Abstract
In this study 114 extensively drug-resistant Acinetobacter baumannii clinical isolates were characterized. The strains were collected at L'Aquila Hospital after the earthquake in L'Aquila city (central Italy) on the 6th of April 2009. The genes blaOXA-23 and blaOXA-51 were detected in all clinical isolates analyzed, whereas blaTEM-1 allele was detected in 56/114 isolates. The blaOXA-23 gene is located downstream the ISAba region and is under control of a strong promoter. On 42/80 A. baumannii the presence of two class 1 integrons was ascertained on chromosomal DNA. Variable regions show different gene array: (1) aadB and aadA2, (2) aacA4, aac(6′)-Ib-cr, and aadA1. Macrorestriction analysis using ApaI restriction endonuclease identifies three clusters (A, B, and C) according to pulsed-field gel electrophoresis profiles. All isolates analyzed belong to the clone A. baumannii sequence type 2.
Introduction
A
Most A. baumannii isolates developed antibiotic resistance versus a large panel of antibiotics making these bacteria difficult to treat. Over the past decades, a dramatical increase in resistance to carbapenems has also been observed.
Carbapenem resistance in A. baumannii is mainly caused by the production of carbapenemases as OXA-β-lactamases and metallo-β-lactamases (MBLs), molecular class D and B respectively. The OXA-type carbapenemases family includes four kinds of alleles: blaOXA-23-like, blaOXA-24-like, blaOXA-58-like, and blaOXA-51-like. Generally, blaOXA-51-like determinants are intrinsically produced by A. baumannii strains. Transposons Tn2006, Tn2007, and Tn2008 were identified as the common genetic structures harboring blaOXA-23 determinants. 12
In A. baumannii the expression of blaOXA-type genes is enhanced by the presence of a promoter located in IS region like ISAba1. 6 Generally, ISs are able to mobilize the genes among different bacterial species leading to a rapid spread of antibiotic resistance determinants.
In addition, in the last two decades the increased number of MBLs in A. baumannii contributes to the global emergence of resistance to β-lactams. Four MBL groups have been identified in A. baumannii, including IMP-, VIM-, NDM-, and SIM-types.7,13,18,21 In this study the authors analyzed 114 multidrug-resistant A. baumannii collected from elderly inpatients in an Italian hospital (L'Aquila, central Italy) after the earthquake in L'Aquila city (central Italy) on the 6th of April 2009.
Methods
Clinical strains
One hundred fourteen A. baumannii clinical isolates (one isolate for each patient) were consecutively collected from inpatients (Intensive Care Unit, Infectious Diseases, Neurosurgery and Rehabilitation Medicine) at the teaching Hospital San Salvatore, L'Aquila (Abruzzo, Italy) during the period December 2009–June 2013. The patients were on average 78 years old. The isolates were collected from various biological specimens including urine, blood, pus, and bronchial aspirate.
All the isolates were identified by Phoenix automated microbiology system (Becton-Dickinson Diagnostic Systems) and API 20NE system (BioMérieux). Matrix-assisted laser desorption ionization time of flight (MALDI-TOF) mass spectrometry Biotyper 3.0 (Bruker Daltonik) was also used to identify A. baumannii clinical strains.
Susceptibility testing
The phenotypic profile was carried out by microdilution method using a bacterial inoculum of 5×105 CFU/ml according to Clinical and Laboratory Standards Institute (CLSI) performance standards. 1 β-lactam compounds were from Sigma Chemical Co. except for clavulanic acid and ceftazidime from GlaxoSmithKline, piperacillin, tazobactam, sulbactam, and tigecycline from Pfizer Italia, imipenem and cefoxitin from Merck Sharp & Dohme, meropenem from Astra Zeneca, levofloxacin from Sanofi Aventis, ciprofloxacin from Mast Diagnostics, and colistin from UCB Pharma. The tazobactam was used in combination with piperacillin at a fixed concentration of 4 mg/L. The combinations ticarcillin-clavulanic acid and ampicillin-sulbactam were used at a ratio of 2:1. Minimum inhibitory concentration (MIC) values were determined using Mueller Hinton broth supplemented with cations calcium and magnesium, 25 and 12.5 μg/ml respectively. Susceptibility results of antimicrobials were interpreted using CLSI criteria. For tigecycline no recommendations are available for A. baumannii, however, the Food and Drug Administration (FDA) has recommended a breakpoint of susceptibility similar to that of Enterobacteriaceae: MIC values ≤2 and ≥8 mg/L were interpreted as susceptible and resistant, respectively.
Molecular typing: multilocus sequence typing and pulsed-field gel electrophoresis
Multilocus sequence typing (MLST) is based on the sequence of housekeeping genes and was performed according to the protocol described in MLST Pasteur Web site (www.pasteur.fr).
A. baumannii clinical isolates were analyzed for genetic relatedness by pulsed-field gel electrophoresis (PFGE) after digestion of genomic DNA with ApaI restriction enzyme. Conditions used were described elsewere.5,17 The restriction fragments were separated on a CHEF Mapper XA apparatus (Bio-Rad) and cluster designations were based on Tenover criteria. 20
Molecular characterization of antimicrobial resistance mechanisms
Chromosomal DNA was extracted as previously described. 19 Chromosomal DNA-free large plasmid was extracted from all A. baumannii isolates using Large-Construct Kit (Qiagen s.r.l.). PCR screening was performed either on the chromosomal and plasmid DNA. Specific primers were used to identify blaVIM, blaIMP, blaNDM-1, blaTEM, blaSHV, blaOXA-23, blaOXA-48, blaOXA-51, and blaCTX-M determinants.16,17,22 To investigate the presence of integrons, chromosomal DNA and plasmids were analyzed by PCR using specific primers for intI1, intI2, and intI3 genes. 15 The variable region was analyzed by sequencing the amplicons obtained by PCR using primers 5′CS_for and 3′CS_rev. 15 The presence of ISAba region was undertaken with the primers ISABA_for (5′CATGTAAACCAATGCTCACC) and ISABA_rev (5′GTGCTTTGCGCTCATCATGC). The positive amplicons obtained by three different amplifications were sequenced on both strands by BigDye Sequencing Reaction Kit and an ABI 3500 eight capillary automated sequencer (LifeTechnologies). The results were compared and aligned with reference sequences using BLAST database and CLUSTAL W software. Identification and characterization of ISAba region were performed by PCR and sequencing. Southern-blot analysis was performed either on plasmid and chromosomal DNAs as previously reported. 19 Hybridization was carried out overnight at 65°C and detection was performed using dUTPfluoresceine-kit following instructions provided by the manufacturer (GE Healthcare). Positive and negative controls were included in all experimental assays.
Gene transfer assay
Conjugation experiments were carried out using Escherichia coli J-53 (pro met Rifr Nalr) as recipient and A. baumannii isolates as donors. Meropenem (2 mg/L) and rifampin (300 mg/L) were used to select the transconjugants. The detection sensitivity of the assay was ≥5×10−7 transconjugants per recipient. The plasmids were transferred into E. coli HB101 recipient cells by electroporation method using MicroPulser apparatus (Bio-Rad). The apparatus was programmed as follows: 1.8 kV, 1 pulse, 1 ms in 0.1 cm cuvettes. Transformants were selected on Luria Bertani medium (Sigma-Aldrich) agar plates supplemented with oxacillin (50 mg/L) and meropenem (2 mg/L).
Results
From December 2009 to June 2013, 114 A. baumannii clinical strains were collected from elderly inpatients with severe infections. As shown in Table 1, 100% of isolates were nonsusceptible to penicillin, ticarcillin-clavulanate combination, cefotaxime, cefepime, ceftriaxone, carbapenems, fluoroquinolones, and aminoglycosides; 67% of isolates are nonsusceptible to piperacillin-tazobactam combination and 79% of isolates are non-susceptible to ceftazidime. The strains were found to be susceptible to colistin and tigecycline. To determine the genomic diversity of A. baumannii, all clinical strains were analyzed by macrorestriction profile analysis and PFGE. Macrorestriction analysis using ApaI restriction endonuclease identifies three clusters (A, B, and C) according to PFGE profiles (Fig. 1). The cluster A including A1 and A2 contained 34 isolates; the cluster B (from B1 to B4) contained 46 isolates; and the cluster C contained 34 isolates. The three clusters showed similar antimicrobial susceptibility pattern. The MLST analysis was performed on 50 isolates representative of the three clonal lineages. All A. baumannii isolates belong to sequence type 2 (ST2).

Macrorestriction pattern of clinical Acinetobacter baumannii strains. Lane 1, molecular weight marker λ-Ladder; lanes 2–11, PFGE profile of clinical Klebsiella pneumoniae isolates; lane 12 molecular weight marker λ-HindIII. In the underlying part of the figure are shown the different profiles.
There is insufficient evidence that the species in question is a good target for therapy with the drug (EUCAST, European Committee on Antimicrobial Susceptibility Testing).
MIC, minimum inhibitory concentration.
Fifty-six out of 114 A. baumannii harbored a plasmid with an approximately size of 150 kb. Among them, 12 isolates belonged to cluster A, 34 isolates belonged to cluster B, and 10 isolates belonged to cluster C. The mobility of plasmids was ascertained by transferring the plasmid from A. baumannii strains to E. coli J53 by conjugation assay. The transfer by conjugation failed. However, the plasmids were inserted by electroporation in E. coli HB 101. All transformants were analyzed by DNA/DNA hybridization following Southern blot assay with specific probes for blaNDM, blaVIM, blaIMP, blaTEM, blaSHV, blaOXA, and blaCTX determinants and intI1 genes. The plasmids were found to be positive only to blaTEM-1 probe. Chromosomal DNA of A. baumannii isolates was analyzed by PCR with specific primers for β-lactamase determinants. All strains harbor two blaOXA determinants of 822 bp that were completely sequenced and both showed an open reading frame of 274 amino acid residues encoding for OXA-51 and OXA-23 enzymes. blaNDM, blaVIM, blaIMP, and blaCTX-M determinants were not identified by PCR either on plasmid and chromosomal DNA. The genetic environment of the blaOXA-23 gene was ascertained by PCR and DNA sequencing using specific primers for ISAba region. A fragment of about 1,600 bp has been identified by PCR and was entirely sequenced. The blaOXA-23 gene is located downstream the ISAba region and it is under the control of a strong promoter (Fig. 2). The presence of intI1 gene was ascertained on chromosomal DNA on 42/114 A. baumannii where the simultaneous presence of two class 1 integrons has been identified. One of them shows a variable region of about 1,500 bp where two gene cassettes are carried: aadB gene of 597 bp encoding an aminoglycoside adenyltransferase and aadA2 gene of 780 bp encoding an aminoglycoside adenyltransferase. The second integron shows a variable region of about 2,000 bp carrying three gene cassettes: aacA4 of 519 bp that encodes an aminoglycoside acetyl-transferase, aac(6′)-Ib-cr of 519 bp that encodes an aminoglycoside 6′-acetyl-transferase type I, and aadA1 of 792 bp that encodes an aminoglycoside 3′-adenylyl-transferase.

Mobile genetic element of blaOXA-23 gene. In the figure is shown the promoter region of ISAba1 where -35,-10, inverted repeat left (IRL) sequences, and start codon of blaOXA-23 gene have been underlined.
Discussion
There are several reports of multidrug-resistant A. baumannii from Italy.2,9–11 To date, in Italy, the main clonal lineage of A. baumannii belongs to ST2. Nevertheless, A. baumannii ST1, ST4, ST20, ST78, ST95, ST109, ST196, and ST197 have been detected.9,10 Three A. baumannii clones circulate in Europe (the so-called clones I, II, and III). In Italy outbreaks are attributable to European clone II. 11 Over the years, in Italy, a progressive increase of blaOXA-23-producing A. baumannii lineage II has been observed. 9 The strains collected from 2009 to 2014 were found to be resistant to all antibiotics tested with the exception of tigecycline and colistin. Nonetheless, twenty percent of the patients died after prolonged hospitalization. On the basis of their resistance profile the A. baumannii isolated in our hospital could be considered “extensively drug-resistant” strains. 8 The presence of blaOXA-23 and ISAba region was confirmed on all isolates analyzed, whereas TEM-1 enzyme was isolated in 56 A. baumannii. The blaOXA-23 is poised to quickly spread among clinically relevant bacteria. The genetic structure of blaOXA-23 has been described by Mugnier et al. 12 blaOXA-51 gene was found in all clinical isolates as constitutive gene. The carbapenem resistance in our strains is mainly due to the presence of carbapenemase (OXA-23 and OXA-51 enzymes). Other carbapenem resistance mechanisms, as porin loss and hyperexpression of efflux pumps, have not been investigated in this study. In A. baumannii isolates the simultaneous presence of two class I integrons has been observed. The array aadB-aadA2 has been described in A. baumannii and in Pseudomonas aeruginosa, Proteus mirabilis, Citrobacter Freundii, and E. coli (www.ncbi.nlm.nih.gov/). In particular, the array aacA4-aac(6′)-Ib-cr-aadA1 is uncommon in A. baumannii. This study was undertaken to evaluate the evolution of carbapenem resistance in A. baumannii clinical strains isolated from elderly inpatients in the L'Aquila Hospital. For instance, the strains were collected over a period of about 4 years (2009–2014) after earthquake measuring 6.3 on the Richter scale struck L'Aquila city and part of Abruzzo region (central Italy) on the 6th of April 2009. In our hospital, a change of mechanisms of resistance to carbapenems in A. baumannii has been observed in the last years. During the years 2006–2008 carbapenem-resistant A. baumannii clinical isolates were collected from the same hospital. In those strains no β-lactamases have been detected (data unpublished) and resistance to carbapenems might be ascribed to other mechanisms of resistance (data unpublished). As a consequence of the earthquake the number of elderly people with severe infections admitted to the hospital increased and the number of voluntary and persons involved in reconstruction increased. It is plausible that the appearance of A. baumannii harboring blaOXA-23 can be the direct consequence of the earthquake. Several studies indicate that A. baumannii may develop a broad range of mechanisms of resistance to all existing classes of antibiotics as a result of its aptitude to accumulate resistance mechanisms by acquisition of plasmids, transposons, and integrons harboring different antibiotic resistance genes.
Footnotes
Acknowledgments
The authors wish to thank Anna Toso (Toronto Catholic District School Board, Toronto, Canada) for the language revision of the article. The authors wish to thanks Dr. Patrizia Frascaria of Microbiology Laboratory of San Salvatore Hospital, L'Aquila for the A. baumannii clinical strains collection. This work was supported by a grant to M.P., G.C, and G.A. from MURST ex 60% (Ministero dell'Istruzione, dell'Università e della Ricerca).
Disclosure Statement
No competing financial interests exist.
