Detection of Streptococcus pneumoniae and Identification of Pneumococcal Serotypes by Real-Time Polymerase Chain Reaction Using Blood Samples from Italian Children ≤5 Years of Age with Community-Acquired Pneumonia

Abstract

Streptococcus pneumoniae is a leading cause of severe life-threatening infections. Laboratory identification and serotyping of this pathogens is desirable to monitor vaccine impact and coverage; however, especially in pediatric patients, the yield of traditional microbiological diagnostic procedures can be very low. The aim of this study was to develop real-time polymerase chain reaction (PCR)-based assays to be performed directly on blood samples to identify the most common capsular serotypes causing pneumonia in Italian children (≤5 years of ages) after the introduction of the 7-valent conjugate vaccine. Our real-time PCR-based assays showed high sensitivity (at least 35 fg of pneumococcal DNA), and they were validated with 49 well-characterized pneumococcal isolates, 8 nonpneumococcal isolates, 13 simulated blood clinical samples loaded with S. pneumoniae of known serotypes, and 46 blood clinical samples. All the strains tested and the simulated blood clinical samples were correctly typed by the technique. Real-time PCR allowed serotyping in 37/46 children ≤5 years of age (80.4%) in whom pneumonia was diagnosed in four Italian hospitals. Non-PCV7 serotypes accounted for at least 47.8% (22/46) of cases, serotype 19A being the most common (34.7%, 16/46). Although, it is not known at present whether the incidence of 19A serotype is attributable to the use of PCV7 only, expanding pneumococcal serotype coverage has clearly the potential to prevent a larger number of pneumonias in Italian children less than ≤5 years of age. Molecular methods are of increasing importance in the diagnosis of pneumococcal pneumonia and in monitoring serotype distribution and replacement.

Introduction

S treptococcus pneumoniae is a leading cause of severe life-threatening infections particularly among young children, the elderly, and the immunocompromised.²⁸ Since 2000, the7-valent pneumococcal conjugate vaccine (PCV7) was introduced for routine use in infants and high-risk children in the United States and, subsequently, in other countries, Italy included.

The use of this vaccine led to a dramatic decrease in the rate of invasive pneumococcal diseases (IPDs) in adults and children in those countries where the vaccine has been administered to most of the child population in the first year of life.²²

However, several PCV7 postlicensure studies in the United States and European countries have described a substantial increase in non-PCV7 serotypes (serotype replacement), mainly serotype 19A, in both disease and asymptomatic carriage.^11,23 Recently, PCV13 (13-valent pneumococcal conjugate vaccine), with expanded coverage, has been introduced to replace PCV7.¹

Nowadays, accurate serotyping is essential to monitor pneumococcal serotype distribution, the ecological impact of conjugate vaccines, and their coverage.

Serotyping is generally performed by various methods (capsular swelling reaction, agglutination, dot blot assay, and molecular typing) requiring clinical isolates.¹⁸ However, the yield of these microbiological diagnostic procedures can be low, especially in pediatric patients¹⁴ and polymerase chain reaction (PCR)-based assays performed directly on clinical samples, not requiring viable bacteria are of particular interest.

Real-time PCR offers a series of advantages over conventional PCR, the most important being its lower limit of detection. Real-time PCR-based assays for direct detection of pneumococci and serotyping from clinical samples, therefore, represent an important tool in the diagnosis and epidemiology of invasive pneumococcal infections.

Recently, a few different real-time PCR approaches have been developed for the detection and serotyping of S. pneumoniae in different clinical samples.^4,13,20,27 In this study, novel, sensitive, and specific real-time PCR assays on whole blood samples for the identification of the most common serotypes causing IPDs are described and validated on bacterial strains, simulated blood clinical samples, and blood clinical samples.

Materials and Methods

Bacterial strains

An American Type Culture Collection (ATCC) S. pneumoniae 49619 (serotype 19F), a panel of 49 well-characterized clinical isolates of S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7A, 7F, 8, 9A, 9N, 9V, 10A, 13, 14, 15B, 15C, 18C, 19A, 19F, 23F, 33F (two strains each) and 22F, 23A, 35F (one strain each), and 8 nonpneumococcal isolates (2 S. mitis, 2 S. oralis, 2 S. gordonii, and 2 Staphylococcus epidermidis) stored in germ bank at the Sezione di Microbiologia DISC, University of Genoa, Italy, were used to assess the ability of the primer/probe set to detect S. pneumoniae belonging to the most common capsular serotypes causing IPDs.^15,16

All pneumococcal strains were identified by conventional techniques² including optochin susceptibility, bile solubility, and the Quellung reaction using antisera purchased from the Statens Serum Insitute as previously described.¹⁶

In addition, all the pneumococcal isolates were positive with real-time PCR assays detecting lytA and CpsA genes.

Serotypes other than 4, 6A/B, 9V, 14, 18C, 19F, and 23F were defined as non-PCV7 serotypes. When it was not possible, due to technical limitations, to identify specific PCV7 serotypes within a serogroup, data were not interpreted in terms of PCV7 coverage.

DNA extraction from bacterial strains

DNA extraction was performed using the Roche High Pure PCR Template Preparation (Roche Diagnostics) according to the manufacturer's instructions.

DNA extraction from whole blood

Bacterial DNA extraction from whole blood was performed using the Roche High Pure PCR Template Preparation (Roche Diagnostics) according to the manufacturer's instructions and with a two-step elution.

Laboratory blood samples

To evaluate any possible amplification interference by substances present in whole blood, each serotyping real-time PCR assay was carried out using whole blood from 5 healthy subjects, 26–28 years of age (negative controls), and simulated clinical samples (positive controls). Positive controls were prepared as follows: 0.5 ml aliquots of normal whole blood obtained from healthy subjects were seeded with serial 10-fold dilutions of a 0.5 McFarland standard of S. pneumoniae strains belonging to the 13 serotypes included in the PCV13, down to approximately one cell per microliter of blood.

Clinical blood samples and patients

Forty-six whole blood EDTA specimens from 46 pediatric patients (≤5 years of age, mean age 2.3 ± 1.2 years, range 15 days–4.8 years), out of 347 consecutively admitted with clinical signs, symptoms, and chest radiographs consistent with community-acquired pneumonia (CAP) to 4 Italian hospitals (Ospedale Maggiore Policlinico, Milan, Ospedale Giannina Gaslini, Genoa, Ospedale Bambino Gesù, Rome, Azienda Ospedaliera di Padova) from February 2009 through June 2010 were used. The 46 specimes were selected because of laboratory-confirmed presence of S. pneumoniae in whole blood by cultural and/or molecular test (real-time PCR amplification of both lytA and cpsA genes).

Blood culture findings were positive in 8.7% (4/46) of the patients with detectable S. pneumoniae DNA (46/46) by molecular test.

Ten out of 46 patients were admitted with a diagnosis of complicated CAP because of the presence of empyema.

Eighteen patients had completed the national vaccination schedule (18/46, 39.1%) and were considered fully vaccinated, 9 patients (19.6%) were incompletely vaccinated (they had started but not completed the vaccine schedule), 18 were nonvaccinated (39.1%), and the vaccination status was unknown for one patient (2.2%).

Blood cultures (0.5–4 ml of whole bood per bottle) were performed using the BacT/ALERT, BioMérieux, and BacTec 9240, Becton-Dickinson. For molecular test, the real-time PCR assays described next were used.

Whole blood EDTA samples (1.5–2 ml) were drawn on the same day as blood cultures and shipped at controlled temperature to the Sezione di Microbiologia DISC, University of Genoa, where they were extracted promptly to avoid possible degradation of pneumococcal DNA.

The study was approved by the ethics boards of the four participating hospitals, and the parents of the patients signed an informed consent.

Capsular and autolysin gene real-time PCR assay for the detection of S. pneumoniae

Primers and probes (TIB Molbiol, Genoa, Italy) used for the lytA and wzg (cpsA) genes were those described by Sheppard et al.²⁶ and Tarragó et al.²⁷ respectively, with small changes to the reaction mixture and cycling conditions. DNA was amplified using LightCycler 2.0 (Roche).

All runs included a negative water control and a positive control (an appropriate diluition of S. pneumoniae ATCC 49619 genomic DNA). S. pneumoniae genomic DNA was prepared as described by Park et al.²⁰ A standard curve was created with concentrations from approximately 10 million genomic copies to approximately 10 genomic copies of S. pneumoniae. If no increase in fluorescent signal was observed after 45 cycles, the amplification was assumed to be negative. Each sample was tested in triplicate. A sample was considered positive if at least two of three tests yielded positive results.

An internal amplification control (IAC) was deliberately not used in the reaction to maximize sensitivity, because an IAC has been shown to reduce assay sensitivity due to the intrinsic competitive nature of the technique.¹² An external standard control was used.

Development of real-time PCR assays for the determination of pneumococcal serotypes

S. pneumoniae serotyping was performed using primers and probes designed on the basis of the different capsular type sequences in the GenBank database (www.ncbi.nml.nih.gov) and synthesized by TIB Molbiol, Genoa, Italy. Analytical specificity of primers and probes was pre-evaluated with computer-aided analysis using Primer-BLAST(www.ncbi.nml.nih.gov/tools/primer-blast) and BLAST (blast.ncbi.nml.nih.gov(Blast.cgi) and comparing all used sequences with all sequences in “bacteria” and “homo sapiens” Genebank Primers and probes used in this study; their target genes and the numbered base positions of probes are shown in Table 1. The cycling conditions of each serotype are shown in Table 2.

Table 1.

Oligonucleotide Primers and Probes for Each Serotypes

Serotype	Target gene	Forward\reverse primers sequences (5′–3′)	Probe (nucleotide position)
1	wgd (cpsK)	CgATACATCTTCAgTCgAggCT (13805–13826)\ggTTATCATATAACgCTTTTgACTCC (13986–13961)	FAM- CCTCCgTACTgACTTTgTATATCCAACAggAACAg-BBQ (13916–13882)
3	wchE (cap3;cpsS)	CgCAgAgTgATATTACAgTTCTAg (7361–7384)\CACgAgATTACgCTCAgggTCAAg (7509–7486)	FAM- TtgCTgAAgCCTTTTgTTTgCgAT-BBQ (7426–7449)
4	wciJ (cpsF; wchF)	CCTgggAAggTACAATCTTATATg\(7063–7086) TgCCAATTCgggACTAACA (7194–7171)	FAM- CaggAgATgCTAAAATAATTgTAgAAgAAgCAAATTgT—BBQ (7118–7155)
5	wzg (cpsA)	ggTAATgAAgCTTATCgAgATgCTg\(12909–12933) TCCCgTAAAAATTCAggACTAAAgA (13144–13120)	FAM- AgCAgATTATTgCggTTAATTTgAAggC—BBQ (13015–13042)
6	wxiP (cpsS)	CATgCATTgCTAgAgATggTTCC\(8889–8831) CCATgTCTTCgATACAAgACCAg (8963–8941)	FAM61-a+At+Aa+Ctatc+Atgag+Cc+Agtt—BBQ (8890–8870) FAM-62 a+At+A+A+Tt+Atc+At+Gag+Ac+Agtt—BBQ (8788–8768) a mixture 50%FAM61 +50% FAM62 was used
7F/A	wcwA	CCATgCAAgCAAgCACAgT\(8294–8312) gAAAAgCgATAgAATTgggATTC (8449–8427)	FAM-c+T+At+Tcc+Ag+A+Ag+A+A+Tctc—BBQ (8327–8344)
9V/A	udg (cpsK)	gATACACTTTTCATgggAgTAACg\(17250–17273) CAATACCCACCgTAgCCAAAgg (17458–17437)	FAM-TTgATggTATTggCCTAgATCCACgTATAggAAA—BBQ (17386–17419)
14	wzy	ggTAgCAATgCgACACgC\(7899–7916) TgTgACCCCAATAATATATCTACTg (8020–7966)	FAM-AATggAATggAAATgTTACTTggCGCAgg—BBQ (7995–7978)
18C/B	gct	AATTTAgTAgAAgCTATTCgATATgTC\(15787–15813) CAAATTTACCTTTCCAATCATCAC (15916–15893)	FAM-a+Aagt+Cag+Atgtt+Aa+Aga+Ctac—BBQ (15849–15870)
19A	wchO	ggAATTAATgCTgTgTTTATggg\(7346–7368) CCTACAAAATAACgCTTAAAgAgACg (7500–7475)	FAM-CCACTCTAggTgAgCATTTTgCATCCAT—BBQ (7447–7420)
19F/B	wchO	AATTCggTATTTATgggAgTTgg (8975–8997)\CCTACAAAATAACgTTTAAAgAgACg (9123–9098)	CCACTCTAAATTTgACTTTTgCATCCATAgAggT (9070–9037)
23F^a	wchV	ggAggCTCTATgTgAgATgTTTTATC\(9985–10010) gTCTCTATCCgAAAATTTCTTTgTTg (10222–10197)	LC Red 640- ATTTgCTCTTCgAAAAATgTg- PH (10116–10136) FL-gTAggTAAgCTATTTgAAgATAgTgCgATTATg (10082–10114)

FRET probe.

Table 2.

Cycling Conditions for Serotyping Real-Time Polymerase Chain Reaction

Assay	Steps	Cycle	Temperature (°C)	Time
4, 5, 7F/A, 14	Denaturation	1	95	8 minutes
	Cycling	50	95	5 seconds
			64	20 seconds
			72	1 second
19A	Denaturation	1	95	8 minutes
	Cycling	50	95	5 seconds
			64	20 seconds
			72	4 seconds
1, 3, 9V/A	Denaturation	1	95	8 minutes
	Cycling	50	95	5 seconds
			66	20 seconds
			72	1 second
6	Denaturation	1	95	8 minutes
	Cycling	50	95	5 seconds
			62	20 seconds
			72	1 second
18C/B	Denaturation	1	95	8 minutes
	Cycling	50	95	5 seconds
			58	20 seconds
			72	1 second
19F/B	Denaturation	1	95	8 minutes
	Cycling	50	95	5 seconds
			61	20 seconds
			72	1 second
23F	Denaturation	1	95	8 minutes
	Cycling	55	95	5 seconds
			62	5 seconds
			72	4 seconds

For all PCRs, the reaction mixture consisted of 1× FastStart DNA Master hybridization probe mixture (Roche Diagnostics), 3.5 mmol/L MgCl₂, 0.5 μmol/L of each primer, and 0.2 μmol/L of each hybridization probe (Table 1). Five microliters of DNA extract or water were added to the 20-μL LightCycler reaction capillary containing 15-μL reaction mixture. An IAC was not used in the reaction to maximize sensitivity.

All runs included a negative water control and a positive control (an appropriate diluition of S. pneumoniae (serotype 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F genomic DNA).

A standard curve was created with concentrations from approximately 10 million genomic copies to approximately 10 genomic copies of S. pneumoniae belonging to each specific serotype. If no increase in fluorescent signal was observed after 45 cycles (Fret probes) or 50 cycles (TaqMan probes), the amplification was assumed to be negative. A sample was considered positive if at least two of three tests yielded positive results, as just described.

Specificity determinations were made by testing at 5 mg/L the DNAs extracted from all S. pneumoniae isolates of the serotype panel and eight nonpneumococcal isolates (2 S. mitis, 2 S. oralis, 2 S. gordonni, and 2 Staphylococcus epidermidis) in all 8 assays. In addition, tests were carried out using DNAs extracted from13 simulated whole blood clinical samples, belonging to the 13 serotypes included in the 13PCV, prepared as just described, and from whole blood of five healthy individuals.

Results

Validation of real-time PCR assays for the determination of pneumococcal serotypes

All assays allowed the detection of a minimum of 35fg of DNA corresponding to approximately 16 genome copies.

All strains of the serotypes included in the specificity panel tested were correctly typed by the technique described here, whereas the pneumococcal strains of serotypes not included in the panel tested and microorganisms of the other species tested (S. mitis, S. oralis and S. gordoni, and Staphylococcus epidermidis) were negative in all real-time PCR typing assay, as well as DNAs extracted from blood samples from healthy individuals demonstrating a high specificity of the primers/probe sequences used. No interferences (no false positives nor false negatives) were observed when DNAs, extracted from simulated blood samples containing pneumococcal cells belonging to serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F, were tested.

Clinical samples serotyping

Real-time PCR allowed serotyping in 37/46 patients (80.4%) (Table 3). The most common serotypes identified were 19A (16/46, 34.7%), 14 (9/46, 19.6%), and 7F/A (3/46, 6.5%). The remaining serogroups/seotypes (1, 3, 4, 6, 9, 19F, and 23F) accounted for 17.3%. Non-PCV7 serotypes accounted for at least 47.8% (22/46) of cases.

Table 3.

Serotyping Real-Time Polymerase Chain Reaction Results for 46 Streptococcus pneumoniae Positive Clinical Blood Samples

Serotype/serogroup	No of positive samples
1	1
3	2
4	1
6	2
7F/A	3
9V/A	1
14	9
19 A	16
19F/B	1
23F	1
Not typable^a	9
Total	46

Not typable indicates that the serotype could not be identified by the panel of real-time polymerase chain reaction assays used.

Serotype19A was found to be the most common serotype irrespectively of the vaccination status of the patients (38.9% among vaccinated and 18.5% among unvaccinated or incompletely vaccinated children) and of the severity of the infection (50% in complicated and 30.5% in uncomplicated pneumonia).

In two out of four cases of culture-positive blood tested, the S. pneumoniae strains were available and were sent to our laboratory for serotyping. No discrepancies were observed between the serotyping results obtained with the Quellung technique and the real-time PCR assays, using the DNA extracted from the corresponding EDTA-blood sample.

Discussion

It is well known that blood cultures in pneumonia, especially in children, have little impact on patient care due to several factors such as a long time-to-results and lack of sensitivity.^5,17,24

Non-culture-based diagnostic real-time PCR technique has been shown to allow the accurate and rapid quantification of pneumococcal DNA load in different clinical samples, whole blood included.^13,25,27 In addition, it has been demonstrated that, using lytA as the target gene and real-time PCR, pneumococcal DNA is never found in the blood of healthy children, regardless of their carrier state, supporting the use of real-time PCR for pneumococcal diagnostic purposes.³

In agreement with previously reported data, the molecular assay used in this study compared very favorably with blood cultures, exceeding the sensitivity of culture.^13,25

Recently, the knowledge of serotype distribution has become of crucial importance to evaluate the impact of universal infant immunization with PCV7 on invasive serotypes distribution and to predict the potential coverage and the impact of the newly introduced PCV13. It is well known that since the introduction of PCV7, the overall rate of IPDs declined in U.S. children less than 5 years of age by 75%.²² However, serotype replacement occurred, leading to an increase in IPDs due to serotypes not contained in PCV7.^6,21

Traditional serotyping (capsular swelling reaction) requires clinical isolates and suffers some limitations.¹⁰ Cross-reaction between serotypes can occur, and administration of antibiotics before blood culture collection could lead to an overestimation of the role of resistant serotypes and an underestimation of the importance of susceptible serotype.²⁷ The use of PCR to amplify capsular genes of pneumococcal isolates improves serotyping specificity, but again it depends on the availability of culturable bacteria.¹⁹

A few studies showed that real-time PCR, using DNA extracted from clinical samples, offers an interesting opportunity to determine S. pneumoniae serotypes, providing results that more accurately reflect the actual serotype distribution than those obtained by conventional non-molecular methods.^25,27 The assays described in this article allowed serotyping in 37/46 patients (80.4%), whereas, at best, the cultural method would have allowed serotyping in 4/46 (8.7%) patients only.

As suggested by other authors, the impossibility of serotyping by real-time PCR all samples could be due to the presence of serotypes that are not included in the panel used or to a bacterial load below the limit of sensitivity of the PCR assays used.²⁵ In nine blood samples that could be not serotyped by real-time PCR, the cycle number needed to reach the baseline threshold value in lytA and cpsA real-time PCR was always higher than 36, suggesting a very low bacterial load. A limitation of this and other molecular serotyping studies^25,27 is the impossibility to distinguish between serotypes included in certain serogroups because of technical caveats. However, despite this limitation, the molecular method gives more informative epidemiological data than traditional serotyping.

The main finding of our study is that more than 47% of pneumonia cases in children ≤5 years of age were due to non-PCV7 serotypes and that serotype 19A was the most frequent serotype found among both fully vaccinated, unvaccinated, and incompletely vaccinated children and irrespectively of the severity of the illness (complicated and uncomplicated pneumonia). Our previous studies showed that in the prevaccine era in Italy (2000–2002), 19A was already one of the most frequent serotypes (ranking sixth in frequency) causing diseases in children (0–16 years).¹⁵ It is unlikely that the observed increase is attributable to the use of PCV7 only. As suggested by other authors, antibiotic use, the development of resistance in this serotype, clonal expansion, and serotype switching may all have contributed to the present scenario.^7–9 Recently, Resti and colleagues used real-time PCR to serotype pneumococcal pneumonia in 80 children (0–16 years of age) admitted to Italian hospitals. In that study, in contrast with our results, serotype 1 was the most frequent serotype found, whereas serotype19A was second in frequency. However, in that study, serotype 1 was significantly associated with complications and older age (mean age 6 years), and it was never found in children aged <2 years, whereas 19A was significantly associated with younger age. In our study, the mean age of the patients was 2.3 years, and 10 out of 46 cases of pneumonia could be defined as complicated. This, in part, could explain the discrepancy between the two studies observed. Further data are needed to draw statistically significant conclusions.

Lastly, since IPD attributable to serotypes not included in the PCV7 have increased in frequency and PCV7 has been shown to be ineffective against vaccine-related serotype 19A (i.e., no cross-protection), vaccines with expanded coverage such as PCV-13 are likely to significantly reduce the burden of pneumococcal disease in Italian children.

Footnotes

Disclosure Statement

All the authors disclose that they have no commercial associations that might create a conflict of interest in connection with this article.

References

American Academy of Pediatrics Committee on Infectious Diseases. 2010. Recommendations for the prevention of Streptococcus pneumoniae infections in infants and children: use of 13-valent pneumococcal conjugate vaccine (PCV13) and pneumococcal polysaccharide vaccine (PPSV23) Pediatrics, 126:186–190.

Arbique

J.C.

, Poyart

, Trieu-Cuot

, Quesne

, Carvalho Mda

, Steigerwalt

A.G.

, Morey

R.E.

, Jackson

, Davidson

R.J.

, Facklam

R.R.

2004. Accuracy of phenotypic and genotypic testing for identification of Streptococcus pneumoniae and description of Streptococcus pseudopneumoniae sp. nov. J. Clin. Microbiol., 42:4686–4696.

Azzari

, Cortimiglia

, Moriondo

, Canessa

, Lippi

, Ghiori

, Becciolini

, de Martino

, Resti

2011. Pneumococcal DNA is not detectable in the blood of healthy carrier children. J. Med. Microbiol. 10.1033/jmm.0.028357-0

Azzari

, Moriondo

, Indolfi

, Cortimiglia

, Canessa

, Becciolini

, Lippi

, De Martino

, Resti

2010. Realtime PCR is more sensitive than multiplex PCR for diagnosis and serotyping in children with culture negative pneumococcal invasive disease. PLoS One, 5:e9282.

Campbell

S.G.

, Marrie

T.J.

, Anstey

, Dikinson

, Ackroyd-Stolarz

2003. The contribution of blood cultures to the clinical management of adult patients admitted to the hospital with community-acquired pneumonia: a prospective observational study. Chest, 123:1142–1150.

Centers for Disease Control and Prevention. 2010. Invasive pneumococcal disease in young children before licensure of 13-valent pneumococcal conjugate vaccine: United States, 2007. MMWR Morb. Mortal. Wkly. Rep., 59:253–257.

Croucher

N.J.

, Harris

S.R.

, Fraser

, Quail

M.A.

, Burton

, Van Der Linden

, McGee

, Von Gottberg

, Song

J.H.

, Ko

K.S.

, Pichon

, Baker

, Parry

C.M.

, Lambertsen

L.M.

, Shahinas

, Pillai

D.R.

, Mitchell

T.J.

, Dougan

, Tomasz

, Klugman

K.P.

, Parkhill

, Hanage

W.P.

, Bentley

S.D.

2011. Rapid pneumococcal evolution in response to clinical interventions. Science, 331:430–434.

Dagan

2009. Serotype replacement in perspective. Vaccine, 27,Suppl 3:C22–C24.

Hanage

W.P.

, Bishop

C.J.

, Huang

S.S.

, Stevenson

A.E.

, Pelton

S.I.

, Lipsitch

, Finkelstein

J.A.

2010. Carried Pneumococci in Massachusetts children: the contribution of clonal expansion and serotype switching. Pediatr. Infect. Dis. J., 30:302–308.

10.

Henrichsen

1999. Typing of Streptococcus pneumoniae: past, present, and future. Am. J. Med., 107:50S–54S.

11.

Hicks

L.A.

, Harrison

L.H.

, Flannery

, Hadler

J.L.

, Schaffner

, Craig

A.S.

, Jackson

, Thomas

, Beall

, Lynfield

, Reingold

, Farley

M.M.

, Whitney

C.G.

2007. Incidence of pneumococcal disease due to non-pneumococcal conjugate vaccine (PCV7) serotypes in the United States during the era of widespread PCV7 vaccination, 1998–2004. J. Infect. Dis., 196:1346–1354.

12.

Hoorfar

, Malorny

, Abdulmawjood

, Cook

, Wagner

, Fach

2004. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J. Clin. Microbiol, 42:1863–1868.

13.

Kee

, Fatovich

D.M.

, Palladino

, Kay

I.D.

, Pryce

T.M.

, Flexman

, Murray

, Waterer

G.W.

2010. Specificity of a quantitative real-time polymerase chain reaction assay for the detection of invasive pneumococcal disease: identifying Streptococcus pneumoniae using quantitative polymerase chain reaction. Chest, 137:243–244.

14.

Korppi

, Leinonen

, Ruuskanen

2008. Pneumococcal serology in children's respiratory infections. Eur. J. Clin. Microbiol. Infect. Dis., 27:167–175.

15.

Marchese

, Gualco

, Cochetti

, Montanari

M.P.

, Speciale

A.M.

, Musumeci

S.R.

, Varaldo

P.E.

, Nicoletti

, Schito

G.C.

2005. Antibiotic susceptibility and serotype distribution in Streptococcus pneumoniae circulating in Italy: results of the SEMPRE surveillance study (2000–2002) Int. J. Antimicrob. Agents., 26:138–145.

16.

Marchese

, Tonoli

, Balistreri

, Debbia

E.A.

, Schito

G.C.

2000. Antibiotic susceptibility patterns and serotypes of antibiotic resistant and/or invasive Streptococcus pneumoniae strains circulating in Italy. Microb. Drugs Resist., 6:163–170.

17.

Michelow

I.C.

, Lozano

, Olsen

, Goto

, Rollins

N.K.

, Ghaffar

, Rodriguez-Cerrato

, Leinonen

, McCracken

G.H.

Jr.

2002. Diagnosis of Streptococcus pneumoniae lower respiratory infection in hospitalized children by culture, polymerase chain reaction, serological testing, and urinary antigen detection. Clin. Infect. Dis., 34:E1–E11.

18.

Murray

P.R.

2007. Manual of Clinical Microbiology, 9th. ASM Press: Washington, DC.

19.

Pai

, Gertz

R.E.

, Beall

2006. Sequential multiplex PCR approach for determining capsular serotypes of Streptococcus pneumoniae isolates. J. Clin. Microbiol., 44:124–131.

20.

Park

H.K.

, Lee

H.J.

, Kim

2010. Real-time PCR assays for the detection and quantification of Streptococcus pneumoniae. FEMS Microbiol. Lett., 310:48–53.

21.

Park

S.Y.

, Van Beneden

C.A.

, Pilishvili

, Martin

, Facklam

R.R.

, Whitney

C.G.

2010. Active Bacterial Core Surveillance Team. Invasive pneumococcal infections among vaccinated children in the United States. J. Pediatr., 156:478.e2–483.e2.

22.

Pilishvili

, Lexau

, Farley

M.M.

, Hadler

, Harrison

L.H.

, Bennett

N.M.

, Reingold

, Thomas

, Schaffner

, Craig

A.S.

, Smith

P.J.

, Beall

B.W.

, Whitney

C.G.

, Moore

M.R.

2010. Active Bacterial Core Surveillance/Emerging Infections Program Network. Sustained reductions in invasive pneumococcal disease in the era of conjugate vaccine. J. Infect. Dis., 201:32–41.

23.

Reinert

, Jacobs

M.R.

, Kaplan

S.L.

2010. Pneumococcal disease caused by serotype 19A: review of the literature and implications for future vaccine development. Vaccine, 28:4249–4259.

24.

Resti

, Micheli

, Moriondo

, Becciolini

, Cortimiglia

, Canessa

, Indolfi

, Bartolini

, De Martino

, Azzari

2009. Comparison of the effect of antibiotic treatment on the possibility of diagnosing invasive pneumococcal disease by culture or molecular methods: a prospective, observational study of children and adolescents with proven pneumococcal infection. Clin. Ther., 31:1266–1273.

25.

Resti

, Moriondo

, Cortimiglia

, Indolfi

, Canessa

, Becciolini

, Bartolini

, Benedictis

F.M.

, De Martino

, Azzari; Italian Group for the Study of Invasive Pneumococcal Disease

2010. Community-acquired bacteremic pneumococcal pneumonia in children: diagnosis and serotyping by real-time polymerase chain reaction using blood samples. Clin. Infect. Dis., 51:1042–1049.

26.

Sheppard

C.L.

, Harrison

T.G.

, Morris

, Hogan

, George

R.C.

2004. Autolysin-targeted LightCycler assay including internal process control for detection of Streptococcus pneumoniae DNA in clinical samples. J. Med. Microbiol., 53:189–195.

27.

Tarragó

, Fenoll

, Sánchez-Tatay

, Arroyo

L.A.

, Muñoz-Almagro

, Esteva

, Hausdorff

W.P.

, Casal

, Obando

2008. Identification of pneumococcal serotypes from culture-negative clinical specimens by novel real-time PCR. Clin. Microbiol. Infect., 14:828–834.

28.

World Health Organization (WHO). 2007. Pneumococcal conjugate vaccine for childhood immunization-WHO position paper. Wkly. Epidemiol. Rec., 82:93–104.