Abstract
The objectives of this study were to investigate the prevalence of plasmid-mediated quinolone resistance genes in a collection of 226 extended-spectrum β-lactamase (ESBL)–producing Enterobacteriaceae isolates and characterize the qnr-positive isolates. The rate of qnr-positive isolates was 21.6% (49/226), 49.5% for aac(6′)-Ib-cr (112/226), and 1.7% for qepA1 (4/226). Those isolates carried qnr genes corresponding to types qnrB (71.4%), qnrS1 (24.4%), and qnrA1 (18.3%). The distribution among bacterial species was as follows: 55.8% (19/34) to Enterobacter cloacae, 50% (28/56) to Klebsiella pneumoniae, and 1.4% (2/136) to Escherichia coli. The characterization of qnr-positive isolates indicated the ESBL SHV-types as the most prevalent (81.6%), including the ESBLs SHV-12, SHV-5, and SHV-2a, followed by CTX-M-15 (44.9%) and TLA-1 (8.1%). In addition, for qnr-positive isolates, the prevalence of aac(6′)-Ib-cr was 55.1%, but qepA was not identified. Alterations at codons Ser-83 and Asp-87 in GyrA and at codons Ser-80 in ParC were observed in 69% and 80% of the qnr-positive isolates, respectively. The analysis of the transconjugants revealed a cotransmission of blaCTX-M-15 with qepA1 or aac(6′)-Ib-cr and/or qnrA1 and blaSHV-type with qnrB5 and qnrB6 genes. To conclude, these findings indicate a high prevalence of qnr and aac(6′)-Ib-cr among ESBL-producing isolates from Mexican hospitals and point to the wide spread of qnr-like determinants associated to ESBLs SHV- and CTX-M-type in Mexican clinical isolates.
Introduction
Materials and Methods
Clinical isolates included in the study
This study evaluated 226 ESBL-producing Enterobacteriaceae isolates collected from eight hospitals in five regions of Mexico: northwest (Instituto de Seguridad y Servicios Sociales de los Trabajadores del Estado [ISTE-S]), Sonora; west (Hospital Civil de Guadalajara [HCG-J]), Jalisco; center (Instituto Nacional de Cancerología [INCan-DF], and Sanatorio Durango [SD-DF]), México Distrito Federal; south (Hospital General de Acapulco [CGA-G]), Guerrero; and north (Hospital de Altas Especialidades No. 25 del IMSS [HAE-NL], Hospital San Juan Tecnológico [HSJT-NL], and Centro Regional de Control de Enfermedades Infecciosas [CRCEI]), Monterrey Nuevo León. Only one isolate was permitted per patient and the culture sources included blood, urine, secretion, catheter, and other sites. All isolates were sent to the National Institute of Public Health in Morelos, Mexico, where identification was confirmed and all data were integrated into a centralized database.
Three bacterial species were included: ESBL-producing Escherichia coli (136 isolates), ESBL-producing K. pneumoniae (56 isolates), and ESBL-producing Enterobacter cloacae (34 isolates). All isolates were collected between March 2005 and June 2009. The distribution of the isolates according to the hospital is shown in Table 1. The ESBL production was detected in E. coli and K. pneumoniae isolates according to the Clinical and Laboratory Standards Institute (CLSI) methodology (M100-S21). 7 Cefotaxime (30 μg), cefotaxime–clavulanic acid (30/10 μg), ceftazidime (30 μg), and ceftazidime–clavulanic acid (30/10 μg) discs were used. An increase of >5 mm in the inhibition zone of the combination disc compared with the cephalosporin-only disc suggested an ESBL-producing organism.
Bacterial species not collected in the hospital.
1. ISTE-S, ISSSTESON, Hermosillo, Son; 2. HCG-J, Hospital Civil de Guadalajara Fray Antonio Alcalde, Guadalajara, Jal; 3. INCan-DF, Instituto Nacional de Cancerología, México, DF; 4. HGA-G, Hospital General de Acapulco, Acapulco, Gro; 5. HAE-NL, Hospital de Altas Especialidades No. 25 del IMSS, Monterrey, NL; 6. HSJT-NL, Hospital San Jose Tecnologico, Monterrey, NL; 7. CRCEI, Centro Regional de Control de Enfermedades Infecciosas, Monterrey, NL; 8. SD-DF, Sanatorio Durango, México, DF.
The primers used for qnr-determinants prevalence are listed in the appendix Table 1.
Screening of PMQR genes in clinical isolates
The qnrA, qnrB, qnrS, qnrC, and qnrD genes were screened by separated multiplex polymerase chain reaction (PCR) 5 and confirmed by single PCR, and the qepA and aac(6′)-Ib-cr genes were analyzed by single PCR with specific primers for each gene (Appendix Table 1). The aac(6′)-Ib-cr gene was differentiated from the wild-type gene by PCR digestion with BstI5 enzyme and confirmed by nucleotide sequence. The qepA gene was amplified using a 1× enhancer buffer (Invitrogen). All PCR products were purified by means of High-Pure PCR Product Purification Kit (Roche Applied Science), sequenced using chain termination method with a Big-Dye Terminator kit (Applied Biosystems), and analyzed on an ABIPRISMA 3100 (Applied Biosystems). The nucleotide sequences were compared on GenBank database by means of BLASTx searches.
Analysis for qnr-positive isolates
The β-lactamase genes encoding for ESBL blaCTX-M, blaSHV, and blaTLA were screened by PCR using specific primers (Appendix Table 1). The minimum inhibitory concentrations (MICs) against nalidixic acid, ciprofloxacin, levofloxacin, cefotaxime, ceftazidime, and gentamicin were determined by agar dilution plate method following the CLSI and were interpreted according to CLSI performance standard M100-S21. 7 The antimicrobials were supplied and stored according to the manufacturer's instructions. E. coli 25922 was used as reference strain for susceptibility testing.
PCR amplification of the quinolone resistance–determining regions (QRDRs) of the gyrA and parC genes (except parC of E. cloacae) were performed with specific primers (Appendix Table 1). Both strands of the purified PCR products were sequenced and the DNA sequences were analyzed by BLASTx for the identification of QRDRs of GyrA and ParC protein and were compared with the protein sequences of K. pneumoniae and E. coli GyrA and ParC proteins deposited in the GenBank, respectively.
The quinolone resistance transfer genes were assayed by mating experiments, as described by Miller, 18 in 21 qnr-positive isolates, which were selected according to the hospital of origin and clonal relationship. Conjugation experiments were performed using azide-resistant E. coli J53, and transconjugants were selected on LB plates containing sodium azide (100 μg/ml); nalidixic acid (8 μg/ml) or ampicillin (100 μg/ml) and cefotaxime (1 μg/ml) were used for counterselection of plasmid-mediated quinolone and cephalosporin resistance. The phenotype resistance transferred was determined using LB agar plates with eight different types of antibiotics: nalidixic acid (8 μg/ml), ciprofloxacin (0.5 μg/ml), ampicillin (100 μg/ml), cefotaxime (1 μg/ml), tetracycline (15 μg/ml), chloramphenicol (10 μg/ml), kanamycin (25 μg/ml), and gentamicin (16 μg/ml). The confirmation of ESBL production and PMQR genes was carried out as described earlier. The incompatibility groups of plasmids were analyzed in all transconjugants by PCR-based replicon typing. 4
Plasmid DNA was extracted from clinical isolates according to the method described by Kieser. 15 Plasmids R1 (92 kb), R6K (40 kb), RP4 (54 kb), R1 (205 kb), and pUA21 (300 kb) were used as molecular size markers.
All qnr-carrying isolates were analyzed by pulsed-field gel electrophoresis (PFGE), 31 and DNA was obtained as previously described by Kaufmann. 14 Isolates from each bacterial species were analyzed using the GelCompar II software (Applied Math). The similarity percentage was determined in a dendrogram derived from UPGMA and Dice coefficients (band position tolerance and optimization were set at 0.7% and 0.65%, respectively).
Results
Epidemiological and prevalence data of the ESBL-producing Enterobacteriaceae isolates
The age of the patients from whom the isolates were collected was between 18 and 74 years; 73.4% (36/49) of the isolates corresponded to male patients and 24.6% (13/49) to female patients. The sites of the samples are listed as follows: blood 78 (34.5%), urine 61 (27%), secretion 30 (13.2%), catheter 3 (1.3%), and other sites 54 (24%).
The prevalence of qnr determinants was 21.6% (49/226) and it was distributed as follows: 55.8% (19/34) among E. cloacae isolates, 50% (28/56) among K. pneumoniae isolates, and 1.4% (2/136) among E. coli isolates (Table 1). Among these 49 qnr-carrying isolates, 71.4% (35/49) carried qnrB; qnrB6 type turned out to be the most prevalent (37.1%, 13/35), followed by qnrB2 (28.5%, 10/35) and qnrB1 and qnrB5 (17.1%, 6/35). The qnrS1 gene was identified in 24.4% (12/49) of the isolates, and qnrA1 in 18.3% (9/49). The qnrC and qnrD genes were not identified. Seven isolates (14.2%) carried two alleles of qnr genes. Three of them carried A1/S1 genes; another three carried A1/B genes and one isolate carried B/S1 genes (Table 2). The prevalence of the aac(6′)-Ib-cr gene was 49.5% (112/226); from these isolates, 18 of 112 (16%) contained both wild-type and mutant genes. The distribution of this gene is given as follows: 61.7% (84/136) of the isolates corresponded to E. coli, 33.9% (19/56) to K. pneumoniae, and 26.4% (9/34) to E. cloacae (Table 1).
Abbreviations of hospitals are given in Table 1.
The XbaI restriction profiles showed different DNA patterns between the clinical isolates of their respective species.
A, cefotaxime and nalidixic acid antibiotics selection; B, cefotaxim
The plasmids underlined correspond to conjugative plasmid.
The Trp102Arg and Asp179Tyr mutations from aac(6′)-Ib-cr genes were confirmed by DNA sequencing (see text).
-, wild-type gene.
NI, not identified in the PCR screening.
PFGE, pulsed-field gel electrophoresis; ESBL, extended-spectrum β-lactamase; MIC, minimum inhibitoryconcentration; ND, not determinate; Neg, unsuccessful conjugation; NR, Not related; Ala, alanine; Ile, isoleucine; Tyr, tyrosine; Val, valine; Phe, phenylalanine; Asp, Asparagine; Thr, threonine; PCR, polymerase chain reaction.
Characteristics of qnr-positive isolates
Among the qnr-positive isolates, 76.3%, 74.6%, and 74.6% were resistant to nalidixic acid, ciprofloxacin, and levofloxacin, respectively. Thirty-three of 49 qnr-positive isolates (67.3%) were nalidixic acid resistant, with MICs >512 mg/L. Thirty isolates (61.2%) were ciprofloxacin resistant, with MICs >64 mg/L. Thirty-two isolates (69.3%) were levofloxacin resistant, with MICs ranging from 16 to >64 mg/L. The remaining isolates were susceptible or intermediate to nalidixic acid (23.7%), ciprofloxacin (25.4%), and levofloxacin (25.4%), according to the CLSI. Regarding gentamicin, 64.4% of the isolates were resistant to this antibiotic (mainly >64 μg/ml). In terms of cephalosporin antibiotics, such as cefotaxime and ceftazidime, 98.3% of the isolates were resistant to both antibiotics (Table 2). In these qnr-positive isolates, the prevalence of aac(6′)-Ib-cr gene was 55.1% (27/49); 20% (10/49) of these isolates contained both wild-type and mutant genes. The distribution was as follows: 60.7% (17/28) of the isolates corresponded to K. pneumoniae; 36.8% (7/19) to E. cloacae, and 100% (2/2) to E. coli isolates (Table 2). In the case of transconjugants containing both the qnrA1 and the aac(6′)-Ib-cr genes (TK06268), the level of resistance to ciprofloxacin was 1.0 μg/ml, a value close to the clinical breakpoint for susceptibility. However, a onefold increase in the MIC for nalidixic acid was observed in the transconjugants that transferred only the aac(6′)-Ib-cr genes (Table 3).
Phenotypes: A, cefotaxime and nalidixic acid transfer resistance; B, cefotaxime transfer resistance; C, cefotaxime and ampicillin transfer resistance.
The aac(6′)-Ib-cr was identified by PCR digestion with BstI5 enzyme.
The transconjugants selected in nalidixic acid had the same molecular characteristics.
NP: not identified by PCR screening.
NI: plasmid incompatibility group not identified by PCR-based replicon typing. 4
NA, not applicable; Neg, negative.
The ESBL SHV-type was the most prevalent (81.6%, 40/49), and it was distributed as follows: 55% (22/40) corresponded to SHV-12; 27.5% (11/40) corresponded to SHV-5; 15% (6/40) to SHV-2a, and 2.5% (1/40) to SHV-2. The ESBL CTX-M-type was identified in 44.8% (22/49) of the isolates: 95% (21/22) corresponded to CTX-M-15 and 5% (1/22) to CTX-M-1; 8.1% (4/49) corresponded to TLA-1, considering that the 40.8% of the isolates contains two or three ESBLs. The prevalence of the ESBL SHV-CTX-M-type was 32.6% (15/49), followed by CTX-M-TLA-1 (6.1%, 3/49) and SHV-CTX-M-TLA-1 (2%, 1/49) (Table 2). The ESBL CTX-M-type was identified in all cases (with the exception of three isolates) in combination with an SHV-type. The K01254 isolate and its respective transconjugant (TK01254) showed the ESBL-producing phenotype only in the case of cefotaxime, and both strains were susceptible in vitro (Tables 2 and 3).
The prevalence of mutations in the gyrA and parC genes was 69.3% and 80%, respectively (parC gene from E. cloacae was not analyzed). The most frequent mutations identified were the Ser83Ile and Ser80Ile for GyrA in 55.1% (34/49) of the isolates and the ParC in 90% (27/30) (Table 2).
Regarding the 21 mating experiments, 7 were successful: 3 of them transferred the cefotaxime and nalidixic acid resistance phenotype (A) and 4 transferred only the cefotaxime resistance phenotype (B). The qnrB alleles were preferably cotransferred with the SHV-type, whereas the qnrA1 was cotransfered with the CTX-M-15 and aac(6′)-Ib-cr genes. For aac(6′)-Ib-cr, only one transconjugant turned out to be positive (Table 3). The transferred plasmids belonged to different incompatibility groups (IncN, IncFrep, and IncFIA) (Table 3). All transconjugants showed from two- to threefold increase in the MIC of nalidixic acid, with respect to E. coli J53.
Plasmid DNA was extracted from all the qnr-carrying isolates. All isolates contained from one to four plasmids, within a range of <40 to 330 kb in size. In general, the plasmid profiles were heterogeneous; nevertheless, in related clones from each hospital (clones A, B, and C), the profiles were homogeneous, including the nonrelated clones from the same hospital (hospital 4). The qnrB-type determinants were detected in four transconjugants (Table 3) with aac(6′)-Ib-cr gene on a 80-kb plasmid. The qnrS1 and qepA genes were transferred into 170- and 150-kb plasmids, respectively (Table 3). The incompatibility groups of the plasmid encoding qnrA, aac(6′)-Ib-cr, and qepA1 were determined; however, the plasmids encoding the qnrB-type genes turned out to be negative by PCR-based replicon typing.
The genotyping analysis among qnr-positive isolates showed genetic relationship between the isolates from each hospital, and it pointed out to the presence of endemic clones at the four hospitals that rendered qnr-positive isolates.
Characteristics of qepA-positive isolates
The qepA gene corresponded to qepA1 allele and its prevalence was 1.7% (4/226) (Table 1). This gene was identified in four qnr-negative E. coli isolates from different hospitals (isolates 03210 and 03212 corresponded to hospital 1 and isolates 09220 and 10246 corresponded to hospitals 3 and 8, respectively) (Table 1); however, all isolates were obtained in 2008. These E. coli isolates showed a multidrug resistance pattern with the following MICs: nalidixic acid (>256 μg/ml), ciprofloxacin (>64 μg/ml), levofloxacin (64 μg/ml), gentamicin (1 μg/ml), cefotaxime (≥256 μg/ml), and ceftazidime (512 μg/ml).
The CTX-M-15 corresponded to ESBL encoded in three qepA-positive isolates and SHV-12 was identified in the other one. The 09220 isolate contained the 150- and 110-kb plasmids, and the transfer of cefotaxime and ampicillin resistance (phenotype C) corresponded to 150-kb plasmid with IncFIA and IncFrep incompatibility groups. This plasmid encoded the qepA1 and CTX-M-15 and was negative for aac(6′)-Ib-cr gene (Table 3). Onefold increase in the MIC for nalidixic acid was observed in this transconjugant (Table 3).
Discussion
The ESBL-producing K. pneumoniae has been identified in several Mexican hospitals,1,10,20 and a retrospective and multicenter study confirms a broad dissemination of ESBLs in several Mexican hospitals. 29 These studies have related an extensive dissemination of a plasmid harboring ESBL genes and these ESBL-producing isolates strongly suggest a continued selection of these resistant bacteria. The ESBL-producing isolates have been associated with PMQR genes. 26 However, neither the qnr determinants nor the aac(6′)-Ib-cr gene has been described in Mexico, but qepA1 was recently described in an E. coli isolate from Mexico. 28 The main purpose of this work was to investigate the prevalence of PMQR genes in ESBL-producing Enterobacteriaceae recently collected from several Mexican hospitals and characterize the quinolone/fluoroquinolone and cephalosporin resistance mechanisms from qnr-positive isolates.
Currently, the qnrA, qnrB, and qnrS genes, in combination with aac(6′)-Ib-cr, are the most common plasmid-mediated genes that confer a decreased susceptibility to quinolones and fluoroquinolones, and there is a worldwide emergence of PMQR genes. 26 Nevertheless, qepA has been described in several countries such as China, France, and the United States and its prevalence is growing. 35 In the present study, we demonstrated that the prevalence of qnr determinants (qnrA, B, and S) was 21.6%, the prevalence of aac(6′)-Ib-cr was 49.5%, the prevalence of qepA genes was 1.7%, and qnrC and qnrD were not identified in a group of ESBL-producing Enterobacteriaceae isolates. However, the prevalence of aac(6′)-Ib-cr in the qnr-positive isolates was slightly higher (55.1%), but qepA was not identified. The prevalence of qnr determinants was higher among the E. cloacae isolates (55.8%), followed by the K. pneumoniae (50%) and the E. coli ones (1.4%), in agreement with what has been noted by other authors.12,27
The ESBLs remain as one of the most significant mechanisms of resistance to oxyimino-cephalosporins among Enterobacteriaceae. In the 1980s, the ESBLs were predominantly TEM and SHV derivatives. 3 However, since 2000, the CTX-M-types have spread worldwide. 2 In Mexico, the SHV-type along with TLA-1 enzymes have been the predominant ESBL during the present century.1,13,20 Recently, CTX-M-15 was described in E. coli isolates in Puebla, Mexico, 28 and also in a retrospective study in Mexico. 29 Among qnr-positive isolates, the ESBL SHV-type (81.6%) remains the most prevalent ESBL; nevertheless, the ESBL CTX-M-15 was broadly identified (44.9%). As in many other countries, the CTX-M-type enzymes have also been reported in Latin America.2,22,33 The CTX-M-15 is encoded in combination with an ESBL SHV-type (SHV-12 was identified as the most prevalent; 51.1%) and/or TLA-1. This situation could be pointing to a major problem in hospital settings in Mexico because of the presence of high resistance both to cephalosporins and to cefotaxime and ceftazidime.
Several reports have assessed the PMQR genes in ESBL-producing Enterobacteriaceae species,21,24,30 such as those carried out in Spain (4.9%) and China (12.8%). 35 In Peru and Bolivia, the most prevalent PMQR gene turned out to be qnrB, but qnrA was not identified. 23 Among the qnr determinants analyzed in this study, the qnrB alleles were the more prevalent (34 of 49), whereas qnrS1 and qnrA1 displayed a lower prevalence (12 of 49 and 9 of 49, respectively). These point to a higher prevalence of these genes in comparison with the other countries aforementioned. With respect to the rate of aac(6′)-Ib and aac(6′)-Ib-cr among all the isolates analyzed, the aac(6′)-Ib gene was twofold higher among the qnr-negative isolates. In different bacterial groups, the prevalence of aac(6′)-Ib-cr appeared to be higher among qnr-negative Es. coli isolates (61.7%), in comparison with the isolates of the other species tested. In this work, as it has been generally reported, the prevalence of the qepA gene among clinical isolates is low, and it does not exceed of 3.6% 30 ; however, a prevalence of >4% in E. coli isolates was recently described in Japan. 35 The four qepA1-harboring isolates did not contain qnr determinants and they were preferably encoded in combination with ESBLs CTX-M-15 and SHV-12. Likewise, qepA1 was cotransferred with CTX-M-15 (isolate T09220), as it was observed in E. coli C1550 isolate from Puebla (Mexico) 28 ; however, the aac(6′)-Ib-cr was not present in either isolate.
It has been described that the widespread distribution of PMQR genes could potentially fuel the rapid development of chromosomal fluoroquinolone resistance. 26 In this study, the prevalence of QRDR mutations in genes gyrA and parC with qnr-positive isolates was high; however, we cannot support the role of qnr determinants as it has been previously described 16 because of the fact that the qnr-negative isolates were not analyzed. On the other hand, the MIC for nalidixic acid from isolates with mutations on the gyrA/parC genes is at least fivefold higher. The low susceptibility to ciprofloxacin (2.0 μg/ml) was observed on isolates K06268 and EC06271, which contained the aac(6′)-Ib-cr gene and wild-type on the GyrA or ParC proteins. This situation was observed also in the transconjugant TK06268. The presence of qnr and/or aac(6′)-Ib-cr genes enhances the selection of resistance mutations in the presence of quinolone concentrations that would otherwise be lethal.16,17,26
The qnr and aac(6′)-Ib-cr genes along with certain ESBLs have been frequently cotransmitted and coselected. 12 The horizontal transmission events involved several plasmid incompatibility groups, which resulted in the acquisition of multidrug resistance. This fact could contribute to the rapid increase in the prevalence of multidrug resistance among clinical bacteria. The qnrA1-carrying genes on transferable plasmids were identified with a different incompatibility group (IncFrep and IncN), encoding the ESBL CTX-M-15, whereas the aac(6′)-Ib-cr gene was located in both plasmids. With respect to the qnrB alleles, they were found to be encoded on the same molecular weight plasmid (80 kb) with a nonidentified incompatibility group encoding the SHV-type ESBL. The qnrS1 gene was transferred alone into a plasmid with a nonidentified incompatibility group. Such cotransmissibility of PMQR genes could correspond to the acquisition of genetic elements on ESBLs previously encoded in the plasmid.
The results of the PFGE showed that the qnr-positive strains of E. cloacae and K. pneumoniae isolates from CRCEI and HGA hospitals have very similar types of DNA bands. This clonality corresponds to isolates from different years in each hospital, thereby suggesting that the qnr-positive isolates have persisted over time in the respective hospitals.
In conclusion, this is the first report of the prevalence of PMQR genes in ESBL-producing Enterobacteriaceae from Mexico, indicating that, as in many countries, the PMQR genes qnr and aac(6′)-Ib-cr are widely distributed. These genes in combination with mutations in gyrase and toposimerase IV are implicated in high-level fluoroquinolone resistance, in addition to the cephalosporin resistance mediated by ESBLs, and may play a significant role in therapeutic failure for these antibiotic families. The cotransmission of qnr with aac(6′)-Ib-cr and ESBL genes sped up the formation of multidrug resistance in Enterobacteriaceae in Mexico, highlighting the role of ESBL CTX-M-15. In Mexico, the spread of PMQR qnr genes is high among E. cloacae and K. pneumoniae isolates, whereas aac(6′)-Ib-cr and qepA1 are restricted to E. coli isolates from adult patients. Further research is needed to find out the prevalence of PMQR genes in non–ESBL-producing and pediatrics Enterobacteriaceae isolates.
Footnotes
Acknowledgments
This work was supported by grants 87334 and SALUD-2008-1 from CONACYT (Mexican Council of Science and Technology). The authors thank R. Gomez for her excellent laboratory assistance. This work was presented at the 50th Interscience Conference on Antimicrobial Agents and Chemotherapy, 2010 (Abstract C2-1468).
Disclosure Statement
No competing financial interests exist.
Appendix
| Primer a | Sequence (5′ to 3′) b | Gene c | Size of PCR-amplified product (bp) | Reference |
|---|---|---|---|---|
| CTX-MF/CTX-MR | GCTGTTGTTAGGAAGTGTG/GGTGACGATTTTAGCCGCC | CTX-M-1, CTX-M-12 and CTX-M-15 | 811 | 9 |
| P1/P2 | ACTGAATGAGGCGCTTCC/TCCCGCAGATAAATCACC/ | SHV-type | 291 | 25 |
| TLA-1F/TLA-1R | TCTCAGCGCAAATCCGCG/CTATTTCCCATCCTTAACTAG | TLA-1 | 974 | This study |
| QnrAm-F/QnrAm-R | AGAGGATTTCTCACGCCAGG/TGCCAGGCACAGATCTTGAC | qnrA1 to qnrA6 | 580 | 5 |
| QnrBm-F/QnrBm-R | GGMATHGAAATTCGCCACTG/TTTGCYGYYCGCCAGTCGAA | qnrB1 to qnrB6 | 264 | 5 |
| QnrSm-F/QnrSm-R | GCAAGTTCATTGAACAGGGT/TCTAAACCGTCGAGTTCGGCG | qnrS1 to qnrS2 | 428 | 5 |
| QnrBS-F | GTTGGCGAAAAAATTGACAGAAA | qnrB1 to qnrB23 | 494 c | This study |
| AAC6-F/AAC6-R | TTGCGATGCTCTATGAGTGGCTA/CTCGAATGCCTGGGCTGTTT | aac(6′)-lb and aac(6′)-lb-cr | 482 | 19 |
| QepA-R/QepA-R d | GGACATCTACGGCTTCTTCG/CATGACGCAGTACCTGCAG | qepA | 718 | 19,28 |
| GyrAK-F/GyrAK-R | TGGATTATGCGATGCCGGTC/GCTCCGTACCGTCATAGTTG | gyrA QRDR of K. pneummoniae | 396 | This study |
| ParCK-F/ParCK-R | GGCATTACCGTTTATTGGCG/TGGTTTTCGGCTGCTCAATC | parC QRDR of K. pneummoniae | 518 | This study |
| GyrAE-F/GyrA-ER | ACCTTGCGAGAGAAATTA/CGACGACCGTTAATGATTG | gyrA QRDR of E. coli | 673 | This study |
| ParCE-F/ParCE-R | TTGCCGTTTATTGGTGATG/GATAATTTCCGCTTCAGTC | parC QRDR of E. coli | 576 | This study |
| GyrAEc-F/GyrAEc-R | CGCGTACTTTACGCCATGAACGTA/CAGACGGATTTCCGTATAACGC | gyrA QRDR of E. cloacae | 242 | 13 |
F, sense primer; R, antisense primer.
M = A or C; H = A or C or T; Y = C or T; K = G or T; R = A or G; B; G or T or C.
Amplified product in the QnrBm-R combination primer.
The primer combination was used for obtains a PCR product of 718 bp.
