Investigation of Genetic Diversity of the bla SHV Gene and Development of an Oligonucleotide Microarray to Detect Mutations in the bla SHV Gene

Abstract

SHV β-lactamases, including SHV extended-spectrum β-lactamases, are widespread throughout the world, and confer a broad spectrum of resistance to antibiotic drugs. Mutations ranging from single base-pair substitutions to small deletions within bla_SHV often result in diminished activity and an increased susceptibility to β-lactamase inhibitors. Here, we collected 1,320 clinical isolates from three hospitals in Shanghai. We developed a novel oligonucleotide microarray to detect mutations in the bla_SHV gene, and validated the array data by direct sequencing. Sixty-two of the 1,320 isolates carried the bla_SHV gene. The genotypes of these 62 isolates were successfully called by the microarray and were consistent with the genotypes identified by bidirectional sequencing. Sixteen different bla_SHV alleles were identified. The SHV-1 variant was the most frequent (32.26%), followed by SHV-11 (27.42%) and SHV-12 (25.81%). Of the 62 isolates, 12 contained two different bla_SHV alleles. Our microarray significantly facilitated the identification of bla_SHV variants, which makes it an attractive option for the detection of SHV variants in clinical laboratories.

Introduction

The emergence of bacterial resistance to expanded-spectrum β-lactam antibiotics and β-lactamase inhibitors has become a serious global problem over the last few decades. To date, more than 800 β-lactamase enzymes have been identified from Gram-negative bacilli.⁴³ According to their amino acid sequence similarity, β-lactamases are classified into four classes, A to D.^1,12 SHV-type enzymes, belonging to class A, are the most prevalent of the extended-spectrum β-lactamases (ESBLs) among bacteria. At least, 87 functional mutations, ranging from single base-pair substitutions to small deletions, have been identified so far (www.lahey.org/studies/). The mutations L35Q, G238S, and E240K are the most common and are associated with the vast majority of SHV-type ESBLs. Conversion of a non-ESBL SHV enzyme to an ESBL is caused mainly by the mutation G238S, whereas the E240K mutation increases the enzymatic activity of an ESBL further and extends the spectrum of β-lactam antibiotics that it is able to hydrolyze.^17,30 One SHV β-lactamase, SHV-10, a derivative of SHV-5, has an inhibitor-resistant phenotype.³³ SHV-type β-lactamases are most frequently found in Klebsiella pneumoniae because of the high frequency of SHV-1 in K. pneumoniae,³¹ and account for up to 20% of the plasmid-mediated ampicillin resistance in this species.^11,39 SHV enzymes are also found in Acinetobacter spp. and Pseudomonas aeruginosa.²⁵ The prevalence of strains expressing SHV-type ESBLs varies greatly with time and geographic area, implying that their distribution is far from uniform.

Conventional laboratory methods, which are phenotype-based antimicrobial susceptibility tests, identify ESBL producers by detecting the presence of the ESBLs themselves. However, some bacteria that are susceptible to β-lactam antibiotics in vitro by routine methods show resistance to them in the clinic. Therefore, the prevalence of SHV-type ESBLs may be underestimated, and tests to identify the presence of an ESBL are not sufficiently reliable to determine ESBL producers definitively.^11,36 Furthermore, multiple bla_SHV gene copies were observed in most, if not all, strains containing the bla_SHV gene^16,38; thus, it is important to determine the different alleles of the bla_SHV gene within individual isolates. Isoelectric focusing (IEF) can identify the coexistence of SHV and TEM in one isolate.¹⁸ However, many β-lactamases possess an identical pI, and thus the identification of coexisting SHV variants by IEF is far from unambiguous. A high mutation rate allows fast adaptation and enables bacteria to evolve rapidly in one generation. Genes encoding β-lactamases are usually highly polymorphic because of antibiotic selective pressure and high mutation rates. In contrast to phenotype-based tests, variants of the bla_SHV gene can be accurately identified by genotyping polymorphic sites in the bla_SHV gene.

Various approaches to investigate single-nucleotide polymorphisms (SNPs) have been applied to identify mutations in β-lactamase genes, including single-base extension,¹⁶ polymerase chain reaction (PCR)–restriction fragment length polymorphism,⁸ ligase chain reaction,²¹ matrix-assisted laser desorption ionization–time-of-flight mass spectrometry,⁸ and microarray technology.^17,5 Among these methods, only microarray technology provides the ability to genotype SNPs with a high degree of multiplexing. Diagnostic microarrays have been developed for the detection of microorganisms,^6,22,23 antibiotic-resistance genes,^{3,7,13, 18} and drug-metabolism genes.²⁰ However, an assay that is able to genotype more than 50 mutations of the bla_SHV gene simultaneously and discriminate heterozygotes has not yet been described.

In the present study, we developed a microarray to sample the bla_SHV gene in clinical samples. This novel oligonucleotide microarray was used to determine 54 mutations in the bla_SHV gene. It was able to distinguish 67 variant alleles of the bla_SHV gene and discriminate different alleles within an isolate.

Materials and Methods

Bacterial strains and DNA extraction

Strain 46112 and another two K. pneumoniae strains, containing SHV-1, SHV-12, and SHV-18, respectively, were used as controls. These strains were validated by direct sequencing. A total of 1,320 nonreplicate isolates were collected from Ruijin Hospital, Dongfang Hospital, and Shanghai No. 1 Hospital. The isolates were identified using standard biochemical tests.²⁸ The clones were scraped from the solid culture medium, and plasmid DNA was extracted from them by alkaline lysis.

Primer design

Primers were designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www_slow.cgi) on the basis of the published sequences of the bla_SHV and rrlA genes from the GenBank database and published data on mutations in the bla_SHV gene (www.lahey.org/studies/). The primer sequences are listed in Table 1.

Table 1.

Primer Sequences

Primer	Sequence	GenBank accession no.	Position ^a	Expected amplicon size (bp)
SHV-f^b	GTGGACTACTCGCCGGTCA	DQ247972	295–313	494
SHV-r^b	GGCGTATCCCGCAGATAAATCACCA	DQ247972	764–788
SHV-Up	CTCAAGGATGTATTGTGGTTATGCGT	DQ247972	−20–6	884
SHV-Low	GGGTTAGCGTTGCCAGTGCTCGAT	DQ247972	841–864
23S-f	CGGTCCTAAGGTAGCGAAATT	BA000007	1920–1940	340
23S-r	AGACCGCCCCAGTCAAAC	BA000007	2242–2259
T7^c	TAATGACTCACTATAGGG
ACSP6^c	ATTTAGGTGACACTATAG

Location of primers refers to the ATG translation start site of the bla_SHV gene and the GTG translation start site of the rrlA gene.

Sequencing primer.

Universal primer.

Detection of the bla_SHV gene

The bla_SHV and rrlA genes were co-amplified using the primer pairs SHV-f/SHV-r and 23S-f/23S-r, respectively, in a single duplex reaction by touchdown PCR.⁹ Amplification reactions were carried out in a total volume of 30 μl containing 0.3 mM of each deoxynucleoside triphosphate, 10 mM Tris–HCl (pH 8.3), 100 mM KCl, 2 mM MgCl₂, 0.5 μM of primers SHV-f and SHV-r, 0.16 μM of primers 23S-f and 23S-r, 60 ng of DNA, and 1.2 U of Taq (Takara). Cycling conditions were as follows: 94°C for 3 min, followed by 10 cycles of 94°C for 30 sec, 63°C for 30 sec with a 0.5°C decrement of the annealing temperature per cycle, and 72°C for 40 sec, followed by 30 cycles of 94°C for 30 sec, 58°C for 30 s, and 72°C for 40 sec, and a final extension of 5 min at 72°C. The PCR products were then separated and detected by 1.8% agarose gel electrophoresis.

Amplification of the full-length bla_SHV gene

To identify mutations in the bla_SHV gene, a 30-μl PCR reaction was carried out to amplify the full-length bla_SHV gene. The reaction mixture contained 0.3 mM of each deoxynucleoside triphosphate, 0.2 μM of primers SHV-Up and SHV-Low, 1× PCR reaction buffer, 2 mM MgCl₂, 70 ng of DNA, and 0.8 U of Ex Taq (Takara). The cycling conditions were as follows: 94°C for 3 min; 8 cycles of 94°C for 30 sec, 69°C for 40 sec with a 0.5°C decrement of the annealing temperature per cycle, and 72°C for 55 sec; 30 cycles of 94°C for 30 sec, 65°C for 40 sec, and 72°C for 55 sec; and a final extension of 5 min at 72°C.

Labeling and fragmentation

Fluorescent-target DNA for hybridization was synthesized by amplifying and labeling the full-length bla_SHV gene in a 90-μl PCR reaction. The reaction mixture contained 0.3 mM dATP, dGTP, and dTTP; 0.15 mM dCTP and CY3-dCTP (GE Healthcare); 0.2 μM of primers SHV-Up and SHV-Low; 1× PCR reaction buffer; 2 mM MgCl₂; 100 ng of DNA; and 2.5 U of Ex Taq (Takara). The cycling conditions were described as above. The full-length amplicons were purified with a QIAquick PCR Purification kit (Qiagen) and were then fragmented for 15 min at 37°C using DNase I (0.0012 U/μg of DNA) in a 20-μl volume containing 1 mM Tris–HCl, 0.25 mM MgCl₂, 0.05 mM CaCl₂, and 2.5 U of alkaline phosphatase (Fermentas), followed by heat inactivation at 95°C for 6 min.

SHV oligonucleotide microarray

Several allele-specific probes, with a perfectly matched (PM) and a mismatched (MM) probe, were designed to detect each SNP. The MM probe acted as a control for nonspecific hybridization. There were two PM probes for each SNP: one identical to the wild-type allele and one identical to the mutant-type allele. The PM and MM probes for an SNP differed only at the central base within the probe sequence, that is, the SNP site itself, or were offset from the central base by one to two bases in either direction. More than two PM probes were designed for mutations located close together, to avoid an effect of polymorphic sites on hybridization efficiency. Furthermore, to facilitate data analysis, when multiple PM probes were used for a given SNP, each mutant-type PM probe was arranged in a group with the corresponding wild-type PM and MM probe. All probes were 13- to 30-nt long with a melting temperature in the range of 49°C–55°C (Oligo 6 software; Molecular Biology Insights). Each probe had a 15-thymidine nucleotide spacer and was modified by the addition of an amino group to the 5′-end to allow covalent attachment of the probe to the glass slide surface. All 174 amino-modified oligonucleotides with a 15-thymidine spacer were dissolved at 25 μM in 6× SSC buffer (pH 7.0) with 0.05% SDS, and were printed in triplicate as three subarrays on aldehyde-coated glass slides (Cell Associates, Inc.) using a OmniGrid™ 100 microarrayer (GeneMachine). A total of 174 oligonucleotides were printed on each glass slide in a 6.3-mm×8.5-mm grid. The spot spacing was 115 μm, and the spot size was 185 μm. After printing, the SHV microarray was dried at room temperature for 2 hr and then stored desiccated at room temperature.

Hybridization

Fluorescently labeled and fragmented DNAs were added to a hybridization solution containing 6×SSPE, 5% dimethyl sulfoxide, 0.1% Triton X-100, and 1 nM fluorescent control oligonucleotide in a final volume of 25 μl. The hybridization solution was heated to 95°C for 5 min, immediately placed on ice, and 20 μl was transferred to the subarray for hybridization at 50°C for 2 hr. After hybridization, microarrays were washed with 2× SSC and 0.1% SDS at 42°C for 5 min and then washed with 1× SSC and 0.1% SDS at 42°C for 5 min and with 0.5× SSC at room temperature for 5 min.

Data analysis

Microarrays were scanned using a GenePix 4000B scanner (Axon Instruments). The resulting images were processed to obtain hybridization signal intensity values using GenePix Pro 3.0 software (Axon Instruments). We set the mean of the signal intensities of the negative hybridization probe plus three standard deviations to be the cut-off value to block weak or unreliable signals. If the signal intensity value of the probe was less than the cut-off value, its net signal intensity was set as zero. After subtraction of local background signal, the net signal intensity of each probe that was spotted in triplicate was averaged. For each probe set related to one SNP, the average value of one PM was regarded as a specific signal value only if the ratio of the PM minus the MM to the PM plus the MM was higher than 0.3. The genotype could not be assigned if the ratios of all the PMs were lower than or equal to 0.3.

To assign the genotypes, the allelic fractions (AFs) between the signal value from one of the alleles and the sum of the signal values from both possible alleles at each SNP site were calculated from the normalized mean.⁴²

Sequencing

PCR products were incubated with shrimp alkaline phosphatase and exonuclease I for 1 hr at 37°C followed by 15 min at 80°C.²⁹ The PCR products were then sequenced in both directions using the primers SHV-s and SHV-r using Big Dye chemistry and run on ABI 3700 (Applied Biosystems). Given that the isolates carried two distinct alleles of the bla_SHV gene, we used molecular haplotyping to delineate phase. The full-length PCR product was cloned into the pGEM-T vector (Promega). After transformation, a single colony was chosen for sequencing with T7 and SP6 primers. The difference between the reference sequence (SHV-1) and the cloned sequence provides the phased genotype for the plasmid.

Results

Prevalence of the bla_SHV gene in clinical isolates from Shanghai hospitals

We collected 1,320 cultures of bacteria from blood, abscesses, peritoneal fluid, catheter tips, lung, sputum, and throat cultures from patients in three Shanghai hospitals: Ruijin Hospital, Dongfang Hospital, and Shanghai No. 1 Hospital. Some were used for in vitro antimicrobial susceptibility tests. To screen for isolates containing the bla_SHV gene, we developed a PCR assay. In this duplex PCR assay, a 494-bp fragment amplified with the primer pair SHV-f and SHV-r indicated the presence of the bla_SHV gene; a 340-bp fragment from the rrlA gene served as a positive control. The positive control was amplified from all 1,320 isolates (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/mdr). The 494-bp fragment, indicative of the presence of the bla_SHV gene, was observed in 62 strains, which equates to 4.7% of the clinical samples.

Of the 62 strains, 47 were Enterobacteriaceae, four were Pseudomonas, and five were Staphylococcus. The fact that both Gram-negative and Gram-positive bacteria carried the bla_SHV gene implies that this gene is widely spread among divergent bacteria. Table 2 shows that the most common isolates containing the bla_SHV gene were from K. pneumoniae (33.87%) followed by Escherichia coli (20.97%), and Enterobacter cloacae (14.52%). The prevalence of the bla_SHV gene in Morganella morganii, Pseudomonas fluorescens, and Citrobacter freundii was higher than that in other species tested; however, because of the small sample size for these three species, these findings should be interpreted with caution.

Table 2.

The Prevalence of the bla_SHV Gene Among Clinical Isolates

		SHV-positive isolates
Species	No. of isolates	No. of isolates	% of total	% of species
Acinetobacter baumannii	77	3	4.84	3.90
Citrobacter freundii	3	1	1.61	33.33
Enterobacter aerogenes	9	1	1.61	11.11
Enterobacter cloacae	44	9	14.52	20.45
Enterococcus faecalis	51	2	3.23	3.92
Escherichia coli	266	13	20.97	4.89
Klebsiella pneumoniae	129	21	33.87	16.28
Morganella morgani	8	2	3.23	25.00
Pseudomonas aeruginosa	134	3	4.84	2.24
Pseudomonas fluorescens	3	1	1.61	33.33
Staphylococcus epidermidis	49	1	1.61	2.04
Staphylococcus haemolyticus	121	4	6.45	3.31
Viridans streptococci	26	1	1.61	3.85
Other species^a	400	0	0.00	0.00
Total	1320	62	100	4.70

Other species included Chryseobacterium meningosepticum, Enterococcus faecium, Haemophilus influenzae, Stenotrophomonas maltophilia, Streptococcus agalactiae, Proteus mirabilis, Staphylococcus aureus, Serratia marcescens, Staphylococcus warneri, Staphylococcus capitis, and Staphylococcus hominis.

SHV oligonucleotide microarray

We designed 174 oligonucleotide probes to detect five novel mutations and 49 published mutations in the bla_SHV gene. The microarray is unique in its ability to discriminate 67 known bla_SHV alleles, including five novel alleles.

For assay optimization, we sequenced three K. pneumoniae isolates, provided by Ruijin Hospital, containing SHV-1, SHV-12, and SHV-18 variants, respectively, for reference templates. Equal amounts of PCR products of any two reference templates were mixed and hybridized to the microarray to determine the AF limits. Furthermore, we also set a cut-off signal value and used the MM probes to block weak and nonspecific signals. By monitoring the allele discrimination performance of the microarray, we were able to optimize the hybridization and wash conditions. To assess assay quality, we used the microarray to genotype 62 isolates after complete discrimination of the mutations of the reference strains. All the mutations were successfully called, and the microarray results were in agreement with the genotypes obtained by bidirectional sequencing. These results indicated that our microarray was sufficiently sensitive to detect mutations in the bla_SHV gene. A typical microarray image is shown in Supplementary Fig. S2 (Supplementary Data are available online at www.liebertpub.com/mdr).

Allelic distribution of the bla_SHV gene in Shanghai

Sequencing avoids misidentification of the β-lactamase genes, and therefore is the standard molecular method to determine the alleles of the bla_SHV gene.¹ By bidirectional sequencing, we identified 25 mutations, including five novel nonsynonymous mutations (V75A, A79T, D101H, S203L, and D214) (Table 3) and 10 synonymous mutations. On this basis, 32.26% of bla_SHV alleles were SHV-1; 27.42% were SHV-11; and 25.81% were SHV-12 (Table 3). Many other alleles were also identified, including SHV-2A, SHV-27, SHV-28, SHV-32, SHV-33, SHV-36, SHV-71, SHV-77, SHV-93, SHV-94, SHV-95, SHV-96, and SHV-97.

Table 3.

Allelic Distribution of the bla_SHV Gene in Different Bacterial Species

Species (no. of isolates)	SHV-1	SHV-2a 238S 240K	SHV-11 35Q	SHV-12 35Q 238S 240K	SHV-27 156D	SHV-28 7F	SHV-32 126V 156D	SHV-33 226S	SHV-36 8V 35Q	SHV-71 112Y 146V	SHV-77 35Q 75A	SHV-93 35Q, 79T 156D	SHV-94 35Q 101H	SHV-95 203L	SHV-96 35Q 214A
Klebsiella pneumoniae (21)	4		8	3	2	1	1	1				1
Escherichia coli (13)	6	1	5	2							1		1
Enterobacter cloacae (9)	1		1	6					1
Staphylococcus haemolyticus (4)	2		1												1
Pseudomonsa aeruginosa (3)	1		1	1
Acinetobacter baumannii (3)	1		1	1											1
Enterococcus faecalis (2)	1
Staphylococcus epidermidis (1)				1
Enterobacter aerogenes (1)										1
Morganella morgani (2)	1			1
Pseudomonsa fluorescens (1)	1			1
Citrobacter freundii (1)	1													1
Viridans streptococci (1)	1
Total (62)	20	1	17	16	2	1	1	1	1	1	1	1	1	1	2
% of total	32.26	1.61	27.42	25.81	3.23	1.61	1.61	1.61	1.61	1.61	1.61	1.61	1.61	1.61	3.23

SHV-type ESBLs

Sixteen isolates harbored a known SHV-type ESBL. This corresponds to a frequency of 1.21% among all the isolates, excluding the six isolates carrying novel alleles whose phenotype was not known. The prevalence of ESBL-producing K. pneumoniae and E. coli has been increasing among hospitalized patients. The isolates were K. pneumoniae (three isolates), E. cloacae (six isolates), E. coli (two isolates), M. morganii (one isolate), Acinetobacter baumannii (one isolate), P. aeruginosa (one isolate), P. fluorescens (one isolate), and Staphylococcus epidermidis (one isolate).

Coexistence of multiple bla_SHV alleles within individual isolates

We investigated the coexistence of different bla_SHV alleles comprehensively by directly sequencing PCR products of the full-length bla_SHV gene rather than by clone sequencing. Of the 62 isolates, 12 carried two different bla_SHV alleles (19.35%), including six that carried two distinct suballeles. In addition, in three isolates, SHV-12 coexisted with SHV-1, a suballele of SHV-12, and SHV-2a, respectively.

Discussion

We have developed an oligonucleotide microarray that can detect 54 mutations in the bla_SHV gene. To our knowledge, this is the first time this technology has been used to detect so many mutations in bla_SHV.

Even though many approaches have been developed to detect ESBLs, none is perfect.⁴ Therefore, it is necessary to change cephalosporin breakpoints and apply additional ESBL detection methods.³¹ Nevertheless, the optimal method to identify ESBL producers is to detect the presence of β-lactamase genes directly, not the β-lactamases they produce. In the present study, we used a positive control PCR to avoid false negatives and ensure detection of the bla_SHV gene in all positive samples, not just the ESBL producers.

The coexistence of multiple genes encoding ESBLs within an individual isolate is rare.^24–32,41 In contrast, the coexistence of two different alleles of the β-lactamase gene in an individual bacterium is more prevalent. It is of practical significance to distinguish different bla_SHV alleles in an isolate,¹⁶ but IEF is unable to discriminate different β-lactamases within an isolate, and current genotyping approaches can only identify a few known mutations.^27,37 Because a microarray can simultaneously detect tens of thousands of SNPs, we believe that this is the best method to detect mutations in antibiotic-resistance genes. Microarray analysis also has advantages over conventional molecular approaches and antibiotic-resistance tests. We used AF limits to facilitate the detection of heterozygotes, thus overcoming some of the difficulties in assigning heterozygotes using the microarray technology.^10,13

The current disadvantages of microarrays include the inability to detect novel mutations, and the limitations to multiplexing afforded by DNA preparation.¹⁴ When these challenges are overcome, it is possible that a single microarray could detect not only all the variants of the antibiotic-resistance genes but also all the bacteria containing these genes. It is likely that many conventional clinical laboratory tests will be replaced by microarray analysis in the future.

Alleles encoding SHV-type ESBLs included SHV-2a, SHV-12, and SHV-27. Fifteen of the 16 ESBL producers carried SHV-12. Moreover, SHV-12 was found in a broad range of bacterial species, being most prevalent in E. cloacae and P. fluorescens, but also present in P. aeruginosa, M. morganii, S. epidermidis, and A. baumannii. SHV-12, which was originally reported in Switzerland, is the dominant SHV-type ESBL not only in Shanghai but also in other provinces in China^15,33,40, as well as in Korea³⁴ and Italy.³² SHV-5, previously reported in the Zhejiang province, China,³³ was not found in this study.

In the present study, the occurrence of the bla_SHV gene was 14.52% among E. cloacae isolates, but was 33.87% among K. pneumoniae isolates. Because of this high frequency, combined with the high incidence of SHV-type ESBLs in K. pneumoniae, SHV-type ESBLs may be one of the main causes of resistance of E. cloacae to β-lactam antibiotics in Shanghai. In this study, we found that the occurrence of SHV-type ESBLs in E. cloacae (13.63%) was higher than that in K. pneumoniae (2.33%); this differs from previous reports.^26,34,35 Our high incidence of SHV-type ESBLs in E. cloacae is consistent with the high prevalence of the bla_SHV gene in E. cloacae reported by Hammami et al.¹⁵ A recent survey revealed that CTX-M-type ESBLs are the most common ESBLs in E. coli and K. pneumoniae in China, but the most common type of ESBL differs among the provinces in China, implying a different use of antibiotics and unequal prevalence of ESBL genes across different geographical areas.³³

In conclusion, we developed a microarray to detect mutations in the bla_SHV gene and investigated the genetic diversity of the bla_SHV gene among clinical isolates from Shanghai by multiplex PCR and sequencing. The allele frequencies of the bla_SHV gene in Shanghai are different from those in other regions.^24,32,19 By comparison with conventional methods, our microarray can rapidly identify almost all known variants of the bla_SHV gene and will be a valuable tool for epidemiological surveillance of the spread of SHV variants.

Footnotes

Acknowledgments

This work was supported by the Shanghai Science and Technology Committee Fund of Shanghai grants 06XD14219, the National High Technology Research and Development Program of China (863 Program) (Grant No. SQ2010AA1000691008), and the National Natural Science Foundation of China (Grant No. 31101091).

Disclosure Statement

The authors have no conflicts of interest to declare.

References

Ambler

R.P.

, Coulson

A.F.

, Frere

J.M.

et al. 1991. A standard numbering scheme for the class A beta-lactamases. Biochem. J., 276,Pt 1:269–270.

Anjum

M.F.

, Choudhary

, Morrison

et al. 2011. Identifying antimicrobial resistance genes of human clinical relevance within Salmonella isolated from food animals in Great Britain. J. Antimicrob. Chemother., 66:550–559.

Aragon

L.M.

, Navarro

, Heiser

, Garrigo

, Espanol

, Coll

2006. Rapid detection of specific gene mutations associated with isoniazid or rifampicin resistance in Mycobacterium tuberculosis clinical isolates using non-fluorescent low-density DNA microarrays. J. Antimicrob. Chemother., 57:825–831.

Bradford

P.A.

2001. Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev., 14:933–951.

Call

D.R.

, Bakko

M.K.

, Krug

M.J.

, Roberts

M.C.

2003. Identifying antimicrobial resistance genes with DNA microarrays. Antimicrob. Agents Chemother., 47:3290–3295.

Call

D.R.

2005. Challenges and opportunities for pathogen detection using DNA microarrays. Crit. Rev. Microbiol., 31:91–99.

Cassone

, D'Andrea

M.M.

, Iannelli

, Oggioni

M.R.

, Rossolini

G.M.

, Pozzi

2006. DNA microarray for detection of macrolide resistance genes. Antimicrob. Agents Chemother., 50:2038–2041.

Chanawong

, M'Zali

F.H.

, Heritage

, Lulitanond

, Hawkey

P.M.

2000. Characterisation of extended-spectrum beta-lactamases of the SHV family using a combination of PCR-single strand conformational polymorphism (PCR-SSCP) and PCR-restriction fragment length polymorphism (PCR-RFLP) FEMS. Microbiol. Lett., 184:85–89.

Don

R.H.

, Cox

P.T.

, Wainwright

B.J.

, Baker

, Mattick

J.S.

1991. “Touchdown” PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res., 19:4008.

10.

Dong

Y.Y.

, Sheng

H.H.

, Yang

, Zeng

X.T.

, Wu

X.M.

2009. [A new SNP microarray technology based on single base extension] Yi. Chuan., 31:439–444.

11.

Espinal

, Garza-Ramos

, Reyna

et al. 2010. Identification of SHV-type and CTX-M-12 extended-spectrum beta-lactamases (ESBLs) in multiresistant Enterobacteriaceae from Colombian Caribbean hospitals. J. Chemother., 22:160–164.

12.

Garau

, Garcia-Saez

, Bebrone

et al. 2004. Update of the standard numbering scheme for class B beta-lactamases. Antimicrob. Agents Chemother., 48:2347–2349.

13.

Grimm

, Ezaki

, Susa

, Knabbe

, Schmid

R.D.

, Bachmann

T.T.

2004. Use of DNA microarrays for rapid genotyping of TEM beta-lactamases that confer resistance. J. Clin. Microbiol., 42:3766–3774.

14.

Gunderson

K.L.

, Steemers

F.J.

, Lee

, Mendoza

L.G.

, Chee

M.S.

2005. A genome-wide scalable SNP genotyping assay using microarray technology. Nat. Genet., 37:549–554.

15.

Hammami

, Boubaker

I.B.

, Saidani

et al. 2011. Characterization and molecular epidemiology of extended spectrum beta-lactamase producing enterobacter cloacae isolated from a tunisian hospital. Microb. Drug Resist., 18:59–65.

16.

Hammond

D.S.

, Schooneveldt

J.M.

, Nimmo

G.R.

, Huygens

, Giffard

P.M.

2005. bla(SHV) genes in klebsiella pneumoniae: different allele distributions are associated with different promoters within individual isolates. Antimicrob. Agents Chemother., 49:256–263.

17.

Jacoby

G.A.

1994. Genetics of extended-spectrum beta-lactamases. Eur. J. Clin. Microbiol. Infect. Dis., 13,Suppl 1:S2–S11.

18.

Jain

, Mondal

2008. TEM & SHV genes in extended spectrum beta-lactamase producing Klebsiella species beta their antimicrobial resistance pattern. Indian J. Med. Res., 128:759–764.

19.

Jeong

S.H.

, Bae

I.K.

, Lee

J.H.

et al. 2004. Molecular characterization of extended-spectrum beta-lactamases produced by clinical isolates of Klebsiella pneumoniae and Escherichia coli from a Korean nationwide survey. J. Clin. Microbiol., 42:2902–2906.

20.

Juran

B.D.

, Egan

L.J.

, Lazaridis

K.N.

2006. The AmpliChip CYP450 test: principles, challenges, and future clinical utility in digestive disease. Clin. Gastroenterol. Hepatol., 4:822–830.

21.

Kim

, Lee

H.J.

2000. Rapid discriminatory detection of genes coding for SHV beta-lactamases by ligase chain reaction. Antimicrob. Agents Chemother., 44:1860–1864.

22.

Kostrzynska

, Bachand

2006. Application of DNA microarray technology for detection, identification, and characterization of food-borne pathogens. Can. J. Microbiol., 52:1–8.

23.

Leinberger

D.M.

, Schumacher

, Autenrieth

I.B.

, Bachmann

T.T.

2005. Development of a DNA microarray for detection and identification of fungal pathogens involved in invasive mycoses. J. Clin. Microbiol., 43:4943–4953.

24.

Liu

, Ling

B.D.

, Zeng

, Lin

, Xie

Y.E.

, Lei

2008. Molecular characterization of extended-spectrum beta-lactamases produced by clinical isolates of Enterobacter cloacae from a Teaching Hospital in China. Jpn. J. Infect. Dis., 61:286–289.

25.

Livermore

D.M.

1995. beta-Lactamases in laboratory and clinical resistance. Clin. Microbiol. Rev., 8:557–584.

26.

Miro

, Mirelis

, Navarro

et al. 2005. Surveillance of extended-spectrum beta-lactamases from clinical samples and faecal carriers in Barcelona, Spain. J. Antimicrob. Chemother., 56:1152–1155.

27.

M'Zali

F.H.

, Heritage

, Gascoyne-Binzi

D.M.

, Snelling

A.M.

, Hawkey

P.M.

1998. PCR single strand conformational polymorphism can be used to detect the gene encoding SHV-7 extended-spectrum beta-lactamase and to identify different SHV genes within the same strain. J. Antimicrob. Chemother., 41:123–125.

28.

Navon-Venezia

, Hammer-Munz

, Schwartz

, Turner

, Kuzmenko

, Carmeli

2003. Occurrence and phenotypic characteristics of extended-spectrum beta-lactamases among members of the family Enterobacteriaceae at the Tel-Aviv Medical Center (Israel) and evaluation of diagnostic tests. J. Clin. Microbiol., 41:155–158.

29.

Nickerson

D.A.

, Tobe

V.O.

, Taylor

S.L.

1997. PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing. Nucleic Acids Res., 25:2745–2751.

30.

Nyberg

S.D.

, Osterblad

, Hakanen

A.J.

, Huovinen

, Jalava

, Resistance

T.F.

2007. Detection and molecular genetics of extended-spectrum beta-lactamases among cefuroxime-resistant Escherichia coli and Klebsiella spp. isolates from Finland, 2002–2004. Scand. J. Infect. Dis., 39:417–424.

31.

Paterson

D.L.

, Bonomo

R.A.

2005. Extended-spectrum beta-lactamases: a clinical update. Clin. Microbiol. Rev., 18:657–686.

32.

Perilli

, Dell'Amico

, Segatore

et al. 2002. Molecular characterization of extended-spectrum beta-lactamases produced by nosocomial isolates of Enterobacteriaceae from an Italian nationwide survey. J. Clin. Microbiol., 40:611–614.

33.

Prinarakis

E.E.

, Miriagou

, Tzelepi

, Gazouli

, Tzouvelekis

L.S.

1997. Emergence of an inhibitor-resistant beta-lactamase (SHV-10) derived from an SHV-5 variant. Antimicrob. Agents Chemother., 41:838–840.

34.

Ryoo

N.H.

, Kim

E.C.

, Hong

S.G.

et al. 2005. Dissemination of SHV-12 and CTX-M-type extended-spectrum beta-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae and emergence of GES-3 in Korea. J. Antimicrob. Chemother., 56:698–702.

35.

Spanu

, Luzzaro

, Perilli

, Amicosante

, Toniolo

, Fadda

2002. Occurrence of extended-spectrum beta-lactamases in members of the family Enterobacteriaceae in Italy: implications for resistance to beta-lactams and other antimicrobial drugs. Antimicrob. Agents Chemother., 46:196–202.

36.

Szabo

, Bonomo

R.A.

, Silveira

et al. 2005. SHV-type extended-spectrum beta-lactamase production is associated with Reduced cefepime susceptibility in Enterobacter cloacae. J. Clin. Microbiol., 43:5058–5064.

37.

Szabo

, Melan

M.A.

, Hujer

A.M.

et al. 2005. Molecular analysis of the simultaneous production of two SHV-type extended-spectrum beta-lactamases in a clinical isolate of Enterobacter cloacae by using single-nucleotide polymorphism genotyping. Antimicrob. Agents Chemother., 49:4716–4720.

38.

Tollentino

F.M.

, Polotto

, Nogueira

M.L.

et al. 2011. High prevalence of bla(CTX-M) extended spectrum beta-lactamase genes in Klebsiella pneumoniae isolates from a tertiary care hospital: first report of bla(SHV-12), bla(SHV-31), bla(SHV-38), and bla(CTX-M-15) in Brazil. Microb. Drug Resist., 17:7–16.

39.

Tzouvelekis

L.S.

, Bonomo

R.A.

1999. SHV-type beta-lactamases. Curr. Pharm. Des., 5:847–864.

40.

W.L.

, Cheng

K.C.

, Chi

C.J.

, Chen

H.E.

, Chuang

Y.C.

, Wu

L.T.

2006. Characterisation and molecular epidemiology of extended-spectrum beta-lactamase-producing Enterobacter cloacae isolated from a district teaching hospital in Taiwan. Clin. Microbiol. Infect., 12:579–582.

41.

, Ji

, Chen

et al. 2007. Resistance of strains producing extended-spectrum beta-lactamases and genotype distribution in China. J. Infect., 54:53–57.

42.

Zhang

G.Q.

, Guan

Y.Y.

, Sheng

H.H.

et al. 2008. Multiplex PCR and oligonucleotide microarray for detection of single-nucleotide polymorphisms associated with Plasmodium falciparum drug resistance. J. Clin. Microbiol., 46:2167–2174.

43.

Zhao

W.H.

, Hu

Z.Q.

2010. Beta-lactamases identified in clinical isolates of Pseudomonas aeruginosa. Crit. Rev. Microbiol., 36:245–258.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.29 MB

0.03 MB

Investigation of Genetic Diversity of the bla SHV Gene and Development of an Oligonucleotide Microarray to Detect Mutations in the bla SHV Gene

Abstract

Introduction

Materials and Methods

Bacterial strains and DNA extraction

Primer design

Detection of the blaSHV gene

Amplification of the full-length blaSHV gene

Labeling and fragmentation

SHV oligonucleotide microarray

Hybridization

Data analysis

Sequencing

Results

Prevalence of the blaSHV gene in clinical isolates from Shanghai hospitals

SHV oligonucleotide microarray

Allelic distribution of the blaSHV gene in Shanghai

SHV-type ESBLs

Coexistence of multiple blaSHV alleles within individual isolates

Discussion

Footnotes

Acknowledgments

Disclosure Statement

References

Supplementary Material

Detection of the bla_SHV gene

Amplification of the full-length bla_SHV gene

Prevalence of the bla_SHV gene in clinical isolates from Shanghai hospitals

Allelic distribution of the bla_SHV gene in Shanghai

Coexistence of multiple bla_SHV alleles within individual isolates