyrB1	GCGCGAGATGACCCGCCGCA	729	gyrB sequence
GyrB2	CTGGCGGAAGAAGAAGGTCAACA
ParC1	CGAGCAGGCCTATCTGAACTAT	363	parC sequence
ParC2	GAAGGACTTGGGATCGTCCGGA
ParE1	CGGCGTTCGTCTCGGGCGTGGTGAAGGA	591	parE sequence
ParE2	TCGAGGGCGTAGTAGATGTCCTTGCCGA
MexRSF	GATCAACCACATTTACATTAGG	550	mexR sequence
MexRSR	CGGATACCTGAAACGAAAAAC
MexZSF	CTTATGATCTGCGGCGCCTTT	700	mexZ sequence
MexZSR	GCACCTGATGGCGGACGATT
nfxB3	ACGCGAGGCCAGTTTTCT	731	nfxB sequence
nfxB4	ACTGATCTTCCCGAGTGTCG
Art1	AGGTGAACGGCATCATCCT	108	RT-PCR of mexA
Art2	TCTGGTAGTCGGCCTCGTA
Crt1	GCCAGCAGGACTTCGATAC	118	RT-PCR of mexC
Crt2	GCAGTGACCGAGGCGTAG
Ert1	GGCCGTACTGGTCCTGAG	119	RT-PCR of mexE
Ert2	TGAATTCGTCCCACTCGTT
MexX5	GCGAATTGCTGCCCGGCGG	125	RT-PCR of mexX
MexX6	GTTGACCACCTTGACCACGG
Rrt1	TCGGCACTGCGTAAGGTAT	92	RT-PCR of rpsL
Rrt2	TGCTCTTGCAGGTTGTGAC

RT-PCR, real-time polymerase chain reaction.

Amplification, sequencing, and analysis of target and regulatory genes

The target (gyrA, gyrB, parC, and parE) and regulatory (mexR, mexZ, and nfxB) genes were amplified by PCR using the specific primers listed in Table 1. PCR experiments were carried out using Pfu Taq DNA polymerase (Promega). Amplicons were purified using the Wizard SV Gel and PCR clean-up system (Promega) and then sent for DNA sequencing to BMR Genomics (www.bmr-genomics.it/).

MIC determinations of ciprofloxacin in the presence of MC207,110

The determination of MIC of ciprofloxacin for P. aeruginosa clinical and wild-type strains was performed by streaking a dilution of culture at 0.5 MacFarland onto LB agar containing ciprofloxacin at different concentrations (0.03–128 μg/ml) with or without a sub-lethal dose of efflux inhibitor MC207,110 (25 μg/ml). Plates were incubated at 37°C for 48 hr and the growth was visually evaluated. The MIC was defined as the lowest drug concentration that prevented visible growth. Data obtained are the averages of three independent experiments.

Isolation of RNA and quantitative real-time PCR

Total RNA was isolated with RiboPure-Bacteria Kit (Ambion, Inc.) from bacterial cultures in the late logarithmic phase, according to the supplier's instructions. Contaminating DNA was removed by DNase I treatment (Ambion, Inc.). All samples were then tested by conventional PCR to rule out the possibility of residual DNA contamination. First-strand cDNA was synthesized from ∼1 μg total RNA with Quantitect reverse transcription kit (Qiagen). Quantitative PCR experiments were performed using QuantiTect SYBR Green PCR Master Mix (Qiagen) on a Rotor Gene 6000 (Corbett Life Science) using the primer pairs listed in Table 1. The ribosomal rpsL gene was chosen as a reference housekeeping gene.^4,20 Data obtained are the averages of three independent replicates. Expression data were calculated with the −2^ΔΔCt method (ΔC_t = C_t _sample–C_t _control) and were reported as fold change in gene expression of the sample (P. aeruginosa clinical isolates) normalized to the invariant gene (rpsL) relative to the control wild-type strain (ATCC 27853). An increase of more than twofold was considered overexpression.

Results

Screening of P. aeruginosa clinical isolates

From March 2006 to December 2008, about 833 P. aeruginosa clinical isolates were collected from different Units of “Policlinico S. Matteo” hospital in Pavia. The resistance profile was determined by antibiogram. Several isolates were resistant to FQs and to many antibiotics commonly used in therapy; consequently, we aimed to understand the mechanisms underlying FQ resistance among the MDR isolates. The term MDR is referred to an isolate resistant to at least three drugs from a variety of antibiotic categories, mainly aminoglycosides, antipseudomonal penicillins, carbapenems, cephalosporins, and/or FQs.⁹

To this purpose, among the 833 isolates, we characterized the 45 P. aeruginosa MDR strains, resistant also to ciprofloxacin. As control, we utilized two MDR strains (no. 10 and 13) sensitive to ciprofloxacin. The source and the type of the 45 clinical samples are indicated in Table 2, whereas the drug resistance profile of P. aeruginosa strains selected for this study is shown in Table 3A, B. All the MDR isolates resistant to ciprofloxacin had an MIC ranging from 2 to 128 μg/ml, whereas the two isolates sensitive to ciprofloxacin, and strain ATCC27853, used as control, had an MIC of 0.06–0.125 μg/ml (Table 4). The sensitivity to colistin was also determined, as some strains appeared resistant to all drug tested (Table 3A, B; strain no. 25, 28, 42, and 51). All the isolates were found to be sensitive to colistin by E-test method.

Table 2.

List of Pseudomonas aeruginosa Clinical Isolates Used in This Work

Strains	Date of isolation	Specimen	Unit origin
1	20/03/2006	Urine	Cardiac surgery
2	23/03/2006	Pleural liquid	Cardiac surgery intensive care
3	24/03/2006	Respiratory sample	Respiratory disease unit
4	29/03/2006	Respiratory sample	Intensive care 2
5	05/04/2006	Respiratory sample	Intensive care 2
6	10/04/2006	Urine	Transplant Unit: infectious disease
7	10/04/2006	Urine	Intensive care 2
8	24/04/2006	Respiratory sample	Cardiac surgery intensive care
9	03/05/2006	Drainage liquid	Nefrology
10	04/05/2006	Respiratory sample	Intensive care 2
11	08/05/2006	Respiratory sample	Intensive care 2
12	17/05/2006	Blood	Cardiac surgery intensive care
13	17/05/2006	Respiratory sample	Intensive care 2
14	22/05/2006	Respiratory sample	Intensive care 2
15	25/05/2006	Urethra swab	Intensive care 2
16	31/05/2006	Blood	Cardiac surgery intensive care
17	13/06/2006	Blood	Cardiac surgery intensive care
18	22/06/2006	Wound swab	Cardiac surgery
20	10/07/2006	Prosthesis sample	Vascular surgery
21	14/07/2006	Blood	Cardiac surgery intensive care
22	04/12/2006	Respiratory sample	Cardiac surgery intensive care
23	04/12/2006	Respiratory sample	Intensive care 2
24	06/12/2006	Urethra swab	Intensive care 2
25	29/08/2008	Respiratory sample	Respiratory disease unit
26	03/09/2008	Wound swab	Infectious disease unit
28	08/09/2008	Respiratory sample	Intensive care 2
29	11/09/2008	Respiratory sample	Respiratory disease unit 3
30	12/09/2008	Skin swab	Mondino hospital, Pavia
31	29/09/2008	Pus	Infectious disease unit
32	06/10/2008	Respiratory sample	Intensive care 1
33	27/10/2008	Urine	Infectious disease unit
36	27/11/2008	Urine	Infectious disease unit
37	04/12/2008	Respiratory sample	Respiratory disease unit 1
38	31/12/2008	Wound swab	Nefrology
39	23/02/2008	Blood	Neurological clinic
40	11/08/2008	Blood	Intensive care 1
41	09/08/2008	Blood	Infectious disease unit
42	12/02/2007	Blood	Paediatric haematology
43	09/02/2007	Blood	Cardiac surgery intensive care
44	23/03/2007	Blood	Intensive care 1
45	28/03/2007	Blood	Cardiac surgery intensive care
46	29/03/2007	Blood	Intensive care 1
47	06/04/2007	Blood	Cardiac surgery intensive care
48	19/06/2007	Blood	Intensive care 1
49	12/07/2007	Blood	Intensive care 2
50	22/10/2007	Blood	Paediatric haematology
51	26/10/2007	Blood	Cardiac surgery

Table 3A.

Drug Resistance Profile of Pseudomonas aeruginosa Clinical Isolates (1–24)

	Pseudomonas aeruginosa clinical isolates
Drugs	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	20	21	22	23	24
Ampicillin	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Cefalotin	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Cefotaxime	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Gentamicin	R	R	S	R	R	R	R	R	R	S	R	R	S	R	R	R	R	R	R	R	S	R	R
Imipenem	R	R	R	R	R	S	R	R	R	R	R	R	R	R	R	R	R	R	S	R	R	R	R
Chloramphenicol	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Amikacin	I	S	S	R	R	S	R	S	S	S	R	S	S	R	R	S	S	S	S	S	S	R	R
Cotrimoxazole	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Ceftazidime	S	R	R	I	R	S	R	R	S	S	R	R	S	I	I	R	R	R	S	R	S	R	R
Amoxicillin/clavulanic acid	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Ciprofloxacin	R	R	R	R	R	R	R	R	R	S	R	R	S	R	R	R	R	R	R	R	R	R	R
Aztreonam	I	I	S	S	S	R	S	R	R	S	S	R	S	S	S	I	I	R	S	R	I	S	S
Piperacillin	S	R	R	S	S	S	S	R	S	S	S	R	S	S	S	R	R	R	S	R	S	S	S
Ceftriaxone	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Colistin	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S
Piperacillin/tazob	S	R	R	S	S	S	S	R	S	S	S	R	S	S	S	R	R	R	S	R	S	S	S
Meropenem	R	R	R	R	R	S	R	R	R	S	R	R	S	R	R	R	R	R	S	R	R	R	R

R, resistant; I, intermediate; S, susceptible.

Table 3B.

Drug Resistance Profile of Pseudomonas aeruginosa Clinical Isolates (25–51)

	P. aeruginosa clinical isolates
Drugs	25	26	28	29	30	31	32	33	36	37	38	39	40	41	42	43	44	45	46	47	48	49	50	51
Ampicillin	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Cefalotin	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Cefotaxime	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Gentamicin	R	S	R	R	R	R	R	S	R	R	R	R	R	R	R	R	R	R	R	R	R	R	S	R
Imipenem	R	S	R	R	S	S	S	S	R	R	S	S	R	R	R	R	R	R	R	R	R	S	R	R
Chloramphenicol	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Amikacin	R	S	R	R	S	S	R	S	S	R	S	S	R	S	R	R	R	S	R	R	R	S	S	I
Cotrimoxazole	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Ceftazidime	R	S	R	S	S	S	S	S	R	S	S	R	R	S	R	R	R	R	R	R	R	S	R	R
Amoxicillin/clavulanic acid	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Ciprofloxacin	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	I	R
Aztreonam	R	S	R	S	R	R	I	S	R	S	R	R	S	R	R	S	S	S	S	S	S	S	R	R
Piperacillin	R	S	R	S	S	S	S	S	R	S	S	S	R	S	R	S	S	R	S	S	S	S	R	R
Ceftriaxone	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R	R
Colistin	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S	S
Piperacillin/tazob	R	S	R	S	S	S	S	S	S	S	S	S	R	S	R	S	S	R	S	S	S	S	R	R
Meropenem	R	S	R	S	S	R	S	S	R	S	S	S	R	S	R	R	R	R	R	R	R	S	R	R

Table 4.

Characteristics of the Strains Analyzed in This Work

Strains	RAPD profile	Unit	GyrA	GyrB	ParC	ParE	MIC CIP (μg/ml)	MIC CIP (μg/ml) + MC207,110 (25 μg/ml)	Overexpression of efflux pumps (value of RT-PCR) ^*	Mutation in regulatory genes
ATCC	–	–	–	–	–	–	0.06–0.25	0.06–0.25	(1)
4	A	IC2	T83I	–	S87L	–	64	64
5		IC2	T83I	–	S87L	–	64	64
7		IC2	T83I	–	S87L	–	64	64
11		IC2	T83I	–	S87L	–	64	32
14		IC2	T83I	–	S87L	–	64	64
15		IC2	T83I	–	S87L	–	64	64
23		IC2	T83I	–	S87L	–	64	32
24		IC2	T83I	–	S87L	–	64	64
29		RD3	T83I	–	S87L	–	64	64
43		HSI	T83I	–	S87L	–	64	64
44		IC1	T83I	–	S87L	–	64	64
46		IC1	T83I	–	S87L	–	64	64
47		HSI	T83I	–	S87L	–	64	64
48		IC1	T83I	–	S87L	–	64	64
1	B	HS	T83I	E468D	S87W	–	>128	64
2		HSI	T83I	E468D	S87W	–	>128	64
8		HSI	T83I	E468D	S87W	–	>128	64
12		HSI	T83I	E468D	S87W	–	>128	64
16		HSI	T83I	E468D	S87W	–	>128	32	MexXY (2.89 ± 0.28)	G195E → MexZ
17		HSI	T83I	E468D	S87W	–	>128	32
21		HSI	T83I	E468D	S87W	–	>128	32
36		ID	T83I	E468D	S87W	–	>128	64
45		HSI	T83I	E468D	S87W	–	>128	64
51		HS	T83I	E468D	S87W	–	128	32	MexXY (2.57 ± 0.34)	G195E → MexZ
30		M	T83I	E468D	S87W	–	64	16
49		IC2	T83I	E468D	S87W	–	64	16
3	C	RD	T83I	–	S87L	–	8	4
39		NC	T83I	–	S87L	–	8	2
18		IS	T83I	–	S87L	–	32	4	MexXY (5.18 ± 0.67)	No mutation → MexZ
38		N	T83I	–	S87L	–	64	16
40		IC1	T83I	–	S87L	–	32	8
25	D	RD	T83I	–	–	A473V	2	1
26		ID	T83I	–	S87L	A473V	16–32	4–8	MexXY (9.41 ± 1.22)	Δnt291–301 → MexZ
6	E	T	T83I	–	S87W	–	64	16
20		V	T83I	–	S87W	–	128	16
32		IC1	T83I	–	S87W	–	64	16
33		ID	T83I	–	S87W	–	32	1	MexXY (3.25 ± 0.23)	G195E → MexZ
10	F	IC2	–	–	–	–	0.06	0.06	–
13		IC2	–	–	–	–	0.06	0.06
37	G	RD1	N87Y	–	–	–	2	1
9	H	N	T83I	–	S87L	–	16	2
22	I	HS1	T83I	–	–	–	8	2	–
41	L	ID	T83I	–	S87L	S457R	128	32
31	M	ID	T83I	–	–	–	8	≤0.03	MexCD (7.29 ± 0.91), MexAB (49.8 ± 9.67)	H109Y → NfxB; ΔG(165), V126E → MexR
28	N	IC2	T83I	–	S87L	–	64	8
42		PH	T83I	–	E91K	–	64	4	MexCD (14.42 ± 0.54)	H109Y → NfxB
50	O	PH	–	E468D	–	–	2	1

CIP, ciprofloxacin; IC2, intensive care 2; RD3, respiratory disease 3; HSI, cardiac surgery intensive care; IC1, intensive care 1; HS, heart surgery; ID, infectious disease unit; M, mondino hospital; RD, respiratory disease unit; NC, neurological clinic; N, nefrology; T, transplant unit: infectious disease; V, vascular surgery; PH, paediatric haematology; only the value of RT-PCR where overexpression of an efflux pump was detected are indicated; MIC, minimal inhibitory concentrations.

RAPD fingerprinting and analysis of resistance profiles

The 45 selected P. aeruginosa isolates were typed by RAPD fingerprinting.²⁷ Thirteen distinct RAPD profiles (referred to as A–O) were observed, a few of which are shown in Fig. 1.

FIG. 1.

Random amplification of polymorphic DNA (RAPD) patterns for Pseudomonas aeruginosa clinical isolates. (A) RAPD types of strains belonging to RAPD profiles A1 (strain no. 4, 5, 7, 11, 14, 15, 23, 24, and 29), E1 (strain no. 6, 20, and 32), and E2 (strain no. 33). (B) RAPD types of strains belonging to RAPD profiles B1 (strain no. 1, 2, 8, 12, 16, 17, and 21), C2 (strain no. 18), D1 (strain no. 25), D2 (strain no. 26), and F (strain no. 10 and 13). (C) RAPD types of strains belonging to RAPD profiles G (strain no. 37), H (strain no. 9), I (strain no. 22), N1 (strain no. 28), B2 (strain no. 30), and M (strain no. 31).

Six out of 13 RAPD profiles included single isolates (G–M, and O), whereas the other seven counted more isolates, suggesting that isolates sharing the same RAPD type might correspond to the same strain.

Analysis of the combined data reported in Table 4 revealed that some isolates, exhibiting the same RAPD profile (especially A and B), were collected from the same Unit, thus suggesting the spreading of similar strains in the Unit. Several strains belonging to RAPD profile A presented the same drug resistance phenotype (Tables 3A, B, and 4). The majority of strains belonging to RAPD profile B (no. 2, 8, 12, 16, 17, and 21) plus one strain from profile C were nonsusceptible to all the tested drugs with the exception of amikacin and colistin. In the RAPD profile B most of the isolates came from the Cardiac Surgery Intensive Care.

The data achieved show that strains belonging to the same RAPD profile very often shared a similar resistance profile and the same origin, suggesting the existence of a good correlation between RAPD types and antibiotic resistance profile.

As previously demonstrated for other bacterial species, the RAPD fingerprinting is an easy method able to differentiate unrelated strains and, consequently, useful to clarify P. aeruginosa epidemiology.

Identification of mutations in the genes coding for FQ target

Several mutations within the FQ-resistance-determining regions of gyrA, gyrB, parC, and parE have been described in FQ-resistant isolates of P. aeruginosa.^3,26 For this reason, these regions were sequenced in the 45 P. aeruginosa strains plus the two controls (no. 10 and 13). The results are shown in Table 4. All but two (no. 37 and 50) ciprofloxacin-resistant isolates had the same mutation (T83I) in gyrA, which has been shown to be commonly associated with high ciprofloxacin resistance level (from 2 to 64 mg/L).³⁶ In fact, the DNA gyrase is the primary FQ target in P. aeruginosa as the ciprofloxacin has the highest affinity for the A subunit of DNA gyrase.²⁶ Isolate no. 37 had a different mutation in gyrA (D87Y), which has been previously described,¹⁶ and a low FQ resistance level (2 μg/ml), whereas strain no. 50 was not mutated in gyrA. This last isolate had only a mutation in gyrB (E468D)³³ and a low FQ resistance level (2 μg/ml).

All the strains belonging to B profile were mutated in gyrA, gyrB (E468D), and in parC (S87W)² genes and they were characterized by a high resistance level (64 → 128 μg/ml) because of three mutated FQ targets (also in strains exhibiting D and L profiles). The same mutation in parC was present in all the strains belonging to profile E. A different mutation in parC was found in all the strains belonging to profile A, C, H, L, and N (S87L), and in one strain belonging to profile D (strain no. 26).² Mutation E91K² in parC was identified only in strain no. 42.

In general, the strains mutated both in gyrA and parC genes are linked to high-level of ciprofloxacin resistance,^26,29 as that described for profiles A, B, C, E, L, and N. In fact, strains harboring a wild-type parC gene did not show a high level of FQ resistance (strain no. 25, 37, and 50).

Mutations in gyrB and parE genes are less frequent than mutations in gyrA and parC and these are related to low level of FQ resistance.² Mutations in parE were present only in D (A473V)² and L (S457R) profiles. Until now, this last mutation in parE (S457R) has never been described. Indeed, two isolates exhibiting only mutations in gyrB or in parE (no. 50 and 25, respectively) had a low level of ciprofloxacin resistance (Table 4).

Effect of efflux inhibitors on ciprofloxacin resistance and MDR phenotype

To understand whether ciprofloxacin resistance was related also to efflux pump overexpression, we determined the MIC of ciprofloxacin in the presence of the efflux pump inhibitor MC207,110 in the entire panel of strains.¹⁹

The inhibitor did not decrease the ciprofloxacin MIC in FQ sensitive strains (ATCC27853 and no. 10 and 13) and in all strains belonging to RAPD profile A. This suggested that the ciprofloxacin resistance in the latter strains could not depend on an efflux pump overexpression, but only on the combination of mutations in two FQ target genes (gyrA and parC) (Table 4).

MC207,110 decreases the degree of resistance to ciprofloxacin of 2–8-fold in B-O profiles, suggesting the possible involvement of efflux pumps in drug resistance. In strain no. 33, the MIC of ciprofloxacin decreases of 32-fold in the presence of efflux inhibitor, whereas in strain no. 31 the MIC decreases of >266-fold, reaching the MIC value of P. aeruginosa wild type, thus suggesting a reasonable involvement of efflux pumps.

Detection of efflux pumps overexpression

To check whether overexpression of efflux pumps might represent one of the FQ resistance mechanisms of MDR clinical isolates analyzed in this work, real-time PCR experiments were performed on a panel of selected strains (no. 16, 18, 22, 26, 31, 33, 42, and 51). These strains were chosen as representative of the RAPD profiles where the effect of the efflux inhibitor was higher, which, in turn, might suggest an efflux pump overexpression. Two strains were chosen as control (ATCC27853 and isolate no. 10). The experiments were carried out as described in Materials and Methods by measuring the expression of the following genes: mexA, mexE, mexC, and mexX (in Table 4 only the cases with overexpression of an efflux pump are shown). Data obtained clearly indicated overexpression of one (or more) gene(s) coding for efflux pumps in seven of the eight MDR isolates tested. None of the eight clinical isolates overexpressed mexE.

To check whether overexpression might be due to a mutation in the corresponding regulatory gene, the gene encoding the transcriptional regulator of the efflux pump was sequenced. Data obtained revealed that six out of the seven strains presented at least one mutation (Table 4).

Strain no. 16, 18, 26, 33, and 51 showed overexpression of MexXY-OprM efflux pump. Three of them, no. 16, 33, and 51, shared the same mutation in the repressor MexZ (G195E), which is quite common in P. aeruginosa clinical isolates overexpressing the MexXY-OprMefflux pump.¹² Strain no. 26 showed a mutation in mexZ consisting of a deletion of a 11-nt spanning from nucleotide 291 to 301. This deletion causes a frameshift and hence a truncated protein with an alteration of the tridimensional conformation of the repressor such as it is not able to bind to the DNA regulatory region. This finding represents a novelty, since this mutation has not been described up to now. In fact, in the past Baum et al.⁴ described a P. aeruginosa clinical isolate with a deletion of only a single nucleotide at position 301 in mexZ gene. In all these isolates, the presence of the efflux inhibitor decreased ciprofloxacin MIC of 4–32-fold (Table 4).

Strain no. 31 and 42, overexpressing MexCD-OprJ efflux pump, had the same mutation in its repressor NfxB (H109Y). Even though several mutations in nfxB have been found in P. aeruginosa isolates overexpressing MexCD-OprJ, our finding represents a novelty, since this mutation has not been described up to now. Strain no. 31 overexpressed also MexAB-OprM efflux pump and had two mutations in the corresponding MexR repressor (ΔG(165) and V128E). This last strain was particularly intriguing; indeed, the ciprofloxacin MIC reverted to wild-type value in the presence of the inhibitor. McCay and collaborators²⁵ isolated a P. aeruginosa mutant overexpressing both MexAB-OprM and MexCD-OprJ efflux pumps. This strain showed a mutation in nfxB and no mutation in mexR.²⁵ Our mutant no. 31 had two regulators mutated responsible for overexpression of two efflux pumps

Discussion

The clinical utility of FQ for the treatment of P. aeruginosa and other serious Gram-negative infections is currently decreasing due to the rapid emergence of resistant strains.

In this study we performed a detailed analysis of the mechanisms that are involved in FQ resistance among P. aeruginosa MDR clinical isolates. The whole body of data reported in this work shed some light on the mechanisms responsible for FQ resistance in P. aeruginosa and highlighted the important role that both overexpression of efflux pumps and mutations in FQ target genes have for the development of MDR phenotype in these strains.

A panel of 45 clinical strains were characterized by RAPD profile, an easy method useful to clarify P. aeruginosa epidemiology. The most part of the clinical isolates exhibiting the same RAPD profile were collected from the same hospital Unit, thus suggesting the spreading of similar strains in the Unit. Moreover, several strains belonging to a same RAPD profile presented the same drug resistance phenotype.

The DNA gyrase is the primary FQ target in P. aeruginosa.²⁶ Accordingly, data obtained in this work revealed that, with the exception of the isolate no. 50, all the other ciprofloxacin-resistant isolates harbored a mutation in gyrA (T83I).

In general, beside the mutations in gyrA, also mutations in parC are linked to high level of ciprofloxacin resistance.²⁶ In fact, strains harboring a wild-type parC gene did not show a high level of FQ resistance (strain no. 25, 31, 37, and 50).

Mutations in gyrB and parE genes are less frequent than mutation in gyrA and parC and are related to low level of FQ resistance.²⁶ In agreement with this previous finding, isolate no. 50, which showed a low level of ciprofloxacin resistance, had mutations in gyrB and parE (Table 4).

To understand if the ciprofloxacin resistance was related also to efflux pump overexpression,¹⁹ the MIC of ciprofloxacin in the presence of efflux pump inhibitor, MC207,110, was determined for the entire panel of strains. In addition to this, real-time PCR of mexA, mexC, mexX, and mexE genes, as well as the PCR amplification and sequencing of the relative repressor gene, was performed on a subset of 10 strains.

Strain no. 42 overexpressed the MexCD efflux pump, which was very likely due to a mutation in the gene encoding the NfxB repressor (H109Y). Even though several mutations in nfxB have been found in P. aeruginosa isolates overexpressing MexCD,^11,30 our finding represents a novelty, since this mutation has not been described up to now.

Strain no. 31 was particularly intriguing; indeed, the ciprofloxacin MIC reverted to wild-type value in the presence of the inhibitor. Interestingly, this strain overexpressed both MexCD and MexAB transporters. Overexpression of the MexCD efflux pump was very likely related to a mutation in the gene encoding its repressor NfxB (H109Y), which is the same mutation found in strain no. 42. Concerning MexAB efflux pump, it is overexpressed at a very high level (49.8) because of two mutation in mexR. In addition to mutation V126E, which is frequent in clinical isolates overexpressing MexAB pump,^10,31 another new mutation ΔG(165) was found. Hence, overexpression of MexAB in this strain is very high maybe because the repressor had 2 mutations (Table 4).

Five MDR isolates (no. 16, 18, 26, 33, and 51) showed overexpression of MexXY efflux pump. Strain no. 26 showed the highest overexpression of MexXY efflux pump (Table 4). It was associated to a new mutation found in mexZ, a 11-nt deletion spanning from nucleotide 291 to 301, and this finding represents a novelty, since this mutation has not been described up to now.

Strain no. 18 did not harbor mutation in the mexZ gene. This finding indicates that a locus different from mexZ might be involved in MexXY overproduction in this strain. However, we cannot a priori exclude the possibility that a mutation might have fallen within the MexXY regulatory region where there is MexZ binding site.

In conclusion, this study presents some novelties: (1) the finding of new mutations in the genes encoding the repressors of efflux pumps (NfxB of MexCD and MexZ of MexXY); (2) the isolation of a strain that overexpresses both MexCD-OprJ and MexAB-OprM because of two mutated repressors. In this last isolate we saw that the contribution of efflux to FQ resistance is more relevant as the presence of the inhibitor restored the ciprofloxacin sensitivity in the strain.

Footnotes

Acknowledgments

This work was supported by Fondo d'Ateneo per la Ricerca (M.R.P., G.R.) and by a grant from Italian Cystic Fibrosis Research Foundation (FFC; Project FFC#15/2009, adopted by Pastificio Rana S.p.A.) (G.R.).

Disclosure Statement

No competing financial interests exist.

References

Adewoye

, Sutherland

, Srikumar

, Poole

2002. The mexR repressor of the mexAB-oprM multidrug efflux operon in Pseudomonas aeruginosa: characterization of mutations compromising activity. J. Bacteriol., 184:4308–4312.

Akasaka

, Tanaka

, Yamaguchi

, Sato

2001. Type II topoisomerase mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa isolated in 1998 and 1999: role of target enzyme in mechanism of fluoroquinolone resistance. Antimicrob. Agents Chemother., 45:2263–2268.

Alibert-Franco

, Pradines

, Mahamoud

, Davin-Regli

, Pagès

J.M.

2009. Efflux mechanism, an attractive target to combat multidrug resistant Plasmodium falciparum and Pseudomonas aeruginosa. Curr. Med. Chem., 16:301–317.

Baum

E.Z.

, Crespo-Carbone

S.M.

, Morrow

B.J.

, Davies

T.A.

, Foleno

B.D.

, He

, Queenan

A.M.

, Bush

2009. Effect of MexXY overexpression on ceftobiprole susceptibility in Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 53:2785–2790.

Cao

, Srikumar

, Poole

2004. MexAB-OprM hyperexpression in NalC-type multidrug-resistant Pseudomonas aeruginosa: identification and characterization of the nalC gene encoding a repressor of PA3720-PA3719. Mol. Microbiol., 53:1423–1436.

CLSI. 2005. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Sixth approved standard M7-A6. CLSI: Wayne, PA.

Evans

, Adewoye

, Poole

2001. MexR repressor of the mexAB-oprM multidrug efflux operon of Pseudomonas aeruginosa: identification of MexR binding sites in the mexA-mexR intergenic region. J. Bacteriol., 183:807–812.

Falagas

M.E.

, Bliziotis

I.A.

2007. Pandrug-resistant Gram-negative bacteria: the dawn of the post-antibiotic era? Int. J. Antimicrob. Agents, 29:630–636.

Falagas

M.E.

, Koletsi

P.K.

, Bliziotis

I.A.

2006. The diversity of definitions of multidrug-resistant (MDR) and pandrug-resistant (PDR) Acinetobacter baumannii and Pseudomonas aeruginosa. J. Med. Microbiol., 55:1619–1629.

10.

Gorgani

, Ahlbrand

, Patterson

, Pourmand

2009. Detection of point mutations associated with antibiotic resistance in Pseudomonas aeruginosa. Int. J. Antimicrob. Agents, 34:414–418.

11.

Higgins

P.G.

, Fluit

A.C.

, Milatovic

, Verhoef

, Schmitz

F.J.

2003. Mutations in GyrA, ParC, MexR and NfxB in clinical isolates of Pseudomonas aeruginosa. Int. J. Antimicrob. Agents, 21:409–413.

12.

Hocquet

, Nordmann

, El Garch

, Cabanne

, Plésiat

2006. Involvement of the MexXY-OprM efflux system in emergence of cefepime resistance in clinical strains of Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 50:1347–1351.

13.

Jeannot

, Sobel

M.L.

, El Garch

, Poole

, Plesiat

2005. Induction of the MexXY efflux pump in Pseudomonas aeruginosa is dependent on drug-ribosome interaction. J. Bacteriol., 187:5341–5346.

14.

Johansen

H.K.

, Moskowitz

S.M.

, Ciofu

, Pressler

, Høiby

2008. Spread of colistin resistant non-mucoid Pseudomonas aeruginosa among chronically infected Danish cystic fibrosis patients. J. Cyst. Fibros., 7:391–397.

15.

Köhler

, Epp

S.F.

, Curty

L.K.

, Pechère

J.C.

1999. Characterization of MexT, the regulator of the MexE-MexF-OprN multidrug efflux system of Pseudomonas aeruginosa. J. Bacteriol., 181:6300–6305.

16.

Kugelberg

, Löfmark

, Wretlind

, Andersson

D.I.

2005. Reduction of the fitness burden of quinolone resistance in Pseudomonas aeruginosa. J. Antimicrob. Chemother., 55:22–30.

17.

Lee

Y.C.

, Ahn

B.J.

, Jin

J.S.

, Kim

J.U.

, Lee

S.H.

, Song do

, Lee

W.K.

, Lee

J.C.

2007. Molecular characterization of Pseudomonas aeruginosa isolates resistant to all antimicrobial agents, but susceptible to colistin, in Daegu, Korea. J. Microbiol., 45:358–363.

18.

Levine

, Hiasa

, Marians

K.J.

1998. DNA gyrase and topoisomerase IV: biochemical activities, physiological roles during chromosome replication, and drug sensitivities. Biochim. Biophys. Acta, 1400:29–43.

19.

Lomovskaya

, Warren

M.S.

, Lee

, Galazzo

, Fronko

, Lee

, Blais

, Cho

, Chamberland

, Renau

, Leger

, Hecker

, Watkins

, Hoshino

, Ishida

, Lee

V.J.

2001. Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for combination therapy. Antimicrob. Agents Chemother., 45:105–116.

20.

Maniati

, Ikonomidis

, Mantzana

, Daponte

, Maniatis

A.N.

, Pournaras

2007. A highly carbapenem-resistant Pseudomonas aeruginosa isolate with a novel blaVIM-4/blaP1b integron overexpresses two efflux pumps and lacks OprD. J. Antimicrob. Chemother., 60:132–135.

21.

Maseda

, Yoneyama

, Nakae

2000. Assignment of the substrate-selective subunits of the MexEF-OprN multidrug efflux pump of Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 44:658–664.

22.

Masuda

, Sakagawa

, Ohya

, Gotoh

, Tsujimoto

, Nishino

2000. Contribution of the MexX-MexY-oprM efflux system to intrinsic resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 44:2242–2246.

23.

Matsuo

, Eda

, Gotoh

, Yoshihara

, Nakae

2004. MexZ-mediated regulation of mexXY multidrug efflux pump expression in Pseudomonas aeruginosa by binding on the mexZ-mexX intergenic DNA. FEMS Microbiol. Lett., 238:23–28.

24.

Matthaiou

D.K.

, Michalopoulos

, Rafailidis

P.I.

, Karageorgopoulos

D.E.

, Papaioannou

, Ntani

, Samonis

, Falagas

M.E.

2008. Risk factors associated with the isolation of colistin-resistant gram-negative bacteria: a matched case-control study. Crit. Care Med., 36:807–811.

25.

McCay

P.H.

, Ocampo-Sosa

A.A.

, Fleming

G.T.

2010. Effect of subinhibitory concentrations of benzalkonium chloride on the competitiveness of Pseudomonas aeruginosa grown in continuous culture. Microbiology, 156:30–38.

26.

Mesaros

, Nordmann

, Plésiat

, Roussel-Delvallez

, Van Eldere

, Glupczynski

, Van Laethem

, Jacobs

, Lebecque

, Malfroot

, Tulkens

P.M.

, Van Bambeke

2007. Pseudomonas aeruginosa: resistance and therapeutic options at the turn of the new millennium. Clin. Microbiol. Infect., 13:560–578.

27.

Mori

, Liò

, Daly

, Damiani

, Perito

, Fani

1999. Molecular nature of RAPD markers from Haemophilus influenzae Rd genome. Res. Microbiol., 150:83–93.

28.

Morita

, Sobel

M.L.

, Poole

2006. Antibiotic inducibility of the MexXY multidrug efflux system of Pseudomonas aeruginosa: involvement of the antibiotic-inducible PA5471 gene product. J. Bacteriol., 188:1847–1855.

29.

Mouneimné

, Robert

, Jarlier

, Cambau

1999. Type II topoisomerase mutations in ciprofloxacin-resistant strains of Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 43:62–66.

30.

Poole

, Gotoh

, Tsujimoto

, Zhao

, Wada

, Yamasaki

, Neshat

, Yamagishi

, Li

X.Z.

, Nishino

1996. Overexpression of the mexC-mexD-oprJ efflux operon in nfxB-type multidrug-resistant strains of Pseudomonas aeruginosa. Mol. Microbiol., 21:713–724.

31.

Quale

, Bratu

, Gupta

, Landman

2006. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother., 50:1633–1641.

32.

Rossolini

G.M.

, Mantengoli

2005. Treatment and control of severe infections caused by multiresistant Pseudomonas aeruginosa. Clin. Microbiol. Infect., 11:17–32.

33.

Sekiguchi

, Teruya

, Horii

, Kuroda

, Konosaki

, Mizuguchi

, Araake

, Kawana

, Yoshikura

, Kuratsuji

, Miyazaki

, Kirikae

2007. Molecular epidemiology of outbreaks and containment of drug-resistant Pseudomonas aeruginosa in a Tokyo hospital. J. Infect. Chemother., 13:418–422.

34.

Sobel

M.L.

, Hocquet

, Cao

, Plesiat

, Poole

2005. Mutations in PA3574 (nalD) lead to increased MexAB-OprM expression and multidrug resistance in laboratory and clinical isolates of Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 49:1782–1786.

35.

Srikumar

, Paul

C.J.

, Poole

2000. Influence of mutations in the mexR repressor gene on expression of the MexA-MexB-OprM multidrug efflux system of Pseudomonas aeruginosa. J. Bacteriol., 182:1410–1414.

36.

Takenouchi

, Sakagawa

, Sugawara

1999. Detection of gyrA mutations among 335 Pseudomonas aeruginosa strains isolated in Japan and their susceptibilities to fluoroquinolones. Antimicrob. Agents Chemother., 43:406–409.

37.

Westfall

L.W.

, Carty

N.L.

, Layland

, Kuan

, Colmer-Hamood

J.A.

, Hamood

A.N.

2006. mvaT mutation modifies the expression of the Pseudomonas aeruginosa multidrug efflux operon mexEF-oprN. FEMS Microbiol. Lett., 255:247–254.

38.

Wolter

D.J.

, Smith-Moland

, Goering

R.V.

, Hanson

N.D.

, Lister

P.D.

2004. Multidrug resistance associated with mexXY expression in clinical isolates of Pseudomonas aeruginosa from a Texas hospital. Diagn. Microbiol. Infect. Dis., 50:43–50.