Antimicrobial Susceptibilities and Resistance Genes of Canadian Isolates of Actinobacillus pleuropneumoniae

Abstract

Actinobacillus pleuropneumoniae is the causative agent of porcine pleuropneumonia, a severe and highly contagious respiratory disease responsible for economic losses in the swine industry worldwide. Although antimicrobial resistance in A. pleuropneumoniae has been recently reported in different countries, the current situation in Canada is unknown. The aim of the current study was to determine the antimicrobial susceptibilities of 43 strains of A. pleuropneumoniae isolated in Canada. In addition, antimicrobial resistance genes were detected with an oligonucleotide microarray. The impact of biofilm formation on susceptibility to antimicrobials was also evaluated. All isolates were susceptible to ceftiofur, florfenicol, enrofloxacin, erythromycin, clindamycin, trimethoprim/sulfamethoxazole, and tilmicosin. A low level of resistance was observed toward tiamulin, penicillin, and ampicillin as well as danofloxacin. We observed a high level of resistance to chlortetracycline (88.4%) and oxytetracycline (90.7%). The strains showing resistance to tetracycline antimicrobials contained at least one of the following tet genes: tetB, tetO, tetH, or tetC. Five isolates showed multiresistance to penicillins (bla_ROB-1), streptomycin [aph3′′ (strA)], sulfonamides (sulII), and tetracyclines (tetO) antimicrobials whereas three others showed multiresistance to streptomycin [aph3′′ (strA)], sulfonamides (sulII), and tetracyclines (tetB, tetO, or tetB/tetH) antimicrobials. To the best of our knowledge, this is the first description of tetC gene in Pasteurellaceae. Finally, cells of A. pleuropneumoniae in a biofilm were 100 to 30,000 times more resistant to antimicrobials than their planktonic counterparts.

Introduction

A ctinobacillus pleuropneumoniae is the causative agent of porcine pleuropneumonia, a severe and highly contagious respiratory disease responsible for major economic losses in the swine industry worldwide.^7,11,49 The disease, transmitted by aerosol or by direct contact with infected pigs, may result in rapid death or in severe pathology characterized by hemorrhagic, fibrinous, and necrotic lung lesions.^7,49 Exposure to the organism may lead to chronic infection such that animals fail to thrive; alternatively, they survive as asymptomatic carriers that transmit the disease to healthy herds.^7,49 Many virulence factors of this microorganism have been well characterized^7,11,26 and biofilm formation has been observed in field isolates.^30,33 A. pleuropneumoniae has been divided into biotype 1 strains, which are nicotinamide adenine dinucleotide (NAD) dependent, and biotype 2 strains, which are NAD independent.¹⁵ To date, 15 serovars of A. pleuropneumoniae based on capsular antigens have been described.^4,15 The prevalence of specific serovars varies with geographic region. In North America, the most prevalent serovars are 1, 5, and 7, whereas serovars 2 and 9 are the most commonly isolated in Europe.^15,49 Canada is the most important exporter of live hogs to the United States.¹⁶

Currently available vaccines for controlling infection by A. pleuropneumoniae provide only partial protection, have little impact on morbidity, and neither induce cross-serovar immunity or prevent development of the carrier state (recently reviewed by Ramjeet et al.⁴³). Thus, early and adequate antimicrobial therapy continues to be necessary for the control of porcine pleuropneumonia outbreaks and to prevent spread of disease. A wide variety of antimicrobial agents have been suggested for treating this disease including β-lactams (amoxicillin, penicillin, ampicillin, and ceftiofur), tetracyclines (tetracycline and doxycycline), florfenicol, trimethoprim/sulfamethoxazole, tiamulin, lincomycin/spectinomycin, fluoroquinolones (danofloxacin and enrofloxacin), and gentamicin.⁴⁹

Various antimicrobial resistance patterns have been observed in several studies among strains from different geographical regions,^10,17,23,32 serovars,^3,53,54 and also over time.^22,37,48 While most isolates are reported to be susceptible toward fluoroquinolones, ceftiofur, and florfenicol, resistances toward ampicillin, tetracycline, and other antimicrobials are emerging (reviewed by Aarestrup et al.¹). A high incidence of tetracycline resistance in A. pleuropneumoniae was reported in North America, Asia, and Europe, with the exception of Switzerland.^{5,10,22,31,32,34,38,44,54} Moreover, during the last decade, a considerable increase in tetracycline resistance in A. pleuropneumoniae was observed in Spain.²² The most commonly found determinant was the tetB gene, followed by tetO, tetH, and tetL.^5,34,37,52 In addition, plasmids mediating streptomycin and sulfonamide resistances in A. pleuropneumoniae,^10,24,35 as well as tetracycline resistance⁶ or ampicillin resistance¹⁰ have been characterized and sequenced. The genetic basis of resistance to antimicrobial agents in A. pleuropneumoniae and other Pasteurellaceae members has been recently reviewed.⁴⁶

Prudent use of antimicrobial agents for treatment of infections requires knowledge of the susceptibility of the infecting strain. Although reports from different countries on antimicrobial resistance in A. pleuropneumoniae have been recently published, the current situation in Canada is unknown. In addition, bacteria in biofilms have been shown to be often more resistant to antimicrobial agents than their planktonic counterparts.^9,39 Thus, in the current work, we have determined the antimicrobial susceptibility patterns of 43 strains of A. pleuropneumoniae recently isolated in Canada toward 19 antimicrobial agents. Furthermore, resistance genes were identified and the impact of biofilm formation on susceptibility to antimicrobials was evaluated.

Materials and Methods

Bacterial strains and growth conditions

A total of 43 A. pleuropneumoniae biotype 1 strains isolated from clinical cases from herds located in Saskatchewan, Ontario, and Québec were included in this study (Table 1). All A. pleuropneumoniae isolates were cultivated overnight on chocolate agar plates supplemented with PolyVitex at 37°C with 5% CO₂. For DNA extraction, A. pleuropneumoniae strains were grown overnight in Brain-Heart Infusion (BHI; Difco Laboratories) supplemented with 5 μg/ml NAD at 37°C.

Table 1.

Distribution of the 43 Actinobacillus pleuropneumoniae Clinical Isolates by Serovars and Provinces

	Serovar
Province	1	5a	5b	3(8)	7	12	15
Québec^a	1	3	2	1	5	—	—
Ontario^b	4	—	4	—	4	—	—
Saskatchewan^c	2	3	4	—	3	1	6

Dr. Serge Messier, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, Québec.

Dr. Durda Slavic, Animal Health Laboratory, University of Guelph, Guelph, Ontario.

Dr. Musangu Ngeleka, Prairie Diagnostic Services, Inc., University of Saskatchewan, Saskatoon, Saskatchewan.

Antimicrobial susceptibilities

The antimicrobial susceptibilities of the isolates were determined by a microdilution method using commercial BOPO1F Sensititre 96-well microtiter plates (Trek Diagnostic Systems, Inc.) in Veterinary Fastidious Medium (VFM; Trek Diagnostic Systems, Inc.), in accordance with guidelines and breakpoints of the Clinical and Laboratory Standards Institute (CLSI) M31-A3.¹³ Antimicrobials tested include ampicillin (concentration range 0.12–8 μg/ml), ceftiofur (0.25–4 μg/ml), chlortetracycline (0.25–4 μg/ml), clindamycin (0.12–1 μg/ml), danofloxacin (0.06–0.5 μg/ml), enrofloxacin (0.06–1 μg/ml), erythromycin (0.12–2 μg/ml), neomycin (2–16 μg/ml), florfenicol (0.12–4 μg/ml), gentamicin (0.5–4 μg/ml), oxytetracycline (0.25–4 μg/ml), penicillin (0.06–4 μg/ml), spectinomycin (4–32 μg/ml), sulfachloropyridazine (16–128 μg/ml), sulfadimethoxine (16–128 μg/ml), sulfathiazole (16–128 μg/ml), tiamulin (2–16 μg/ml), tilmicosin (2–16 μg/ml), and trimethoprim/sulfamethoxazole (0.25/4.75–1/19 μg/ml). Escherichia coli ATCC 25922 and A. pleuropneumoniae ATCC 27090 were used as quality control strains. The minimal inhibitory concentration (MIC) was determined as the lowest concentration of antimicrobial agent that prevented visible growth. Ranges of susceptibility were recorded along with the MIC that inhibited 50% (MIC₅₀) and 90% (MIC₉₀) of the isolates. The A. pleuropneumoniae–approved CLSI MIC breakpoints of ceftiofur, florfenicol, tetracycline, tiamulin, and tilmicosin are 8 μg/ml, 8 μg/ml, 2 μg/ml, 32 μg/ml, and 32 μg/ml, respectively.¹³ The interpretative criteria for A. pleuropneumoniae taken from a previously published proposal of clinical breakpoints for amoxicillin⁴⁷ were used for ampicillin and penicillin (2 μg/ml). Other CLSI¹³ breakpoints were as follows: clindamycin (4 μg/ml), danofloxacin (0.25 μg/ml), enrofloxacin (2 μg/ml), erythromycin (8 μg/ml), sulfathiazole (512 μg/ml), and trimethoprim/sulfamethoxazole (4/76 μg/ml). Resistance breakpoints from the Veterinary Antimicrobial Decision Support system⁵⁰ for sulfachloropyridazine (512 μg/ml) and sulfathiazole (512 μg/ml) were considered in this study. No breakpoints for A. pleuropneumoniae were available for aminoglycosides. Thus, susceptibility interpretation was based on distribution of MICs and detection of resistance genes.

Genomic DNA extraction

A. pleuropneumoniae isolates were grown overnight in 10 ml of BHI broth supplemented with NAD at 37°C. Five milliliters of an overnight broth was spun at 10,000 g for 10 min. The pellets were resuspended in 800 μl of TE buffer (10 mM Tris, 1 mM ethylenediaminetetraacetic acid, pH 8.0) and treated with lysozyme (Roche) and RNase A (Qiagen) for 10 min at room temperature. The cell suspensions were then digested with proteinase K (MBI Fermentas) for 1 hr at 37°C, and complete lysis was obtained by addition of sodium dodecyl sulfate to a final concentration of 0.1% (wt/vol). DNA was extracted from the cell lysates by three extractions with phenol-chloroform-isoamyl alcohol (25:24:1) and two extractions with chloroform, and was precipitated in isopropanol.²⁰

Genomic DNA labeling and hybridization on microarrays

A DNA microarray was used for the characterization of the antimicrobial resistance genotype of the A. pleuropneumoniae clinical isolates.¹⁹ The version of this microarray used in the current study was composed of 182 oligonucleotides corresponding to 166 different acquired antimicrobial resistance gene targets, covering most of the resistance genes found in both Gram-negative and Gram-positive bacteria. Microarray construction and validation has been published elsewhere.¹⁹ Oligonucleotide probe sequence information can be found in Supplementary Table S1 (Supplementary Data are available online at www.liebertonline.com/mdr). A. pleuropneumoniae DNA was fluorescently labeled using direct chemical coupling with the Label-IT (Mirus Corp.) cyanine dye Cy5 as recommended by the manufacturer. Probes were purified from unincorporated dyes by passing samples through Qiaquick columns (Qiagen). Labeled DNA sample yields and dye incorporation efficiencies were assessed using a Nanodrop ND-1000 spectrophotometer (Nanodrop). Hybridization of labeled DNA was performed as described previously.⁸ Briefly, the microarrays were prehybridized at 50°C for 1 hr in a slide hybridization chamber (Corning) with 30 μl of prewarmed (37°C) DIG Easy Hyb buffer (Roche Diagnostics) containing 0.5% (vol/vol) purified bovine serum albumin (10 mg/ml) (New England BioLabs). After prehybridization, 500 ng of labeled DNA was resuspended in 6 μl of prewarmed DIG Easy Hyb buffer and denatured by heating it for 5 min at 95°C. Microarrays were then hybridized overnight at 50°C in a slide hybridization chamber. After hybridization, four stringency washes (three in 0.1×SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate]-0.1% sodium dodecyl sulfate and one in 0.1× SSC) were performed at 37°C for 5 min and under light agitation. The slide was then scanned at a resolution of 5 μm at 90% laser power, with a Perkin-Elmer ScanArray Express scanner according to the manufacturer's recommendations.

Polymerase chain reaction detection

Polymerase chain reaction (PCR) amplification of the tetracycline resistance genes was performed using Taq DNA polymerase (GE Healthcare) and specific oligonucleotide primers (Table 2). The PCR products were separated on a 0.8% agarose gel by electrophoresis and visualized using standard techniques.

Table 2.

Oligonucleotides Used for Polymerase Chain Reaction Detection of Tetracycline Resistance Genes in Actinobacillus pleuropneumoniae

Tetracycline resistance gene	Forward PCR primer sequence 5′→3′	Reverse PCR primer sequence 5′→3′	Amplicon size (bp)	Reference for primer design	GenBank accession no.
tetA	GTGAAACCCAACATACCCC	GAAGGCAAGCAGGATGTAG	888	36	X00006
tetB	CCTTATCATGCCAGTCTTGC	ACTGCCGTTTTTTCGCC	774	36	J01830
tetC	ACTTGGAGCCACTATCGAC	CTACAATCCATGCCAACCC	881	36	J01749
tetD	TGGGCATGGTCAGATAAG	CAGCACACCCTGTAGTTTTC	827	36	X65876
tetE	TTAATGGCAACAGCCAGC	TCCATACCCATCCATTCCAC	853	36	L06940
tetG	GCTGGATGATGCATTGCGCG	ATGGTCTGCGTAGTATTGGC	554	5	S52437
tetH	ATACTGCTGATCACCGT	TCCCAATAAGCGACGCT	1,076	5	AJ245947
tetK	TCGATAGGAACAGCAGTA	CAGCAGATCCTACTCCTT	169	5	U38656
tetL	TTAGAAATCCCTTTGAGA	ATGTGAATACATCCTATT	1,379	5	AF503772
tetO	TAACTTAGGCATTCTGGCTC	TCAAGCAGACTCCCTGCCCATTTGT	1,801	5	M18896
tetY	ACCGCACTCATTGTTGTC	TTCCAAGCAGCAACACAC	823	36	AF252855

PCR, polymerase chain reaction.

Minimum bactericidal concentration for biofilms

Biofilms were cultured in 96-well microtiter plates as described previously.³³ The minimum bactericidal concentration for biofilms (MBCB) was determined using a protocol adapted from Pettit et al.⁴¹ After a 5-hr incubation, the liquid medium was removed by aspiration and 100 μl of BHI-NAD containing the desired antibiotic concentration was added to each well. The plates were incubated for 20 hr at 37°C with 5% CO₂. Wells containing only the bacterial inoculum were used as positive controls and wells containing only the antibiotic dilution were used as negative controls. The liquid medium was then removed and 120 μl of BHI-NAD containing 20 μl of the CellTiter-Blue^® Reagent (Promega Corporation) was added to each well. The plate was incubated for 30 min at 37°C with 5% CO₂ and the level of fluorescence (λ_ex 570 nm; λ_em 600 nm) was measured using a microplate reader. The MBCB was considered the lowest concentration resulting in less than 10% reduction of resazurin 30 min after the addition of the reagent. Percent resazurin reduction was calculated using the following formula: (experimental well absorbance–negative control absorbance)/positive control absorbance ×100. For control purposes, MIC was carried as described previously but bacteria were cultured in BHI-NAD or VFM and 10 μl of CellTiter-Blue Reagent was added to the wells after visual MICs were recorded.

Results

The distribution of the 43 A. pleuropneumoniae clinical isolates by provinces and by serovars is shown in Table 1. Isolates representing serovars 5 (5a n=6 and 5b n=10), 7 (n=12), 1 (n=7), 15 (n=6), 3(8) (n=1), and 12 (n=1) were included in the study. The results of the susceptibility testing of the 43 A. pleuropneumoniae isolates (MIC, MIC₅₀, MIC₉₀ values and the percentage of resistant strains) are summarized in Table 3. The MICs of the quality control strains E. coli ATCC 25922 and A. pleuropneumoniae ATCC 27090 were within the expected CLSI quality control range (data not shown).

Table 3.

Minimal Inhibitory Concentration of 19 Antimicrobial Agents for 43 Actinobacillus pleuroneumoniae Clinical Isolates

	No. of isolates with MIC of (μg/ml)
Antimicrobial	0.03	0.06	0.12	0.25	0.5	1	2	4	8	16	32	64	128	256	MIC₅₀	MIC₉₀	% of Resistance
Ceftiofur			38	<	4			1>	\|						≤0.25	0.5	0
Florfenicol			<	7	32	1	2	1>	\|						0.25	0.25	0
Danofloxacin	32	<	6	\|1	2>	2									≤0.06	0.25	11.6
Enrofloxacin	36	<		3	3	>1	\|								≤0.06	0.25	0
Erythromycin			<				12>	31	\|						>2	>2	0
Tilmicosin							<	8	33	2>	\|				8	8	0
Tiamulin							<	1	7	32>	\|3				16	16	7
Clindamycin			<			>	43	\|							>1	>1	0
Gentamicin					<			3>	40						>4	>4	-
Neomycin							<			1>	42				>16	>16	-
Spectinomycin								<			>	43			>32	>32	-
Penicillin		<		4	24	6	\|	>	9						0.5	>4	20.9
Ampicillin		17	<	14	3		\|		>	9					0.25	>8	20.9
Chlortetracycline				<		5	\|6	16>	16						4	>4	88.4
Oxytetracycline				<		4	\|	1>	38						>4	>4	90.7
Sulfachloropyridazine^a										<1	3	21	12>	6\|	64	>128	n.a.
Sulfadimethoxine^a										<1		5	15>	22\|	>128	>128	n.a.
Sulfathiazole^a										<1	4	11	13>	14\|	128	>128	n.a.
Trimethoprim/sulfamethoxazole^b			39	<	1	>1	2	\|							≤0.25	≤0.25	0

(<): Minimum value of concentration used; (>): maximum value of concentration used. Values above this range indicate MIC values higher than the highest concentration in the range. Values below the lowest concentration tested indicate MIC values smaller or equal to the lowest concentration in the range. CLSI resistance breakpoints are indicated with vertical black lines (|) when available; (-), no breakpoint for Actinobacillus pleuropneumoniae is available; (n.a.), data nonavailable.

breakpoint=512 μg/ml.

Concentration of trimethoprim given, tested in a concentration ratio of 1:19 (trimethoprim/sulfamethoxazole).

MIC, minimal inhibitory concentration; CLSI, Clinical and Laboratory Standards Institute.

All 43 A. pleuropneumoniae isolates were susceptible to ceftiofur, florfenicol, enrofloxacin, erythromycin, clindamycin, trimethoprim/sulfamethoxazole, and tilmicosin. Of those, only ceftiofur, florfenicol, and tilmicosin have approved CLSI resistance breakpoints for A. pleuropneumoniae. Ceftiofur and florfenicol were both highly active with MIC₉₀ of 0.5 and 0.25 μg/ml, respectively. Tilmicosin and erythromycin are both macrolides antimicrobials. They were active against all the A. pleuropneumoniae isolates tested, with a MIC₉₀ of 8 and >2 μg/ml, respectively. Clindamycin is a lincosamide antimicrobial that is also used to test for susceptibility to lincomycin. It was also active against all isolates tested, with a MIC₉₀ of >1 μg/ml.

The fluoroquinolones generally exhibit activity against many Gram-positive and Gram-negative bacteria and are approved for use in veterinary medicine. However, the U.S. FDA has banned extra-label use of fluoroquinolones in food animals.⁴⁰ Thus, there are no approved CLSI breakpoints for A. pleuropneumoniae and antimicrobial resistance can be expected to be low. In this study, both enrofloxacin and danofloxacin were highly active against A. pleuropneumoniae, with MIC₅₀ values ≤0.06 and of 0.25 μg/ml for 90% of the isolates. The CLSI¹³ has published a breakpoint for danofloxacin of 0.25 μg/ml, for cattle respiratory disease agents Mannheimia haemolytica and Pasteurella multocida, to permit detection of strains with decreased susceptibility as compared with the original population. Interestingly, 12 of our isolates have a MIC ≥0.25 μg/ml for both danofloxacin and enrofloxacin.

Tiamulin is a semisynthetic derivative of pleuromutilin. It is highly active against Gram-positive organisms such as streptococci and staphylococci, and highly active against mycoplasmas and Brachyspira hyodysenteriae. The soluble powder maybe used in drinking water for the treatment of dysentery associated with B. hyodysenteriae as well as for treatment of pneumonia associated with A. pleuropneumoniae. This antimicrobial has an approved CLSI resistance breakpoints for A. pleuropneumoniae. In this study, only three (7%) isolates were resistant to tiamulin.

There are no aminoglycoside breakpoints for A. pleuropneumoniae. In addition, the CLSI guideline document M31-A3 recommends not to use the 16 μg/ml breakpoint published for other organisms. Consequently, microarray and PCR analysis have been used to assess possible resistances. Results demonstrated that none of the 43 isolates contained the gentamicin resistance genes ant(2′′)-Ia (aadB), aac(3)-IIc (aacC2), and aac(3)-IVa (aacC4) (Table 4). The other aminoglycosides neomycin and spectinomycin had higher MIC values (MIC₉₀ >16 and >32 μg/ml, respectively) showing relatively less susceptibilities than gentamicin. Streptomycin, another aminoglycoside, was not tested for MICs but microarray results revealed the presence of streptomycin resistance genes aph3′′ (strA) (18.6%) and aph6 (strB) (2.3%) that encode for a aminoglycoside-3′′-phosphotransferase [APH(3′′)-Ib] and a aminoglycoside-6-phosphotransferase [APH(6)-Id], respectively.¹²

Table 4.

Frequencies of Antimicrobial Resistance Genes Among 43 Actinobacillus pleuropneumoniae Canadian Isolates as Determined by Microarray Hybridizations

Antimicrobial agent	Antimicrobial resistance gene ^a	No. (%) of isolates carrying the corresponding resistance gene ^b
Ampicillin	bla _ROB-1	7 (16.2)
Tetracyclines	tetB	18 (41.8)
	tetC	2 (4.6)
	tetH	3 (6.9)
	tetO	7 (16.2)
Streptomycin	aph3′′ (strA)	8 (18.6)
	aph6 (strB)	1 (2.3)
Sulfonamides	sulII	9 (20.9)

All antimicrobial resistance genes targeted in this study are described in Supplementary Table S1.

Percentages were calculated as number of isolates with a specific resistance gene/total number of A. pleuropneumoniae isolates ×100. The total number of isolates was 43.

Sulfonamides and the potentiated sulfonamides (trimethoprim/sulfamethoxazole combinations) have also been widely used for the treatment of numerous swine diseases. Because the CLSI breakpoint for sulfonamides is above the maximum value of concentration tested in this study, the percentage of resistance to this antimicrobial was evaluated with the presence of sulfonamide resistance genes sulIa, sulI, sulII, and sulIII. The sulII gene was found in 9 (20.9%) of A. pleuropneumoniae isolates, whereas sulIa, sulI, and sulIII genes were not detected (Table 4). No resistance to trimethoprim/sulfamethoxazole was found and this drug was highly active with MIC₉₀≤0.25 μg/ml.

A proposal of clinical breakpoints for amoxicillin applicable to porcine respiratory tract pathogens has recently been published.⁴⁷ Using this breakpoint, nine isolates were resistant to both ampicillin and penicillin. Of those, microarray experiments have revealed that seven (77.8%) carried the bla_ROB-1 gene. The antimicrobial genotypes of the other two isolates remain unexplained as neither harbored the bla_TEM gene nor the 20 other genes encoding β-lactam resistance found on the microarray (Supplementary Table S1).

Tetracyclines are the main drugs used to treat porcine pleuropneumonia and two semisynthetic derivatives of tetracycline, oxytetracycline, and chlortetracycline have been tested in this study. There is an approved CLSI breakpoint for A. pleuropneumoniae for both derivatives. Tetracycline resistance reports are conflicting as some have shown, like ourselves, very high level of resistance,²² while others have shown resistance level as low as 23.9%³² and 8.4%.³⁴ Consequently, the percentages of resistance to chlortetracycline and oxytetracycline were confirmed with the presence of tetracycline resistance genes identified by microarray and PCR. Results showed that 65.1% (n=28) of our isolates contained at least 1 of the 16 tetracycline resistance determinants (tetA, tetB, tetC, tetD, tetE, tetG, tetH, tetK, tetL, tetM, tetO, tetS, tetA(P), tetV, tetW, and tetY) (Table 4). The most common determinants were tetB (41.8%) and tetO (16.2%). Both tetC and tetH genes were found in two isolates each (Table 5). One isolate carried more than one tet gene, tetB and tetO genes. Both strains carrying the tetC gene have been isolated from Ontario and belong to the serovar 7 (Supplementary Table S2). Hierarchical clustering analysis based on the microarray genomic comparative hybridization has shown that these two strains were clonal.²⁰

Table 5.

Antimicrobial Resistance Gene Patterns Found in the 43 Clinical Isolates of Actinobacillus pleuropneumoniae

Antimicrobial agent(s) resistance gene(s)	No. of isolates
aph3′′ (strA), bla_ROB-1, sulII, tetO	5
aph3′′ (strA), aph6 (strB), sulII, tetO	1
aph3′′ (strA), sulII, tetB, tetH	1
aph3′′ (strA), sulII, tetB	1
sulII, tetB	1
bla _ROB-1	2
tetB, tetO	1
tetB	14
tetC	2
tetH	2
none	13

Information concerning the serovar and the origin of the clinical isolates can be found in Supplementary Table S2.

Multiresistance was also observed in this study based on the presence of resistance genes. Five isolates showed resistance toward four antimicrobials: ampicillin (bla_ROB-1), streptomycin [aph3′′ (strA)], sulfonamides (sulII), and tetracyclines (tetO); while three isolates showed multiresistance to streptomycin [aph3′′ (strA)], sulfonamides (sulII), and tetracyclines (tetB, tetO, or tetB/tetH) (Table 5). Four of the five isolates showing multiresistance to ampicillin, streptomycin, sulfonamides, and tetracyclines were isolated from Saskatchewan and were of serovars 7, 12, and 15 (Supplementary Table S2). Although the number of strains included in the current study is relatively small, isolates from Ontario showed the highest proportion of strains (75%) with at least one antimicrobial resistance gene. Genes coding for integrons and mobile elements (Supplementary Table S1) were not detected in any of the A. pleuropneumoniae clinical isolates. No correlation was observed between the distribution of antimicrobial resistance and the serovars of A. pleuropneumoniae.

It is well-known that bacteria within biofilms can be 10 to 1,000 times more resistant to antibiotics and disinfectants than their planktonic counterparts.^9,27 We thus decided to determine the MBCBs of four antimicrobials for seven of our A. pleuropneumoniae clinical isolates that were sensitive to the antibiotics tested and previously shown to form biofilm.³³ At the MICs, the antibiotics were inactive against biofilms and higher concentrations (at least 128 times the MIC) were required to eradicate the biofilm (Table 6). Given that MBCBs are established with different growth parameters, MICs were done with MBCB parameters (i.e., growth in BHI-NAD, reduction of resazurin) to control for other variables. Visual and resazurin MICs for planktonic bacteria cultured in VFM and BHI-NAD were generally identical or within one twofold dilution (data no shown). Based on the control and the MBCB values, it can be concluded that biofilm formation in A. pleuropneumoniae clearly contributes to antibiotics resistance.

Table 6.

Minimal Inhibitory Concentration for Planktonic Cells and Minimal Bactericidal Concentration for Biofilms of Four Antimicrobial Agents Obtained for Seven Actinobacillus pleuropneumoniae Clinical Isolates

		Ampicillin ^a		Florfenicol ^a		Tiamulin ^a		Tilmicosin ^a
Strains	Serovar	MIC ^b	MBCB	MIC ^b	MBCB	MIC ^b	MBCB	MIC ^b	MBCB
719	1	≤0.125	>4,096	0.5	8,192	16	2,048	4	8,192
C996	5a	0.5	256	2	2,048	16	2,048	8	16,384
4817	5a	0.25	>4,096	0.5	>8,192	16	4,096	8	16,384
05-6501	5b	≤0.125	>4,096	0.5	>8,192	16	4,096	8	16,384
881	7	0.25	>4,096	0.5	>8,192	16	>4,096	8	16,384
1951	7	≤0.125	>4,096	2	>8,192	16	>4,096	8	16,384
4648	7	0.25	>4,096	0.5	>8,192	16	>4,096	8	16,384

μg/ml.

Obtained using CLSI M31-A3¹³ recommendations and planktonic cells.

MBCB, minimal bactericidal concentration for biofilms.

Discussion

Although antimicrobial resistance in A. pleuropneumoniae has been recently reported in different countries, the current situation in Canada is unknown. The aim of the current study was to determine the antimicrobial susceptibilities of 43 strains of A. pleuropneumoniae isolated in Canada and to detect antimicrobial resistance genes with an oligonucleotide microarray.

All isolates were susceptible to ceftiofur, florfenicol, enrofloxacin, erythromycin, clindamycin, trimethoprim/sulfamethoxazole, and tilmicosin. A low level of resistance was observed toward tiamulin, penicillin, and ampicillin as well as danofloxacin. Previous studies reported similar susceptibility data for A. pleuropneumoniae for florfenicol^22,34,54 and ceftiofur.^{2,10,31,34,42,44,53,54} However, a recent study from Czech Republic reported for the first time florfenicol resistance at a low degree (0.8%).³² The presence of the floR gene was detected by PCR in all their resistant isolates.

Tilmicosin and erythromycin, both macrolide antimicrobials, were active against all the A. pleuropneumoniae isolates tested. This result is similar to those found by Salmon et al.⁴⁴

In this study, enrofloxacin was highly active against A. pleuropneumoniae while a low level of resistance was observed for danofloxacin. These results were in agreement with those previously reported.^{2,21,22,34,44,54} However, the emergence of enrofloxacin-resistant A. pleuropneumoniae isolates was recently described in Taiwan, Denmark, Poland, and England.^10,23 More recently, this resistance was linked to multiple target gene (gyrA, parC, and parE) mutations and active efflux pumps⁵¹ but mainly involved mutations in the GyrA protein. It was observed that increasing enrofloxacin MIC values correlated with stepwise accumulation of mutations in the gyrA gene with MIC starting as low as 0.25 μg/ml. Interestingly, five of our isolates have an MIC ≥0.25 μg/ml for danofloxacin and such mutations are under evaluation.

Only three (7%) of our isolates were resistant to tiamulin, which is closely similar (11%) to what was reported in Switzerland.³⁴ However, two studies have previously reported high number of resistant isolates,^31,38 while one study has very recently reported a low number (1.7%) of tiamulin-resistant isolates of A. pleuropneumoniae.³²

The MIC values of aminoglycosides gentamicin, neomycin, and spectinomycin were found to be monomodally distributed, suggesting that no acquired resistance is present among A. pleuropneumoniae. Results demonstrated that none of the 43 isolates contained the gentamicin resistance genes ant(2′′)-Ia (aadB), aac(3)-IIc (aacC2), and aac(3)-IVa (aacC4). The other aminoglycosides neomycin and spectinomycin had higher MIC values showing relatively less susceptibilities than gentamicin, which is in agreement with other reports.^10,34 Aminoglycosides have the ability to produce extended residue times in food animals.⁴⁰ Thus, these drugs are usually used to treat severe infections and extra-label usage should be avoided.

The sulII gene was found in 20.9% of our A. pleuropneumoniae isolates, whereas sulIa, sulI, and sulIII genes were not detected. This is similar to what was previously reported in Switzerland with 15% of sulfonamide resistance attributed to sulII with no other genes found.³⁴ The sulfonamide resistance of the remaining isolates could be explained by a specific mutation in the chromosomal gene folP, which encodes for a dihydropteroate synthase, as known for other organisms.^18,45 It could also be attributed to the presence of a yet unknown mechanism in A. pleuropneumoniae. Resistance to sulfonamides has been reported previously and is not uncommon.^2,22,44 Resistance to the combination trimethoprim/sulfamethoxazole has been reported in A. pleuropneumoniae isolated in Taiwan and in Switzerland.^10,34

As indicated previously, a low level of resistance was observed toward penicillin and ampicillin. The bla_ROB-1 gene, known to be widespread among Pasteurellaceae including A. pleuropneumoniae,²⁹ encodes an unusual class A β-lactamase that could have originated from Gram-positive bacteria.²⁸ This β-lactamase is probably responsible for the resistance to β-lactams of a considerable number of A. pleuropneumoniae isolates reported in previous studies.^{10,21,22,31,34,38,44,54} Also, we report an ampicillin MIC₉₀ of >8 μg/ml whereas, in 1995, ampicillin MIC₉₀ was of 0.25 μg/ml for Canadian strains.⁴⁴ Thus, this study reveals a decrease of ampicillin activity against Canadian A. pleuropneumoniae strains over time.

We observed a high level of resistance to chlortetracycline (88.4%) and oxytetracycline (90.7%). The strains showing resistance to tetracycline antimicrobials contained at least one of the following tet genes: tetB, tetO, tetH, or tetC. The frequencies of tetB, tetH, and tetO genes in the tested isolates were consistent with those previously reported for A. pleuropneumoniae isolates from Spain.⁵ To our knowledge, this is the first report documenting the presence of the tetC gene in A. pleuropneumoniae and also likely the first in a Pasteurellaceae member.

Five isolates showed multiresistance to penicillins (bla_ROB-1), streptomycin [aph3′′ (strA)], sulfonamides (sulII), and tetracyclines (tetO) antimicrobials whereas three others showed multiresistance to streptomycin [aph3′′ (strA)], sulfonamides (sulII), and tetracyclines (tetB, tetO, or tetB/tetH) antimicrobials. No correlation was observed between the distribution of antimicrobial resistance and the serovars of A. pleuropneumoniae, supporting the finding of previous studies.^14,31,34 Analysis of the resistance genes present in Pasteurellaceae strongly suggests that there is a resistance gene flux between the Pasteurellaceae and other Gram-negative, but also Gram-positive bacteria.⁴⁶

The impact of biofilm formation on susceptibility to antimicrobials was also evaluated. A. pleuropneumoniae has the ability to form biofilms under specific growth conditions.^30,33 Bacterial biofilms are structured communities of bacterial cells enclosed in a self-produced polymer matrix that is attached to a surface.²⁷ Biofilm formation is considered to be an important trait of some pathogens and biofilms protect and allow bacteria to survive and thrive in hostile environments.²⁷ It is well-known that bacteria within biofilms can be 10 to 1,000 times more resistant to antibiotics and disinfectants than their planktonic counterparts.^9,27 Furthermore, MIC of planktonic bacteria does not correlate with the concentration required to eradicate biofilms.^9,27 It has been demonstrated that treatment of a strain of A. pleuropneumoniae biofilms with the glycosyl hydrolase dispersin B rendered them more sensitive to killing by ampicillin.²⁵ In the current study, cells of A. pleuropneumoniae in a biofilm were 100 to 30,000 times more resistant to antimicrobials than their planktonic counterparts. Based on the control and the MBCB values, it can be concluded that biofilm formation in A. pleuropneumoniae clearly contributes to antibiotic resistance and this is consistent with previous reports on various other bacteria of veterinary importance.^27,39

In summary, all isolates were susceptible to ceftiofur, florfenicol, enrofloxacin, erythromycin, clindamycin, trimethoprim/sulfamethoxazole, and tilmicosin. A low level of resistance was observed toward tiamulin, penicillin, and ampicillin as well as danofloxacin. We observed a high level of resistance to chlortetracycline and oxytetracycline. The strains showing resistance to tetracycline antimicrobials contained at least one of the following tet genes: tetB, tetO, tetH, or tetC. Multiresistances to four (ampicillin, streptomycin, sulfonamide, and tetracycline) and three (streptomycin, sulfonamide, and tetracycline) antimicrobials were observed. To the best of our knowledge, this is the first description of tetC gene in Pasteurellaceae. Finally, cells of A. pleuropneumoniae in a biofilm were 100 to 30,000 times more resistant to antimicrobials than their planktonic counterparts. The MIC is the gold standard for the determination of antimicrobial susceptibility of planktonic bacteria of human and animal pathogens but often does not correlate with the concentration required to eradicate biofilms. This is an important aspect of antimicrobial therapy that should not be neglected.

Footnotes

Acknowledgments

The authors thank M. Ngeleka, D. Slavic, and S. Messier for providing strains, and K.R. Mittal for serotyping the strains. We also thank G. Bruant and P. Garneau for their help with the microarray experiments and analyses. This work has been supported by Discovery Grants (003428 to M.J. and 191461 to M.A.) from the Natural Sciences and Engineering Research Council of Canada. J.G. is a recipient of a Michel-Saucier postdoctoral fellowship.

Disclosure Statement

No competing financial interests exist.

References

Aarestrup

F.M.

, Duran

C.O.

, Burch

G.S.

2008. Antimicrobial resistance in swine production. Anim. Health Res. Rev., 9:135–148.

Aarestrup

F.M.

, Jensen

N.E.

1999. Susceptibility testing of Actinobacillus pleuropneumoniae in Denmark. Evaluation of three different media of MIC-determinations and tablet diffusion tests. Vet. Microbiol., 64:299–305.

Asawa

, Kobayashi

, Mitani

, Ito

, Morozumi

1995. Serotypes and antimicrobial susceptibility of Actinobacillus pleuropneumoniae isolated from piglets with pleuropneumonia. J. Vet. Med. Sci., 57:757–759.

Blackall

P.J.

, Klaasen

H.L.

, van den Bosch

, Kuhnert

, Frey

2002. Proposal of a new serovar of Actinobacillus pleuropneumoniae: serovar 15. Vet. Microbiol., 84:47–52.

Blanco

, Gutierrez-Martin

C.B.

, Rodriguez-Ferri

E.F.

, Roberts

M.C.

, Navas

2006. Distribution of tetracycline resistance genes in Actinobacillus pleuropneumoniae isolates from Spain. Antimicrob. Agents Chemother., 50:702–708.

Blanco

, Kadlec

, Gutierrez-Martin

C.B.

, Martin de la Fuente

A.J.

, Schwarz

, Navas

2007. Nucleotide sequence and transfer properties of two novel types of Actinobacillus pleuropneumoniae plasmids carrying the tetracycline resistance gene tet(H) J. Antimicrob. Chemother., 60:864–867.

Bossé

J.T.

, Janson

, Sheehan

B.J.

, Beddek

A.J.

, Rycroft

A.N.

, Kroll

J.S.

, Langford

P.R.

2002. Actinobacillus pleuropneumoniae: pathobiology and pathogenesis of infection. Microbes Infect., 4:225–235.

Bruant

, Maynard

, Bekal

, Gaucher

, Masson

, Brousseau

, Harel

2006. Development and validation of an oligonucleotide microarray for detection of multiple virulence and antimicrobial resistance genes in Escherichia coli. Appl. Environ. Microbiol., 72:3780–3784.

Ceri

, Olson

M.E.

, Turner

R.J.

2010. Needed, new paradigms in antibiotic development. Expert Opin. Pharmacother., 11:1233–1237.

10.

Chang

C.F.

, Yeh

T.M.

, Chou

C.C.

, Chang

Y.F.

, Chiang

T.S.

2002. Antimicrobial susceptibility and plasmid analysis of Actinobacillus pleuropneumoniae isolated in Taiwan. Vet. Microbiol., 84:169–177.

11.

Chiers

, De Waele

, Pasmans

, Ducatelle

, Haesebrouck

2010. Virulence factors of Actinobacillus pleuropneumoniae involved in colonization, persistence and induction of lesions in its porcine host. Vet. Res., 41:65.

12.

Chiou

C.S.

, Jones

A.L.

1995. Expression and identification of the strA-strB gene pair from streptomycin-resistant Erwinia amylovora. Gene, 152:47–51.

13.

[CLSI] Clinical, Laboratory Standards Institute. 2008. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals: Approved Standard. 3rd. Wayne, PA, USA: CLSI, 116M31-A3,.

14.

Dom

, Hommez

, Castryck

, Devriese

L.A.

, Haesebrouck

1994. Serotyping and quantitative determination of in vitro antibiotic susceptibility of Actinobacillus pleuropneumoniae strains isolated in Belgium (July 1991-August 1992) Vet. Q., 16:10–13.

15.

Dubreuil

J.D.

, Jacques

, Mittal

K.R.

, Gottschalk

2000. Actinobacillus pleuropneumoniae surface polysaccharides: their role in diagnosis and immunogenicity. Anim. Health Res. Rev., 1:73–93.

16.

[ERS] Economic Research Service, [USDA] United States Department of Agriculture. 2008. Hogs: Trade. www.ers.usda.gov/Briefing/Hogs/Trade.htm. 2011 June 15.

17.

Fales

W.H.

, Morehouse

L.G.

, Mittal

K.R.

, Bean-Knudsen

, Nelson

S.L.

, Kintner

L.D.

, Turk

J.R.

, Turk

M.A.

, Brown

T.P.

, Shaw

D.P.

1989. Antimicrobial susceptibility and serotypes of Actinobacillus (Haemophilus) pleuropneumoniae recovered from Missouri swine. J. Vet. Diagn. Invest., 1:16–19.

18.

Fiebelkorn

K.R.

, Crawford

S.A.

, Jorgensen

J.H.

2005. Mutations in folP associated with elevated sulfonamide MICs for Neisseria meningitidis clinical isolates from five continents. Antimicrob. Agents Chemother., 49:536–540.

19.

Garneau

, Labrecque

, Maynard

, Messier

, Masson

, Archambault

, Harel

2010. Use of a bacterial antimicrobial resistance gene microarray for the identification of resistant Staphylococcus aureus. Zoonoses Public Health, 57,Suppl 1:94–99.

20.

Gouré

, Findlay

W.A.

, Deslandes

, Bouevitch

, Foote

S.J.

, MacInnes

J.I.

, Coulton

J.W.

, Nash

J.H.

, Jacques

2009. Microarray-based comparative genomic profiling of reference strains and selected Canadian field isolates of Actinobacillus pleuropneumoniae. BMC Genomics, 10:88.

21.

Gutierrez

C.B.

, Piriz

, Vadillo

, Rodriguez-Ferri

E.F.

1993. In vitro susceptibility of Actinobacillus pleuropneumoniae strains to 42 antimicrobial agents. Am. J. Vet. Res., 54:546–550.

22.

Gutierrez-Martin

C.B.

, Blanco

N.G.

, Blanco

, Navas

, Rodriguez-Ferri

E.F.

2006. Changes in antimicrobial susceptibility of Actinobacillus pleuropneumoniae isolated from pigs in Spain during the last decade. Vet. Microbiol., 115:218–222.

23.

Hendriksen

R.S.

, Mevius

D.J.

, Schroeter

, Teale

, Jouy

, Butayer

, Franco

, Utinane

, Amado

, Moreno

, Greko

, Stark

K.D.

, Berghold

, Myllyniemi

A.L.

, Hoszowski

, Sunde

, Aarrestrup

F.M.

2008. Occurrence of antimicrobial resistance among bacterial pathogens and indicator bacteria in pigs in different European countries from year 2002–2004; the ARBAO-II study. Acta Vet. Scand., 50:19.

24.

Ito

, Ishii

, Akiba

2004. Analysis of the complete nucleotide sequence of an Actinobacillus pleuropneumoniae streptomycin-sulfonamide resistance plasmid, pMS260. Plasmid, 51:41–47.

25.

Izano

E.A.

, Sadovskaya

, Vinogradov

, Mulks

M.H.

, Velliyagounder

, Ragunath

, Kher

W.B.

, Ramasubbu

, Jabbouri

, Perry

M.B.

, Kaplan

J.B.

2007. Poly-N-acetylglucosamine mediates biofilm formation and antibiotic resistance in Actinobacillus pleuropneumoniae. Microb. Pathog., 43:1–9.

26.

Jacques

2004. Surface polysaccharides and iron-uptake systems of Actinobacillus pleuropneumoniae. Can. J. Vet. Res., 68:81–85.

27.

Jacques

, Aragon

, Tremblay

Y.D.N.

2010. Biofilm formation in bacterial pathogens of veterinary importance. Anim. Health Res. Rev., 11:97–121.

28.

Juteau

J.M.

, Lévesque

R.C.

1990. Sequence analysis and evolutionary perspectives of ROB-1 beta-lactamase. Antimicrob. Agents Chemother., 34:1354–1359.

29.

Juteau

J.M.

, Sirois

, Medeiros

A.A.

, Lévesque

R.C.

1991. Molecular distribution of ROB-1 beta-lactamase in Actinobacillus pleuropneumoniae. Antimicrob. Agents Chemother., 35:1397–1402.

30.

Kaplan

J.B.

, Mulks

M.H.

2005. Biofilm formation is prevalent among field isolates of Actinobacillus pleuropneumoniae. Vet. Microbiol., 108:89–94.

31.

Kim

, Min

, Choi

, Cho

W.S.

, Cheon

D.S.

, Kwon

, Kim

, Chae

2001. Antimicrobial susceptibility of Actinobacillus pleuropneumoniae isolated from pigs in Korea using new standardized procedures. J. Vet. Med. Sci., 63:341–342.

32.

Kucerova

, Hradecka

, Nechvatalova

, Nedbalcova

2011. Antimicrobial susceptibility of Actinobacillus pleuropneumoniae isolates from clinical outbreaks of porcine respiratory diseases. Vet. Microbiol., 150:203–206.

33.

Labrie

, Pelletier-Jacques

, Deslandes

, Ramjeet

, Auger

, Nash

J.H.

, Jacques

2010. Effects of growth conditions on biofilm formation by Actinobacillus pleuropneumoniae. Vet. Res., 41:03.

34.

Matter

, Rossano

, Limat

, Vorlet-Fawer

, Brodard

, Perreten

2007. Antimicrobial resistance profile of Actinobacillus pleuropneumoniae and Actinobacillus porcitonsillarum. Vet. Microbiol., 122:146–156.

35.

Matter

, Rossano

, Sieber

, Perreten

2008. Small multidrug resistance plasmids in Actinobacillus porcitonsillarum. Plasmid, 59:144–152.

36.

Maynard

, Fairbrother

J.M.

, Bekal

, Sanschagrin

, Lévesque

R.C.

, Brousseau

, Masson

, Larivière

, Harel

2003. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob. Agents Chemother., 47:3214–3221.

37.

Morioka

, Asai

, Nitta

, Yamamoto

, Ogikubo

, Takahashi

, Suzuki

2008. Recent trends in antimicrobial susceptibility and the presence of the tetracycline resistance gene in Actinobacillus pleuropneumoniae isolates in Japan. J. Vet. Med. Sci., 70:1261–1264.

38.

Nadeau

, Larivière

, Higgins

, Martineau

G.P.

1988. Minimal inhibitory concentrations of antimicrobial agents against Actinobacillus pleuropneumoniae. Can. J. Vet. Res., 52:315–318.

39.

Olson

M.E.

, Ceri

, Morck

D.W.

, Buret

A.G.

, Read

R.R.

2002. Biofilm bacteria: formation and comparative susceptibility to antibiotics. Can. J. Vet. Res., 66:86–92.

40.

Payne

M.A.

, Baynes

R.E.

, Sundlof

S.E.

, Craigmill

, Webb

A.I.

, Riviere

J.E.

1999. Drugs prohibited from extralabel use in food animals. J. Am. Vet. Med. Assoc., 215:28–32.

41.

Pettit

R.K.

, Weber

C.A.

, Kean

M.J.

, Hoffmann

, Pettit

G.R.

, Tan

, Franks

K.S.

, Horton

M.L.

2005. Microplate Alamar blue assay for Staphylococcus epidermidis biofilm susceptibility testing. Antimicrob. Agents Chemother., 49:2612–2617.

42.

Raemdonck

D.L.

, Tanner

A.C.

, Tolling

S.T.

, Michener

S.L.

1994. Antimicrobial susceptibility of Actinobacillus pleuropneumoniae, Pasteurella multocida and Salmonella choleraesuis isolates from pigs. Vet. Rec., 134:5–7.

43.

Ramjeet

, Deslandes

, Gouré

, Jacques

2008. Actinobacillus pleuropneumoniae vaccines: from bacterins to new insights into vaccination strategies. Anim. Health Res. Rev., 9:1–21.

44.

Salmon

S.A.

, Watts

J.L.

, Case

C.A.

, Hoffman

L.J.

, Wegener

H.C.

, Yancey

R.J.

Jr.

1995. Comparison of MICs of ceftiofur and other antimicrobial agents against bacterial pathogens of swine from the United States, Canada, and Denmark. J. Clin. Microbiol., 33:2435–2444.

45.

Skold

2001. Resistance to trimethoprim and sulfonamides. Vet. Res., 32:261–273.

46.

Schwarz

2008. Mechanisms of antimicrobial resistance in Pasteurellaceae. Kuhnert

, Christensen

Pasteurellaceae: Biology, Genomics and Molecular Aspects. Caister Academic Press: Norfolk, United Kingdom, 197–225.

47.

Schwarz

, Böttner

, Goossens

, Hafez

H.M.

, Hartmann

, Kaske

, Kehrenberg

, Kietzmann

, Klarmann

, Klein

, Krabisch

, Luhofer

, Richter

, Schulz

, Sigge

, Waldmann

K.H.

, Wallmann

, Werckenthin

2008. A proposal of clinical breakpoints for amoxicillin applicable to porcine respiratory tract pathogens. Vet. Microbiol., 126:178–188.

48.

Vaillancourt

J.P.

, Higgins

, Martineau

G.P.

, Mittal

K.R.

, Larivière

1988. Changes in the susceptibility of Actinobacillus pleuropneumoniae to antimicrobial agents in Quebec (1981–1986) J. Am. Vet. Med. Assoc., 193:470–473.

49.

Vanden Bergh

, Zecchinon

, Fett

, Desmecht

2008. Pleuropneumonie à Actinobacillus pleuropneumoniae: pahogénie, diagnostic, traitement et prophylaxie. Ann. Méd. Vét., 152:152–179.

50.

[VADS] Veterinary Antimicrobial Decision Support. 2011. www.vads.org. 2011 June 15.

51.

Wang

Y.-C.

, Chan

J.P.-W.

, Yeh

K.-S.

, Chang

C.-C.

, Hsuan

S.-L.

, Hsieh

Y.-M.

, Chang

Y.-C.

, Lai

T.-C.

, Lin

W.-H.

, Chen

T.-H.

2010. Molecular characterization of enrofloxacin resistant Actinobacillus pleuropneumoniae isolates. Vet. Microbiol., 142:309–312.

52.

Wasteson

, Roe

D.E.

, Falk

, Roberts

M.C.

1996. Characterization of tetracycline and erythromycin resistance in Actinobacillus pleuropneumoniae. Vet. Microbiol., 48:41–50.

53.

Yang

C.Y.

, Lin

C.N.

, Lin

C.F.

, Chang

T.C.

, Chiou

M.T.

2011. Serotypes, antimicrobial susceptibility, and minimal inhibitory concentrations of Actinobacillus pleuropneumoniae isolated from slaughter pigs in Taiwan (2002–2007) J. Vet. Med. Sci., 73:205–208.

54.

Yoshimura

, Takagi

, Ishimura

, Endoh

Y.S.

2002. Comparative in vitro activity of 16 antimicrobial agents against Actinobacillus pleuropneumoniae. Vet. Res. Commun., 26:11–19.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.04 MB