Prevalence of OXA-Type β-Lactamases Among Acinetobacter baumannii Isolates from Northwest of Iran

Abstract

Carbapenems have been considered as last line antibiotics for treatment of multidrug-resistant (MDR) Acinetobacter baumannii but carbapenem resistant A. baumannii has been increased during the last decade in many parts of the world. OXA-type β-lactamase enzymes are the most common cause of carbapenem resistance in A. baumannii and presence of ISAba1 in upstream of these genes may increase the expression of these OXA genes. The aim of this study was to determine, for the first time, the antibiotic resistance pattern and prevalence of OXA type β-lactamases among nosocomial A. baumannii isolates from northwest of Iran. A total of 100 A. baumannii isolates were recovered from hospitalized patients in a university hospital in northwest of Iran. Sixty-two percent of isolates were resistant to imipenem. All isolates carried bla_OXA-51-like gene. Among imipenem resistant isolates, 88.7% carried bla_OXA-23-like, 1.6% carried bla_OXA-40-like, and 3.2% had bla_OXA-58-like resistance genes. Ninety percent of isolates contained ISAba1 element and in 74.2% of imipenem resistant isolates, ISAba1 was located in upstream of bla_OXA-23-like. The results of this study demonstrated high prevalence of OXA-type carbapenemase among MDR A. bumanii in the Northwest of Iran.

Introduction

A cinetobacter baumannii is a gram-negative, nonmotile, and nonfermentative coccobacilli that is involved in nosocomial infections especially in intensive care unit (ICU) wards.^1,11 This bacterium is the causative agent of several types of infections including pneumonia, meningitis, bacteremia, and urinary tract infections.⁸

Carbapenems are among the drugs of choice for treatment of infections caused by multi resistant gram-negative bacilli,²² but carbapenem resistance in A. baumannii has been increased worldwide during the last decade. There are different mechanisms involved in resistance to carbapenem antibiotics in A. baumannii among them production of OXA-type β-lactamases is the most prevalent.^19,21 At the present five groups of OXA-type β-lactamases has been described in A. baumannii: OXA-23-like; OXA-40-like; OXA-51-like; OXA-58-like, and OXA-143-like.^10,31

The first description of OXA type β-lactamase in A. baumannii was from Scotland in 1985 that was initially named ARI-1; this gene was later sequenced and named OXA-23.^6,17 In recent years, OXA-23-producing A. baumannii strains have been reported from different parts of the world.¹⁵ A second group of OXA type β-lactamases is OXA-40-like that was initially found in carbapenem resistant A. baumannii from Spain.² It shares 60% amino acid identity with OXA-23 and is coded chromosomally or by plasmid. The third group comprises of OXA-51-like that naturally occurs in A. baumannii, hence is chromosomally located. This gene shows 56% and 63% amino acid identity with OXA-23 and OXA-40-like respectively.¹⁸ The fourth group is OXA-58-like that was recently identified in France.²⁰ This enzyme is often plasmid mediated and shares <50% amino acid identity with the other three groups,¹⁸ and recently, OXA-143 a fifth enzyme was identified in a clinical A. baumannii isolate from Brazil. It shares 88% amino acid identity with OXA-40, 63% with OXA-23, and 52% with OXA-58.¹⁰

Insertion sequences (ISs) are the smallest and the most abundant transposable elements. These elements contain strong promoters that play a major role in the expression of the antibiotic resistance genes located downstream from the site of insertion of these mobile elements.¹² Recently an IS that is named ISAba1 was identified in A. baumannii.⁴ It has been recently suggested that presence of ISAba1 in upstream of the OXA type β-lactamases genes can increase the expression of these genes.^5,28 ISAba1 might act as a strong promoter that promotes increasing of expression of genes situated downstream from the site of insertion.²⁸ The role of ISAba1 in the expression of the antibiotic resistance gene of A. baumannii has also been demonstrated for AmpC encoding gene, the naturally occurring cephalosporinase.⁴

The aim of this study was to investigate the prevalence of OXA-type β-lactamases and the presence of ISAba1 in upstream of these genes among A. baumannii isolates in hospitalized patients in the northwest of Iran.

Materials and Methods

Bacterial isolation and identification

In this prospective study between March 2008 and June 2009 a total of 100 consecutive, nonduplicate A. baumannii isolates were recovered from clinical specimens of hospitalized patients in Imam Reza hospital (a 580-bed referral hospital with four 12-bed ICUs. The isolates were obtained from invasive and noninvasive sites which include blood, tracheal aspirates, wound, sputum, abscess drainage, wound, bronchial washing, and urine. The samples were transferred to the laboratory of the Department of Microbiology in the faculty of Medicine and were immediately inoculated in MacConkey and blood agars.

The initial identification of isolates was carried out using standard microbiological and biochemical methods which include gram-stain, colony morphology, glucose oxidation, citrate utilization, oxidase test, and growth ability at 44°C.¹ Then identification of A. baumannii was confirmed using bla_OXA-51 PCR.²⁹

Antibiotic susceptibility testing

To determine antibiotic susceptibility pattern of isolates, disc diffusion testing was carried out using Clinical Laboratory Standard Institute (CLSI) guidelines (2006).³ Antibiotic discs used were ceftriaxone (30 μg), ceftazidime (30 μg), cefepime (30 μg), trimethoprim-sulfamethoxazole (1.25/23.75 μg), gentamicin (10 μg), amikacin (30 μg) ciprofloxacin (5 μg), levofloxacin (5 μg), ampicillin-sulbactam (10/10 μg), pipracillin (100 μg), piperacillin-tazobactam (100/10 μg), ticarcillin-clavulanic acid (75/10 μg), imipenem (10 μg), meropenem (10 μg), colistin (10 μg), and polymyxin B (300 units; MAST, Merseyside, United Kingdom). The discs were placed on Mueller Hinton agar plates inoculated with bacterial suspension equal to 0.5 McFarland and incubated at 37°C overnight. The diameter of the zone of growth inhibition was measured using the CLSI guidelines (2006).³ Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as controls. Isolates resistant to two or more classes of antibiotics were classified as multidrug resistant strains.¹⁸

PCR analysis

All A. baumannii isolates were grown for 24 hrs at 37°C in MacConkey agar. DNA was extracted by boiling method. PCR was performed using specific primers,²⁵ with an automated thermal cycler (Eppendorf, Hamburg, Germany) in the PCR cycling conditions: an initial denaturation at 94°C for 4 min followed by 35 cycles of denaturation at 94°C for 1 min, annealing at specific temperature for each gene for 1 min (Table 1), and extension at 72°C for 1 min with a final extension cycle at 72°C for 7 min. Gel electrophoresis was performed for 90 min in a 1.2% agarose gel at 85 V. The genes investigated were consisted of bla_OXA-23-like, bla_OXA-40-like, bla_OXA-51-like, bla_OXA-58-like, and ISAba1 (Table 1).²⁵ A. baumannii reference strains NCTC 12516, NCTC 13305, NCTC 13304, and NCTC 13302 were used as positive controls for the bla_OXA-51-like, bla_OXA-58-like, bla_OXA-23-like, and bla_OXA-40-like, respectively.

Table 1.

Primers Used for Detection of OXA-Type β-Lactamases and ISAba1 Sequence in Acinetobacter baumannii

Primers	Sequence (5′-3′)	Product size (bp)	Annealing temperature (°C)
OXA51 F	AACAAGCGCTATTTTTATTTCAG	641	51
OXA51 R	CCCATCCCCAACCACTTTT
OXA58 F	AGTATTGGGGCTTGTGCT	453	49
OXA58 R	AACTTCCGTGCCTATTTG
OXA40 F	ATGAAAAAATTTATACTTCCTATATTCAGC	825	56
OXA40 R	TTAAATGATTCCAAGATTTTCTAGC
OXA23 F	GATGTGTCATAGTATTCGTCGT	1,057	54
OXA23 R	TCACAACAACTAAAAGCACTGT
ISAba1 F	CATTGGCATTAAACTGAGGAGAAA	451	53
ISAba1 R	TTGGAAATGGGGAAAACGAA

To determine the association between ISAba1 and bla_OXA-23-like, bla_OXA-58-like, and bla_OXA-51-like genes, PCR mapping was performed using ISAba1 forward primer and OXA23, OXA51, and OXA-58 reverse primers for imipenem resistant A. baumannii isolates (Table 1).²⁵ PCR reactions were performed with the PCR cycling conditions: an initial cycle of denaturation at 94°C for 4 min followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 54°C (ISAba1F/OXA23R), 55°C (ISAba1F/OXA51R, and ISAba1F/OXA58R) for 1 min and extension at 72°C for 1 min with a final extension cycle at 72°C for 5 min.

Results

A total of 100 A. baumannii isolate were recovered from different clinical specimens including: tracheal aspirate (37%), urine (21%), sputum (9%), blood (7%), bronchial washing (6%), catheter (6%), wound (5%), abscess drainage (3%), cerebrospinal fluid (2%), pleural effusion (2%), and ascitic fluid (2%). Seventy two (72%) patients were male and 28% were female. The mean age of patients was 51±18.45 years. A. baumannii isolates were obtained from different hospital wards as follows; ICU wards (37%), neurosurgery (26%), internal wards (24%), infectious wards (9%), general surgery unit (3%), and ENT (1%).

Screening for bla_OXA-51-like gene revealed that all isolates were positive for this gene and confirmed them as A. baumannii.

Results of antimicrobial susceptibility testing in this study showed that the lowest rate of resistance was seen against colistin (19%) and polymixin B (16%). In addition, 62% of isolates were resistant to imipenem and meropenem (Table 2).

Table 2.

Results of Antibiotic Susceptibility Testing of 100 Acinetobacter baumannii Isolates Collected from a Hospital in Northwest of Iran

Antimicrobial agent	Resistance (%)	Antimicrobial agent	Resistance (%)
Ceftazidime	92	Gentamicin	86
Ceftriaxone	94	Piperacillin	92
Cefepime	88	Piperacillin-tazobactam	89
Amikacin	81	Ticarcillin-clavulanic acid	83
Ciprofloxacin	86	Meropenem	62
Levofloxacin	84	Imipenem	62
Ampicillin-sulbactam	80	Colistin	19
Trimethoprim-sulfamethoxazole	88	Polymixin B	16

Of 62 imipenem and meropenem resistant isolates, 55 isolates (88.7%) carried bla_OXA-23-like. One isolate (1.6%) carried bla_OXA-40-like and two isolates (3.2%) had bla_OXA-58-like genes. Ninety (90%) of isolates contained ISAba1 (Table 3).

Table 3.

Distribution of OXA-Type β-Lactamase Genes in Imipenem Resistant Acinetobacter baumannii Isolates

Resistance determinants	Cases (no.)	Percent
bla_OXA-51-like only	1	1.6
bla_OXA-51-like+bla_OXA-40-like	1	1.6
bla_OXA-51-like+bla_OXA-58-like	2	3.2
bla_OXA-51-like+bla_OXA-23-like	9	14.5
bla_OXA-51-1ike+ISAba1- bla_OXA-23-like	46	74.2
bla_OXA-51-1ike+ISAba1- bla_OXA-51-like	3	4.8
Total	62	100

According to the PCR mapping results, by using ISAba1 forward and OXA-23 reverse primers, 46 isolates (74.2%) gave a band of 1.5 kb whereas 3 isolates (4.8%) gave a band of 1.1 kb, by using ISAba1 forward and OXA-51 reverse primers. In this study of 55 A. baumannii isolates that contained blaOXA_-23-like gene, in 46 isolates (83.6%) ISAba1 was located in upstream of this gene.

Discussion

A. baumannii is one of the most important gram negative bacteria that is involved in nosocomial infections especially in ICU wards. The finding of this study showed that a third of A. baumannii isolates (37%) were obtained from hospitalized patients in ICU wards. This result is in line with previous report about the role of A. baumannii in ICU infections.^7,16

Results of this study revealed that 62% of isolates were resistant to imipenem. In other studies previously done in Iran, the resistance rate of A. baumannii isolates to imipenem has been reported as 27.7% and 52%, respectively.^7,24,27 These results indicate that the rate of resistance to carbapenems has been significantly increased. Results of studies from other countries also show that resistance rate to carbapenems in recent years has been increased.^9,26

Results of PCR amplification for detection of bla_OXA-51-like revealed that all A. baumannii isolates had bla_OXA-51 gene. This finding supports the proposal that bla_OXA-51-like gene is ubiquitous in A. baumannii.²⁹

OXA-23-like was the first OXA-type β-lactamase that identified in A. baumannii.¹⁷ In our study, 88.7% of imipenem resistant A. baumannii isolates had bla_OXA-23 like gene. This is significantly higher than the rate of bla_OXA-23-like gene reported from central part of Iran (25%).^7,27 The prevalence of OXA-23 in Turkey in the northwest of Iran and next to Tabriz city was 59.1%.⁹ This similarity in the rate of OXA-23 in these two regions could be explained by proximity of Turkey to Tabriz city and high communication between people of these regions; however this hypothesis requires typing of the isolates. Outbreaks of bla_OXA-23-producing carbapenem resistant A. baumannii isolates have been recently reported from many countries and this gene has found a worldwide dissemination.¹⁵ In studies conducted by Mak et al. and Zhou et al., 87.5% and 94% of imipenem resistant isolates had bla_OXA-23-like gene, respectively.^13,32

In this study bla_OXA-40-like was isolated only from one isolate (1.6%) which was much lower than the rate of this gene reported from Tehran in central part of Iran.^7,27 The highest prevalence of bla_OXA-40-like gene have been reported from European countries such as Spain and Portugal.^23,25

In this study, we identified bla_OXA-58-like gene only in two A. baumannii isolates (3.6%) that was lower than the rate (9%) previously reported from central Iran.^7,27 In studies conducted by Ruiz et al. in Spain and Vahaboglu et al. in Turkey, 19% and 17% of isolates contained bla_OXA-58-like, respectively.^25,30

Recently an IS element named ISAba1 was identified in A. baumannii.⁴ ISAba1 has been associated with overexpression of resistance genes such as AmpC, bla_OXA-23-like, and bla_OXA-51-like, which confer resistance to carbapenems.^4,5,28 PCR amplification of ISAba1 in this study detected this IS in 90% of A. baumannii isolates. This result is in agreement with other studies that have found ISAba1 in most of A. baumannii isolates, for example, Ruiz et al. and Turton et al. detected ISAba1 in 74.7% and 84% of isolates, respectively.^25,28 Results of PCR mapping revealed that most of resistant A. baumannii isolates (74.2%) had ISAba1 in upstream of bla_OXA-23-like gene. This finding is somewhat similar to results of studies done in other countries. In these studies 52.6%, 86%, and 94% of imipenem resistant isolates had ISAba1 in upstream of A. baumannii isolates, respectively.^13,28,32 These results indicate that ISAba1 is associated with bla_OXA-23-like gene in most cases and may be involved in overexpression of this gene.

Out of 55 A. baumannii isolates that contained bla_OXA-23-like, 83.6% (46/55) had ISAba1 in upstream of this gene. This result is in agreement with the results obtained by other researchers. Zhou et al. and Turton et al. reported that 97.5% and 100% of isolates with bla_OXA-23-like contained ISAba1 in upstream of bla_OXA-23-like gene.^28,32 These results show that ISAba1 might also be responsible for the transposition and mobility of bla_OXA-23-like.¹⁴

It has been reported that the expression of bla_OXA-51 gene in most cases is low.²⁸ In this study we detected bla_OXA-51-like gene in all A. baumannii isolates, but only three isolates that were resistant to imipenem had ISAba1 in upstream of bla_OXA-51-like gene. These findings indicate that the presence of bla_OXA-51-like gene alone is not sufficient to explain resistance to carbapenem antibiotics but presence of ISAba1 in upstream of bla_OXA-51-like may involve in overexpression of this gene and induction of resistance to imipenem.

Findings of this study revealed that none of the two isolates with bla_OXA-58-like had ISAba1 in upstream of bla_OXA-58 gene, which means that the role of other ISs such as ISAba2, ISAba3, other ISs, and hybrid ISs in overexpression of this gene should be studied.¹⁸

In conclusion, this study revealed for the first time the status of OXA-type β-lactamase genes in A. baumannii isolates in northwest of Iran. This study also showed that bla_OXA-23-like gene was the most prevalent carbapenemase among imipenem-resistant A. baumannii isolates in this area and the most of the bla_OXA-23-like producing isolates carried ISAba1 in upstream of this gene. The high frequency of bla OXA-23 with ISAbaI in our institution is a cause of concern, considering a likely clonal dissemination; efforts to control the transmission should be considered.

Footnotes

Acknowledgments

This study was supported by a research grant from Infectious and Tropical Diseases Research Center of Tabriz University of Medical Sciences, Tabriz, Iran (Grant no. 21168). We thank Dr. Mohammad Mehdi Feizabadi and Morovat Taherikalani for gift of the A. baumannii reference strains.

Disclosure Statement

No competing financial interests exist.

References

Bergogne-Bérézin

, Towner

K.J.

1993. Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin. Microbiol. Rev., 9:148–165.

Bou

, Oliver

, Martinez-Beltran

2000. OXA-24, a novel class D beta-lactamase with carbapenemase activity in an Acinetobacter baumannii clinical strain. Antimicrob. Agents Chemother., 44:1556–1561.

Clinical, Laboratory Standard Institute (CLSI). 2006. Performance standards for antimicrobial susceptibility testing: 16th Informational Supplement Document M100-S16. CLSI: Wayne, PA.

Corvec

, Caroff

, Espaze

2003. AmpC hyperproduction in Acinetobacter baumannii clinical isolates. J. Antimicrob. Chemother., 52:629–635.

Corvec

, Poirel

, Naas

, Drugeon

, Nordmann

2007. Genetics and expression of the carbapenem-hydrolyzing oxacillinase gene bla_OXA-23 in Acinetobacter baumannii. Antimicrob. Agents Chemother., 51:1530–1533.

Donald

H.M.

, Scaife

, Amyes

S.G.B.

, Young

H.K.

2000. Sequence analysis of ARI-1, a novel OXA beta-lactamase, responsible for imipenem resistance in Acinetobacter baumannii. Antimicrob. Agents Chemother., 44:196–199.

Feizabadi

M.M.

, Fathollahzadeh

, Taherikalani

, Rasoolinejad

, Sadeghifard

, Aligholi

, Soroush

, Mohammadi-Yegane

2008. Antimicrobial susceptibility patterns and distribution of bla_OXA genes among Acinetobacter spp. isolated from patients at Tehran hospitals. Jpn. J. Infect. Dis., 61:274–278.

Fournier

P.E.

, Richet

2006. The epidemiology and control of Acinetobacter baumannii in health care facilities. Clin. Infect. Dis., 42:692–699.

Gur

, Korten

, Unal

, Deshpande

, Castanheira

2008. Increasing carbapenem resistance due to the clonal dissemination of oxacillinase (OXA-23 and OXA-58)-producing Acinetobacter baumannii: report from the Turkish SENTRY Program site. J. Med. Microbiol., 57:1529–1532.

10.

Higgins

P.G.

, Poirel

, Lehmann

, Nordmann

, Seifert

2009. OXA-143, a novel carbapenem-hydrolyzing class D β-lactamase in Acinetobacter baumannii. Antimicrob. Agents Chemother., 53:5035–5038.

11.

Katsaragakis

, Markogiannakis

, Toutouzas

K.G.

, Drimousis

, Larentzakis

, Theodoraki

E.M.

, Theodorou

2008. Acinetobacter baumannii infections in a surgical intensive care unit: predictors of multi-drug resistance. World J. Surg., 32:1194–1202.

12.

Mahillon

, Chandler

1998. Insertion sequensce. Microbiol. Mol. Biol. Rev., 62:725–774.

13.

Mak

J.K.

, Kim

M.J.

, Pham

, Tapsall

, White

P.A.

2009. Antibiotic resistance determinants in nosocomial strains of multidrug-resistant Acinetobacter baumannii. J. Antimicrob. Chemother., 63:47–54.

14.

Mugnier

P.D.

, Poirel

, Pitout

, Nordmann

2008. Carbapenem resistant and OXA-23-producing Acinetobacter baumannii isolates in the United Arab Emirates. Clin. Microbiol. Infect., 14:879–882.

15.

Mugnier

P.D.

, Poirel

, Naas

, Nordmann

2010. Worldwide dissemination of the bla_OXA-23 carbapenemase gene of Acinetobacter baumannii. Emerg. Infect. Dis., 16:35–40.

16.

Papa

, Koulourida

, Souliou

2009. Molecular epidemiology of carbapenem-resistant Acinetobacter baumannii in a newly established Greek hospital. Microb. Drug Resist., 15:257–260.

17.

Paton

, Miles

R.S.

, Hood

, Amyes

S.G.B.

1993. ARI-1: β-lactamase-mediated imipenem resistance in Acinetobacter baumannii. Int. J. Antimicrob. Agents, 2:81–87.

18.

Peleg

A.Y.

, Seifert

, Paterson

D.L.

2008. Acinetobacter baumannii: emergence of a successful pathogen. Clin. Microbiol. Rev., 21:538–582.

19.

Perez

, Hujer

, Decker

, Rather

, Bonomo

2007. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob. Agents Chemother., 51:3471–3484.

20.

Poirel

, Marqué

, Héritier

, Segonds

, Chabanon

, Nordmann

2005. OXA-58, a novel class D b-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob. Agents Chemother., 49:202–208.

21.

Poirel

, Nordmann

2006. Carbapenem resistance in Acinetobacter baumannii: mechanism and epidemiology. Clin. Microbiol. Infect., 12:826–836.

22.

Quale

, Bratu

, Landman

, Heddurshetti

2003. Molecular epidemiology and mechanisms of carbapenem resistance in Acinetobacter baumannii endemic in New York City. Clin. Infect. Dis., 37:214–220.

23.

Quinteira

, Grosso

, Ramos

, Peixe

2007. Molecular epidemiology of imipenem-resistant Acinetobacter haemolyticus and Acinetobacter baumannii isolates carrying plasmid-mediated OXA-40 from a Portuguese hospital. Antimicrob. Agents Chemother., 51:3465–3466.

24.

Rahbar

, Monnavar

K.M.

, Vatan

K.K.

, Fadaei-haq

, Shakerian

2008. Carbapenem resistance in gram-negative bacilli isolates in an Iranian 1000-bed Tertiary Hospital. Pak. J. Med. Sci., 24:537–540.

25.

Ruiz

, Marti

, Fernandez-Cuenca

, Pascual

, Vila

2007. High prevalence of carbapenem-hydrolysing oxacillinases in epidemiologically related and unrelated Acinetobacter baumannii clinical isolates in Spain. Clin. Microbiol. Infect., 13:1192–1198.

26.

Stoeva

, Higgins

P.G.

, Savov

, Markovska

, Mitov

, Seifert

2009. Nosocomial spread of OXA-23 and OXA-58 beta-lactamase-producing Acinetobacter baumannii in a Bulgarian hospital. J. Antimicrob. Chemother., 63:618–620.

27.

Taherikalani

, Fatolahzadeh

, Emaneini

, Soroush

, Feizabadi

M.M.

2009. Distribution of different carbapenem resistant clones of Acinetobacter baumannii in Tehran hospitals. New Microbiol., 32:265–271.

28.

Turton

J.F.

, Ward

M.E.

, Woodford

, Kaufmann

M.E.

, Pike

, Livermore

D.M.

, Pitt

T.L.

2006. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol. Lett., 27:351–353.

29.

Turton

J.F.

, Woodford

, Glover

, Yarde

, Kaufmann

M.E.

, Pitt

T.L.

2006. Identification of Acinetobacter baumannii by detection of the bla_OXA-51-like carbapenemase gene intrinsic to this species. J. Clin. Microbiol., 44:2974–2976.

30.

Vahaboglu

, Budak

, Kasap

, Gacar

, Torol

, Karadenizli

, Kolayli

, Eroglu

2006. High prevalence of OXA-51-type class β-lactamases among ceftazidime-resistant clinical isolates of Acinetobacter spp.: co-existence with OXA-58 in multiple centres. J. Antimicrob. Chemother., 58:537–542.

31.

Walther-Rasmussen

, Høiby

2006. OXA-type carbapenemases. J. Antimicrob. Chemother., 57:373–383.

32.

Zhou

, Pi

B.R.

, Yang

, Yu

Y.S.

, Chen

Y.G.

, Li

L.J.

, Zheng

S.S.

2007. Dissemination of imipenem-resistant Acinetobacter baumannii strains carrying the ISAba1 bla_OXA-23 genes in a Chinese hospital. J. Med. Microbiol., 56:1076–1080.