OXA-48 Carbapenemase-Producing Klebsiella pneumoniae Isolated from Libyan Patients

Abstract

Six multidrug-resistant Klebsiella pneumoniae isolates were recovered from injured Libyan combatants. Production of carbapenemase was screened by using commercial combination tablets from Rosco combined with a temocillin disk. Polymerase chain reaction (PCR) and sequencing were used to detect several carbapenemase genes and to characterize their genetic environment. Genetic support was studied by mating-out assays. Plasmid size was identified by the KADO method. PCR and sequencing allowed characterization of plasmid scaffold. Genotyping was performed by pulse-field gel electrophoresis (PFGE) and multilocus sequence typing. PCR was used to check for the presence of nine genes linked to virulence in K. pneumoniae. No carbapenemase was identified by Rosco disks, but all isolates showed high-level temocillin resistance. All of them harbored bla_OXA-48 in the transposon Tn1999.2, on a self-conjugative plasmid of about 60 kb, similar to pOXA-48. PFGE revealed three clusters in which isolates were genetically related: The first comprised FM9 and FM10, and the second comprised FM1, FM4, and FM5. FM2 formed a third distinct clone. Sequence types ST101, ST11, and ST147 were identified in keeping with PFGE results. The entB, ycfM, ybtS, and mrkD genes were detected in all isolates, and kfu gene was present in the three ST101 strains. This work confirms the current and successful spread of bla_OXA-48 by horizontal dissemination of a single IncL/M plasmid through different genetic backbones with strong epidemic potential. It also highlights the need for rapid and reliable phenotypic detection methods. Attempts to link virulence factors and the production of this carbapenemase deserve further studies.

Introduction

Increasing resistance to carbapenems among Enterobacteriaceae represents a real threat worldwide.¹⁴ It is mediated by two main mechanisms: decreased outer-membrane permeability associated with extended spectrum β-lactamase (ESBL) or derepressed AmpC production, and acquisition of carbapenemase genes. The most prevalent carbapenemases are metallo-β-lactamases such as VIM and NDM, Ambler class A β-lactamases such as KPC, and the class D carbapenem-hydrolyzing β-lactamase OXA-48.¹⁷ Since its first description in 2003 in a Klebsiella pneumoniae isolate from Turkey,¹⁷ OXA-48 has been reported in several European countries as well as in North Africa (Morocco, Tunisia, and Egypt) and Senegal.³⁴ OXA-48 hydrolyzes penicillins, and, to a lesser extent, imipenem, sparing extended-spectrum cephalosporins.³³ Thus, its detection is difficult when it is the only resistance mechanism present.²⁷ The aim of this work was to describe six K. pneumonia strains from Libya, producing OXA-48 carbapenemase, to analyze their genetic relationships, and to screen for the presence of genes associated with virulence. They include ycfM and mrkD for the capsular serotype, ycfM and mrkD for fimbrial and non-fimbrial adhesins, and entB, ybtS, kfu, and iroN for iron-scavenging systems. Two of them have been linked to hypermucoviscosity phenotypes, namely magA (mucoviscosity-associated gene, restricted to the gene cluster of serotype K1) and the regulator of mucoid phenotype A, rmpA. In addition, the allS gene has been associated with highly virulent K. pneumoniae isolates.¹¹

Materials and Methods

Sample collection

We studied six multidrug-resistant (MDR) K. pneumoniae isolates (FM1, 2, 4, 5, 9, 10) recovered over a 5 month period (July–November 2011), from combatants injured during Libyan civil war. They were first admitted to Libyan hospitals before being transferred to a Tunisian hospital during the Libyan conflict of summer 2011. All the patients were considered potential carriers of MDR bacteria because of their foreign origin and were, therefore, placed in contact isolation (Table 1). The patients were hospitalized in different wards. The strains were isolated from clinical samples recovered on the day of admission (Table 1). Thus, Libyan origin was attributed to the six MDR isolates. However, we cannot exclude a Tunisian origin, as OXA-48 dissemination has been described since 2010 in this region.¹³ They were addressed to our laboratory for characterization of antimicrobial resistance mechanisms.

Table 1.

Clinical and Genetic Features of the Six Klebsiella pneumoniae Isolates Producing OXA-48 Carbapenemase

	Geographic	Reason for	Hospital ward				β-Lactamase		Plasmid with bla_OXA-48 in Tn1999.2		Virulence
Isolate	origin	hospitalization	in Tunisia	Source	Treatment	Outcome	content	ST	Size (kb)	Replicon type	genes identified
FM1	Musrata	Multiple trauma	ICU	CSF	Imipenem, amikacin, tigecyclin	Cured	bla _TEM-1 bla _SHV-1 bla _CTX-M-15	101	L/M	60	kfu ybtS, entB, ycfM mrkD
FM2	Musrata	Thoracic wound	SURGERY	Pleural fluid	Ofloxacin, gentamicin	Cured	bla _SHV-11 bla _OXA-1 bla _CTX-M-15	11	L/M	60	ybtS entB, ycfM mrkD
FM4	Bengazhi	Extensive thermal burns Sepsis	ICU	KT	Imipenem	Dead	bla _TEM-1 bla _SHV-1 bla _CTX-M-14	101	L/M	60	kfu entB, ycfM mrkD
FM5	Tripoli	Nephrectomy	SURGERY	Urine	Unknown	Dead	bla _TEM-1 bla _SHV-1 bla _CTX-M-15	101	L/M	60	kfu entB, ycfM mrkD
FM9	Tripoli	Sepsis	ICU	KT	Tigecyclin, gentamicin	Dead	bla _TEM-1 bla _SHV-11 bla _OXA-1 bla _CTX-M-15	147	L/M	60	ybtS entB, ycfM mrkD
FM10	Unknown	Multiple trauma	ICU	Endotracheal	Imipenem,	Dead	bla _SHV-11 bla _OXA-1 bla _CTX-M-15	147	L/M	60	ybtS entB, ycfM mrkD

CSF, cerebrospinal fluid; KT, catheter; ICU, intensive care unit; ST, sequence type.

Antibiotic susceptibility and resistance mechanisms

Antibiotic susceptibility was determined by the disk diffusion method according to the Clinical and Laboratory Standards Institute guidelines.¹² Minimal inhibitory concentrations (MICs) were determined by using Etest strips (Biomérieux) (Tables 2 and 4). EUCAST breakpoints V2.0 (http://eucast.org) were used to determine strain susceptibility to colistin. To identify resistance mechanism(s), we used commercially available diagnostics tablets from Rosco, containing meropenem alone and meropenem supplemented with carbapenemase inhibitors, that is, dipicolinic acid for metallo-β-lactamase, and boronic acid for K. pneumoniae carbapenemase (Rosco). Each isolate was also tested with a disk containing 30 μg of temocillin (Becton, Dickinson and Company) to detect OXA-48 producers. A panel of control strains^6,7 was also tested against temocillin. It included strains from personal collection harboring metallo-enzymes such as VIM or NDM-1, an Ambler class A carbapenemase KPC, and carbapenem-resistant strains by the combination of porin loss with extended spectrum beta-lactamase or with plasmidic cephalosporinase (Table 4).

Table 2.

Minimal Inhibitory Concentrations (μg/ml) of β-Lactams for the Six Isolates of Enterobacteriaceae and Their Transconjugants (Tc)

β-Lactams	FM1	Tc FM1	FM2	Tc FM2	E. coli J53 rifamR	FM4	Tc FM4	FM5	Tc FM5	FM9	Tc FM9	FM10	TcFM10	E. coli J53 azide R
Piperacillin	256	64	>256	96	0.38	>256	64	>256	>256	>256	>256	>256	>256	0.75
Piperacillin + tazobactam	256	48	>256	32	0.38	>256	48	>256	96	>256	256	>256	128	0.75
Cefotaxime	256	0.5	>256	0.19	<0.016	>256	0.5	>256	0.5	>256	0.5	>256	0.38	0.032
Ceftazidime	128	0.25	48	0.19	0.047	6	0.125	64	0.125	128	0.125	>256	0.125	0.094
Cefepime	256	0.125	64	0.094	<0.016	64	0.125	>256	0.125	>256	0.125	>256	0.125	0.023
Imipenem	8	0.5	0.5	0.75	0.064	4	3	1.5	1.5	8	3	4	2	0.125
Ertapenem	32	1	4	0.5	0.002	>32	0.5	>32	2	>32	1.5	>32	1.5	0.006
Meropenem	12	0.25	0.5	0.125	0.006	8	0.19	8	0.38	12	0.25	24	0.38	0.008
Doripenem	6	0.25	0.38	0.75	0.006	6	0.25	4	0.25	6	1	6	0.25	0.012
Colistine	5		0.023			0.032		0.064		0.023		0.023

Tc FM4, Tc FM5, Tc FM9, and Tc FM10 were obtained by conjugation experiments using Escherichia coli J53 azide R as an acceptor strain, while E. coli J53 rifam R was used for TcFM1 and TcFM2.

β-lactamase content

Multiplex PCR and sequencing were used to detect several carbapenemase genes (bla_KPC, bla_VIM, bla_NDM, and bla_OXA-48), as well as other β-lactamase genes such as bla_CTX-M, bla_SHV, bla_TEM, and bla_OXA-14¹⁵. The whole bla_OXA-48 gene was sequenced with specific primers as previously described.³²

Conjugation experiments and plasmid scaffold

Genetic support was studied by mating-out assays. Clinical strains were used as donors, and rifampicin-resistant Escherichia coli J53 or sodium azide-resistant E. coli J53 (when clinical isolates were resistant to rifampicin) was used as a recipient. Transconjugants were selected on agar containing azide (100 μg/ml) or rifampicin (25 μg/ml) plus ticarcillin/clavulanic acid (50 and 3.3 μg/ml). Temocillin disks (30 μg) were added on the selective agar medium obtained for screening transconjugants. Colonies were sampled in the temocillin inhibition zone. Transconjugants' resistance profiles were tested by disk diffusion method, PCR, and sequencing. Plasmid DNA was extracted from the transconjugants carrying bla_OXA-48 by using the Kado-Liu method²³ and was analyzed by agarose gel electrophoresis. The size of the plasmid was appreciated by a comparison with a reference plasmid of known size: RP4 (TEM-2, 54 kb), pCFF04 (TEM-3, 85 kb), and pIP173 (SHV-1, 126.8 kb). PCR assays for the repA, traU, and parA genes were performed on the six transconjugants to determine the genetic backbone of the plasmids.³¹ Incompatibility group was determined for each plasmid on the transconjugants by the technique already discribed.^9,31 Mapping of the bla_OXA-48 flanking regions and sequencing of the amplicons were used to determine the genetic environment of bla_OXA-48 in the six isolates.¹⁰

Genetic relationship

The genetic relationship of the 6 isolates was studied by pulse-field gel electrophoresis (PFGE) and multilocus sequence typing, which was performed according to the protocol of Diancourt et al.¹⁶ The results were compared with the international database http://pasteur.fr/recherche/genopole/PF8/mlst/primers_Kpneumoniae.html.

Virulence factors

PCR was used to check for the presence of nine genes that had previously been linked to virulence in K. pneumoniae. The target genes, primers, and PCR conditions are given in Table 3.

Table 3.

Target Genes, Primers, and Specific Annealing Temperatures Used for Polymerase Chain Reaction Detection of Virulence Genes

Virulence genes	Type	Primers	Primer sequences (5′-3′)	Length	Accession number	Annealing temperature (°C)	References
ycfM	Adhesin	ycfM-FycfM-R	CGATTGAGCATCAGGATCAGGTTGGTGCGGTTGTTCAC	161	CP000647.1	55	This study
mrkD	Adhesin type 3 fimbriae	mrkD-1mrkD-2	TAT(T/C)G(G/T)CTTAATGGCGCTGGTAATCGTACGTCAGGTTAAAGA(C/T)C	920	M24536	50	Brisse et al. (2009)⁸
entB	Siderophore	entB-FentB-R	CGCCCAGCCGAAAGAGCAGACATCGGCACCGAATCCAGAC	508	CP000647.1	58	This study
ybtS	Siderophore yersiniabactin	ybtS-FybtS-R	CAAAAATGGGCGGTGGATTCCCTGACGGAACATAAACGAGCG	484	AB298504	59	Bachman et al.²
kfu	Iron transport	kfu-Fkfu-R	ATAGTAGGCGAGCACCGAGAAGAACCTTCCTCGCTGAACA	520	AB115591.2	59	Yu et al.⁴⁰
IroN	Iron system capture	iroN-FiroN-R	GCATAGGCGGATACGAACATCACAGGGCAATTGCTTACCT	556	AY378100.1	59	Yu et al.⁴⁰
magA	Capsular serotype K1 and hypermucoviscosity phenotype	magA-FmagA-R	GGTGCTCTTTACATCATTGCGCAATGGCCATTTGCGTTAG	1,280	AB085741	50	Fang et al. (2004)¹⁸
allS	Allantoin metabolism	1416R336F2	CCGTTAGGCAATCCAGACTCTGATTTA(A/T)CCCACATT	1,090	AB115590	49	Chou et al.¹¹
rmpA	Regulator of mucoid phenotype A	rmpA-FrmpA-R	ACTGGGCTACCTCTGCTTCACTTGCATGAGCCATCTTTCA	535	NC_005249	46	Brisse et al. 2009

PCR conditions 5 min at 94°C, 35 cycles of: 94°C for 30 s, annealing temperature 30 s, 72°C for 1 min, and then, final elongation for 5 min at 72°C.

Results

The six isolates were resistant to all penicillins and to extended-spectrum cephalosporins. They exhibited heterogeneous susceptibility to carabapenems, with MICs ranging from 0.5 to 8 mg/L for imipenem, 0.5–24 μg/ml for meropenem, and 0.38–6 μg/ml for doripenem (Table 2). Ertapenem MICs were higher than 32 μg/ml. All six strains were resistant to fluoroquinolones, trimethoprim-sulfamethoxazole, kanamycin, tobramycin, and gentamicin but remained susceptible to amikacin, except for isolate FM4, which exhibited resistance to all aminoglycosides tested. All 6 isolates were susceptible to colistin according to EUCAST breakpoints V 2.1 (http://eucast.org) (Table 2).

Use of combined meropenem Rosco disks with carbapenemase inhibitors (Rosco) gave negative results for class A and B carbapenemase and derepressed AmpC cephalosporinase production. All isolates displayed very high temocillin resistance, with the absence of inhibition diameter, defined as “contact resistance” (inhibition diameter of 6 mm) (Fig. 1). Results for the phenotypic detection of metallo-enzymes, KPC β-lactamase, and plasmidic cephalosporinase with ROSCO discs were in accordance with the β-lactamase content for control strains. Among them, all but two displayed a temocillin inhibition zone, with diameters varying from18 to 12 mm. For the two control isolates producing VIM-4 and NDM-1, no inhibition zone could be observed with the temocillin disc. Results for temocillin susceptibility testing are summarized in Table 4.

FIG. 1.

Representative results obtained with strain FM9 for OXA-48 detection, by using the same plate commercial Rosco tablets and a temocillin disk. Detection of class A or B carbapenemase was negative, as no diameter difference could be observed between Rosco tablets. However, temocillin contact resistance without any metallo-enzyme suggested OXA-48 production. Imipenem Etest combined with EDTA was used to check the absence of class B carbapenemase. MRP, meropenem; MR + BO, meropenem + boronic acid for detection of KPC carbapenemase; MR + DP, meropenem + dipicolinic acid for detection of metallo-enzyme; MR + CL, meropenem + cloxacillin for detection of cephalosporinase; temo, temocillin; IP, imipenem; IPI, imipenem + ethylenediaminetetraacetic acid (EDTA).

Table 4.

Results of Temocillin Suceptibility Testing for the Clinical Strains, Control Panel Strains, Transconjugants, and Acceptor Strains

Strains	Resistance mechanism	Temocillin MICs (mg/L)	Temocillin inhibition diameter (mm)	Suceptibility categorization according to Fuchs breakpoints ¹⁹	Suceptibility BSAC UTI breakpoint ¹	Suceptibility BSAC systemic breakpoint ¹
FM1	OXA-48, TEM-1, SHV-1, CTX-M-15	>1,024	6	R	R	R
FM2	OXA-48, SHV-11, OXA-1, CTX-M-15	>1,024	6	R	R	R
FM4	OXA-48, TEM-1, SHV-1, CTX-M-14	>1,024	6	R	R	R
FM5	OXA-48, TEM-1, SHV-1, CTX-M-15	>1,024	6	R	R	R
FM9	OXA-48, TEM-1, SHV-11, OXA-1, CTX-M-15	>1,024	6	R	R	R
FM10	OXA-48, SHV-11, OXA-1, CTX-M-15	>1,024	6	R	R	R
Transconjugants
TcFM1	OXA-48	>1,024	6	R	R	R
TcFM2	OXA-48	>1,024	6	R	R	R
TcFM4	OXA-48	>1,024	6	R	R	R
TcFM5	OXA-48	>1,024	6	R	R	R
TcFM9	OXA-48	>1,024	6	R	R	R
TcFM10	OXA-48	>1,024	6	R	R	R
Acceptor strains
E. coli J53 azide R	None	6	21	S	S	S
E. coli J53 rifampicin R	None	6	21	S	S	S
K. pneumoniae control strains
K pneumoniae n°1⁶	CMY-4, SHV-5, TEM-1, porin loss	32	15	I	S	R
K. pneumoniae n°13⁶	ACC-1, TEM-1, porin loss	16	18	I	S	R
K. pneumoniae n°10⁶	VIM-4, SHV-5	>1,024	6	R	R	R
K. pneumoniae n°6⁶	KPC-2, TEM-1	96	12	R	S	R
E. coli n°2⁷	NDM-1, TEM-1, CTX-M-15	128	6	R	R	R

MIC, minimal inhibitory concentrations; BSAC, British Society for Antimicrobial Chemotherapy; UTI, urinary tract infection.

Multiplex PCR assays and sequencing identified OXA-48 carbapenemase in all six isolates. Five strains were also all CTX-M-15 producers, while isolate FM4 harbored a bla_CTX-M-14 gene (Table 2).

Six transconjugants were obtained by mating out assays. They displayed the resistance profile expected for OXA-48 producer. Temocillin contact resistance was observed for each of them. No other resistance gene was co-transferred as shown by PCR. Temocillin MICs ranged between 128 and more than 1,024 mg/L for all OXA-48 producers (clinical strains and transconjugants) as well as for metallo-enzyme producers too, while lower levels were observed for other kind of mechanisms and for recipient strains.

All transconjugants harbored a plasmid of about 60 kb. Results of PCR assays for the repA, traU, and parA genes confirmed that each plasmid was very closely related to pOXA-48.³¹ Mapping of the bla_OXA-48 flanking regions and sequencing of the amplicons revealed that bla_OXA-48 was located in Tn1999.2 in all six isolates.¹⁰

Genetic relationship of the six isolates was analyzed by PFGE, which revealed three clusters: The first comprised FM9 and FM10, and the second comprised FM1, FM4, and FM5. FM2 formed a third distinct clone. Three sequence types (ST) were identified, and the results were in keeping with those of PFGE: Both FM9 and FM10 belonged to ST147 as expected; while FM1, FM4, and FM5 belonged to ST101, and FM2 belonged to ST11.

With regard to virulence factors, the entB, ycfM, ybtS, and mrkD genes were detected in all isolates; while magA, rmpA, allS, and iroN were not. The kfu gene, documented to be associated with invasive infections (e.g., liver abcess), was present in the three ST101 strains.⁴⁰ None of our strains belonged to capsular serotypes K1, K2, K5, K54, or K57.³⁸

Discussion

This work is the third manuscript about OXA-48-producing K. pneumoniae isolates recovered in Libya.^22,29 Our results support bla_OXA-48 spread by horizontal dissemination of a well-known IncL/M plasmid through different genetic backbones. The three STs identified here have already been associated with OXA-48 producers: ST101 was described in Tunisia²⁴ and during a noscomial outbreak in Spain,³⁰ ST147 was identified among Belgian isolates,¹⁴ and bla_OXA-48 was recently associated to ST11 in a K. pneumoniae strain.³⁹

These results are not surprising, as ST101, ST11, and ST147 are known to have strong epidemic potential and have been associated with various carbapenemases: for example, NDM-1 with ST147 in Canada²³ and ST101 in India,¹⁹ ST11 with KPC-2 in South America,^28,21 Asia,^4,34 and Europe^5,36,37 (Norway, Sweden, Spain, and Hungary reference), and ST11 and ST147 with CTX-M-15 in Europe.¹¹

All strains possessed virulence genes known to be frequent in this bacterial species such as fimbrial and non-fimbrial adhesins (ycfM, mrkD) and the iron-scavenging system entB. In contrast, all of them produced yersiniabactin, a siderophore encoded by the Yersinia high-pathogenicity island that is less frequent in K. pneumoniae. Interestingly, ybtS is also prevalent among KPC-producing K. pneumoniae isolates of ST258.² Further studies are needed to establish a link between ybtS and the spread of OXA-48 among K. pneumoniae isolates.

Temocillin, a methoxy derivative of ticarcillin, appeared in the market in 1988 in Belgium. It never met the expected success at that time, because of its exclusive gram-negative spectrum. With the worldwide ESBL spread and the emerging carbapenemases, its potential utility has been reconsidered in the aim of sparing carbapenems. This gave rise to multiple studies about its efficiency in the treatment of infections involving MDR strains.^3,25,20,35 Temocillin is strongly hydrolyzed not only by OXA-48, but also by metallo-enzymes, with corresponding MICs ranging between 128 and 256 mg/L.²⁶ Impermeability associated to ESBL or AmpC production can also lead to increasing MICs but did not reach values mentioned earlier for the moment. However, this property makes this molecule a potential phenotypic detector of OXA-48 producers, especially in the most difficult situation, that is, when being the only resistance mechanism present in a strain.

Regardless of the breakpoints used^1,19 and the strain's susceptibility categorization, the absence of inhibition zone remains correlated to very high MICs and, however, to the presence of these two types of carbapenemases.²⁶ Use of Rosco disks (combining meropenem and carbapenemase inhibitors) with a temocillin disk on the same plate allows discrimination between the possible mechanisms involved in the temocillin resistance. Although this phenotypic one-step/two-tests method obviously deserves complementary studies on a larger sample of strains, the very first results are encouraging, allowing OXA-48 detection, whether expressed alone or together with other resistance mechanisms. Indeed, OXA-48 and metallo-enzymes producers will be categorized resistant when tested against temocillin but are easy to differentiate with the commercial combination tablets from Rosco.²⁶ The simplicity of this technique makes it affordable in any laboratory where molecular biology is not available.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Andrews

J.M.

, Jevons

, Walker

, Ashby

, Fraise

A.P.

2007. Temocillin susceptibility by BSAC methodology. J. Antimicrob. Chemother., 60:185–187.

Bachman

M.A.

, Oyler

J.E.

, Burns

S.H.

, Caza

, Lépine

, Dozois

C.M.

, Weiser

J.N.

2011. Klebsiella pneumoniae yersiniabactin promotes respiratory tract infection through evasion of lipocalin 2. Infect. Immun., 79:3309–3316.

Balakrishnan

, Awad-El-Kariem

F.M.

, Aali

, Kumari

, Mulla

, Tan

, Brudney

, Ladenheim

, Ghazy

, Khan

et al. 2011. Temocillin use in England: clinical and microbiological efficacies in infections caused by extended-spectrum and/or derepressed AmpC beta-lactamase-producing Enterobacteriaceae. J. Antimicrob. Chemother., 66:2628–2631.

Balm

M.N.

, Ngan

, Jureen

, Lin

R.T.

, Teo

2012. Molecular characterization of newly emerged blaKPC-2-producing Klebsiella pneumoniae in Singapore. J. Clin. Microbiol., 50:475–476.

Baraniak

, Grabowska

, Izdebski

, Fiett

, Herda

, Bojarska

, Zabicka

, Kania-Pudlo

, Mlynarczyk

, Zak-Pulawska

et al. 2011. Molecular characteristics of KPC-producing Enterobacteriaceae at the early stage of their dissemination in Poland, 2008–2009. Antimicrob. Agents Chemother., 55:5493–5499.

Birgy

, Bidet

, Genel

, Doit

, Decre

, Arlet

, Bingen

2012. Phenotypic screening of carbapenemases and associated beta-lactamases in carbapenem-resistant Enterobacteriaceae. J. Clin. Microbiol., 50:1295–1302.

Birgy

, Doit

, Mariani-Kurkdjian

, Genel

, Faye

, Arlet

, Bingen

2011. Early detection of colonization by VIM-1-producing Klebsiella pneumoniae and NDM-1-producing Escherichia coli in two children returning to France. J. Clin. Microbiol., 49:3085–3087.

Brisse

, Fevre

, Passet

, Issenhuth-Jeanjean

, Tournebize

, Diancourt

, Grimont

. 2009. Virulent clones of Klebsiella pneumoniae: identification and evolutionary scenario based on genomic and phenotypic characterization. PLoS One, 4:e4982.

Carattoli

, Bertini

, Villa

, Falbo

, Hopkins

K.L.

, Threlfall

E.J.

2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods, 63:219–228.

10.

Carrër

, Poirel

, Eraksoy

, Cagatay

A.A.

, Badur

, Nordmann

2008. Spread of OXA-48-positive carbapenem-resistant Klebsiella pneumoniae isolates in Istanbul, Turkey. Antimicrob. Agents Chemother., 52:2950–2954.

11.

Chou

H.C.

, Lee

C.Z.

, Ma

L.M.

, Fang

C.T.

, Chang

S.-C.

, Wang

J.T.

2004. Isolation of a chromosomal region of Klebsiella pneumoniae associated with allantoin metabolism and liver infection. Infect. Immun., 72:3783–3792.

12.

Clinical, Laboratory Standards Institute. 2011. Performance Standards for Antimicrobial Susceptibility Testing. CLSI: Wayne, PA.

13.

Cuzon

, Naas

, Lesenne

, Benhamou

, Nordmann

2010. Plasmid-mediated carbapenem-hydrolysing OXA-48 beta-lactamase in Klebsiella pneumoniae from Tunisia. Int. J. Antimicrob. Agents, 36:91–93.

14.

Cuzon

, Ouanich

, Gondret

, Naas

, Nordmann

2011. Outbreak of OXA-48-positive carbapenem-resistant Klebsiella pneumoniae isolates in France. Antimicrob. Agents Chemother., 55:2420–2423.

15.

Dallenne

, Da Costa

, Decre

, Favier

, Arlet

2010. Development of a set of multiplex PCR assays for the detection of genes encoding important b-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother., 65:490–495.

16.

Diancourt

, Passet

, Verhoef

J.J.

, Grimont

P.A.

, Brisse

2005. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J. Clin. Microbiol., 43:4178–4182.

17.

European Center for Disease Prevention, Control, Antimicrobial Resistance, Healthcare-Associated Infections Programme. 2010. Antimicrobial resistance 2010: global attention on carbapenemase-producing bacteria. Eurosurveillance, 15.

18.

Fang

, Chuang

, Shun

, Chang

, Wang

. 2004. A novel virulence gene in Klebsiella pneumoniae strains causing primary liver abscess and septic metastatic complications. J. Exp. Med., 199:697–705.

19.

Fuchs

P.C.

, Barry

A.L.

, Thornsberry

, Jones

R.N.

1985. Interpretive criteria for temocillin disk diffusion susceptibility testing. Eur. J. Clin. Microbiol., 4:30–33.

20.

Glupczynski

, Huang

T.D.

, Berhin

, Claeys

, Delmee

, Ide

, Ieven

, Pierard

, Rodriguez-Villalobos

, Struelens

et al. 2007. In vitro activity of temocillin against prevalent extended-spectrum beta-lactamases producing Enterobacteriaceae from Belgian intensive care units. Eur. J. Clin. Microbiol. Infect. Dis., 26:777–783.

21.

Gomez

S.A.

, Pasteran

F.G.

, Faccone

, Tijet

, Rapoport

, Lucero

, Lastovetska

, Albornoz

, Galas

, Melano

R.G.

et al. 2011. Clonal dissemination of Klebsiella pneumoniae ST258 harbouring KPC-2 in Argentina. Clin. Microbiol. Infect., 17:1520–1524.

22.

Hammerum

A.M.

, Larsen

A.R.

, Hansen

, Justesen

U.S.

, Friis-Moller

, Lemming

L.E.

, Fuursted

, Littauer

, Schonning

, Gahrn-Hansen

et al. 2012. Patients transferred from Libya to Denmark carried OXA-48-producing Klebsiella pneumoniae, NDM-1-producing Acinetobacter baumannii and meticillin-resistant Staphylococcus aureus. Int. J. Antimicrob. Agents., 26:26.

23.

Kado

C.I.

, Liu

S.T.

1981. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol., 145:1365–1373.

24.

Lahlaoui

, Poirel

, Barguellil

, Moussa

M.B.

, Nordmann

2011. Carbapenem-hydrolyzing class D beta-lactamase OXA-48 in Klebsiella pneumoniae isolates from Tunisia. Eur. J. Clin. Microbiol. Infect. Dis., 31:937–939.

25.

Livermore

D.M.

, Tulkens

P.M.

2009. Temocillin revived. J. Antimicrob. Chemother., 63:243–245.

26.

Livermore

D.M.

, Warner

, Mushtaq

, Doumith

, Zhang

, Woodford

2011. What remains against carbapenem-resistant Enterobacteriaceae? Evaluation of chloramphenicol, ciprofloxacin, colistin, fosfomycin, minocycline, nitrofurantoin,temocillin and tigecycline. Int. J. Antimicrob. Agents, 37:415–419.

27.

Nordmann

, Gniadkowski

, Giske

C.G.

, Poirel

, Woodford

, Miriagou

European Netowork on Carbapenemases. 2012. Identification and screening of carbapenemase-producing Enterobacteriaceae. Clin. Microbiol. Infect., 18:432–438.

28.

Pereira

P.S.

, de Araujo

C.F.

, Seki

L.M.

, Zahner

, Carvalho-Assef

A.P.

, Asensi

M.D.

2013. Update of the molecular epidemiology of KPC-2-producing Klebsiella pneumoniae in Brazil: spread of clonal complex 11 (ST11, ST437 and ST340) J. Antimicrob. Chemother., 68:312–316.

29.

Pirš

, Andlovic

, Cerar

, Žohar-Čretnik

, Kobola

, Kolman

, Frelih

, Prešern-Štrukelj

, Ružić-Sabljić

, Seme

2011. A case of OXA-48 carbapenemase-producing Klebsiella pneumoniae in a patient transferred to Slovenia from Libya, November 2011. Eurosurveillance, 16.

30.

Pitart

, Sole

, Roca

, Fabrega

, Vila

, Marco

2011. First outbreak of a plasmid-mediated carbapenem-hydrolyzing OXA-48 beta-lactamase in Klebsiella pneumoniae in Spain. Antimicrob. Agents Chemother., 55:4398–4401.

31.

Poirel

, Bonnin

, Nordmann

2012. Genetic features of the widespread plasmid coding for the carbapenemase OXA-48. Antimicrob. Agents Chemother., 56:559–562.

32.

Poirel

, Héritier

, Tolün

, Nordmann

2004. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob. Agents Chemother., 48:15–22.

33.

Poirel

, Potron

, Nordmann

2012. OXA-48-like carbapenemases: the phantom menace. J. Antimicrob. Chemother., 67:1597–1606.

34.

, Wei

, Ji

, Du

, Shen

, Yu

2011. ST11, the dominant clone of KPC-producing Klebsiella pneumoniae in China. J. Antimicrob. Chemother., 66:307–312.

35.

Rodriguez-Villalobos

, Malaviolle

, Frankard

, de Mendonca

, Nonhoff

, Struelens

M.J.

2006. In vitro activity of temocillin against extended spectrum beta-lactamase-producing Escherichia coli. J. Antimicrob. Chemother., 57:771–774.

36.

Samuelsen

, Toleman

M.A.

, Hasseltvedt

, Fuursted

, Leegaard

T.M.

, Walsh

T.R.

, Sundsfjord

, Giske

C.G.

2011. Molecular characterization of VIM-producing Klebsiella pneumoniae from Scandinavia reveals genetic relatedness with international clonal complexes encoding transferable multidrug resistance. Clin. Microbiol. Infect., 17:1811–1816.

37.

Toth

, Damjanova

, Puskas

, Janvari

, Farkas

, Dobak

, Borocz

, Paszti

2010. Emergence of a colistin-resistant KPC-2-producing Klebsiella pneumoniae ST258 clone in Hungary. Eur. J. Clin. Microbiol. Infect. Dis., 29:765–769.

38.

Turton

J.F.

, Perry

, Elgohari

, Hampton

C.V.

2010. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J. Med. Microbiol., 59:541–547.

39.

Voulgari

, Zarkotou

, Ranellou

, Karageorgopoulos

D.E.

, Vrioni

, Mamali

, Themeli-Digalaki

, Tsakris

2013. Outbreak of OXA-48 carbapenemase-producing Klebsiella pneumoniae in Greece involving an ST11 clone. J. Antimicrob. Chemother., 68:84–88.

40.

W.L.

, Ko

W.C.

, Cheng

K.C.

, Lee

C.C.

, Lai

C.C.

, Chuang

Y.C.

2008. Comparison of prevalence of virulence factors for Klebsiella pneumoniae liver abscesses between isolates with capsular K1/K2 and non-K1/K2 serotypes. Diagn. Microbiol. Infect. Dis., 62:1–6.