Distribution of Integrons and Gene Cassettes Among Uropathogenic and Diarrheagenic Escherichia coli Isolates in Iran

Abstract

Integrons are considered to play a significant role in the evolution and spread of antimicrobial resistance genes. A total of 200 uropathogenic (UPEC) and diarrheagenic Escherichia coli (DEC) isolates from outpatients were investigated for antimicrobial susceptibility and the presence of class 1, 2, and 3 integron-associated integrase (intI) genes and gene cassettes. Conjugal transfer and Southern hybridization were performed to determine the genetic localization of class 1 integrons. One hundred ninety-two (96%) isolates were resistant to one or more antimicrobial agents. Antimicrobial resistance among DEC isolates was higher compared with the UPEC. Integrons were highly prevalent in both pathotypes (92.5%). Comparison of integrons among UPEC and DEC showed that DEC isolates harbored integrases (94% for intI1, 8% for intI2) with a slightly higher frequency than in UPEC isolates (87% for intI1, 7% for intI2) (p>0.05). Dihydrofolate reductase (dfrA) and aminoglycoside adenyl transferase (aad) gene cassettes were found most frequently in intI1-positive isolates. All isolates carried their class 1 integrons on conjugative plasmids. These results indicate that class 1 integrons are widespread among E. coli isolates. Therefore, appropriate surveillance and control measures are essential to prevent the further spread of integron-producing isolates.

Introduction

Uropathogenic Escherichia coli (UPEC) is one of the primary etiological agents of urinary tract infections (UTIs), accounting for 75–90% cases.⁶ Also, Diarrheagenic Escherichia coli (DEC) is an emerging agent among pathogens that cause diarrheal diseases.²³ The emergence of antimicrobial-resistant E. coli has become a serious public health threat worldwide.²⁰ Horizontal gene transfer seems to be the main cause of the rapid spread of antibiotic resistance genes across a wide diversity of bacteria. Beyond the horizontal gene transfer, the loss and acquisition of functional modules are important in the process of rapid bacterial development of resistance.²⁴ Integrons have been identified as a primary source of resistance genes and play an important role in dissemination of antibiotic resistance within microbial populations. They are able to capture, integrate, and mobilize gene cassettes. Integrons lack the specific mobilization machinery, but they are associated with insertion sequences, transposons, and/or plasmids.^2,9 Most of the gene cassettes that have been identified within integrons of Enterobacteriaceae confer resistance to a range of antimicrobial agents. New resistance gene cassettes are continually being discovered and more than 130 different cassettes have been characterized within integrons, providing resistance to most classes of antimicrobial agents, including β-lactams, aminoglycosides, amphenicols, macrolides, trimethoprim, quinolones, and antiseptics.^3,14,16 The number of gene cassettes can vary in an integron, but the highest number of them observed so far is eight.¹⁹ There are at least five classes of integrons, in which class 1 integrons are the most commonly found in nosocomial and community environments, followed by classes 2 and 3.^19,25

Several studies have investigated the prevalence of integrons in clinical isolates of E. coli. However, there have been few reports on the distribution and comparison of integrons and gene cassettes among DEC and UPEC isolates. Because of the importance of surveillance of the dissemination of multidrug-resistant (MDR) pathogenic E. coli isolates, we investigated the prevalence of class 1, 2, and 3 integrons and characterized their gene cassette arrays in E. coli strains isolated from diarrheal children younger than 5 years of age and adult patients with symptomatic UTIs.

Materials and Methods

Clinical samples and bacterial isolation

Two hundred E. coli strains were isolated from clinical specimens of four major university hospitals in Zanjan, Iran. One hundred strains were isolated from stool specimens of diarrheal children younger than 5 years of age and 100 strains from urine samples of adult patients with symptomatic UTIs. Diarrheal patients were enrolled in the study if they had not taken any antimicrobial agent in the week preceding sampling. Diarrhea is characterized by the occurrence of three or more loose, liquid, or watery stools, or at least one bloody loose stool in a 24-hr period.²³ Criteria for symptomatic UTI included dysuria, urgency, and frequency of micturition.⁶ Patients with UTI due to catheterization and those yielding mixed infection were excluded from the study. Specimens were cultured on MacConkey agar (Merck) and isolates were identified by standard biochemical methods.

Antimicrobial susceptibility testing

Susceptibility of isolates to the following antibiotics was examined using the disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines:⁵ amoxicillin (25 μg), aztreonam (30 μg), amikacin (30 μg), cefotaxime (30 μg), cefoxitin (30 μg), ceftazidime (30 μg), ciprofloxacin (5 μg), co-amoxiclav (30 μg), co-trimoxazole (25 μg), cefepime (10 μg), gentamicin (10 μg), imipenem (10 μg), and tetracycline (30 μg) (MAST). Isolates shown to be resistant to at least three different classes of antimicrobial agents were determined to be MDR. E. coli ATCC 25922 was used as a control for antibiotic resistance.

Integron characterization and sequencing of resistance-encoding gene cassettes

All isolates were tested for characterization of class 1, 2, and 3 integrons (intI) and their resistance-encoding gene cassettes. Extraction of DNA was performed according to the protocol provided with the Qiagen Mini Amp kit. The primer sequences used in this study are shown in Table 1. The polymerase chain reaction (PCR) was performed in a reaction mixture with a total volume of 25 μl, containing 2 μl template DNA; 0.2 mM of each deoxynucleoside triphosphate; 10 pmol of each primer; 10 mM Tris-HCl; 1.5 mM MgCl₂; 50 mM KCl; and 1.5 U of Taq DNA polymerase. PCR was performed with the Gene Atlas 322 system (ASTEC). Amplification involved an initial denaturation at 94°C for 5 min followed by 30 cycles of denaturation (94°C, 1 min), annealing (62°C, 1 min for intI genes; 60°C, 1 min for 5′CS/3′CS and hep), and extension (72°C, 2 min), with a final extension step at 72°C for 10 min. Amplified products were purified using the QIAquick Gel Extraction Kit (Qiagen), and direct sequencing of internal variable regions (gene cassettes) of class 1 and 2 integrons was done using the ABI 3730X capillary sequencer (Genfanavaran; Macrogen). Nucleotide sequences were analyzed and compared using BLAST software (National Center for Biotechnology Information; www.ncbi.nlm.nih.gov).

Table 1.

Primers Used in This Study

Target	Primer sequence (5′→3′)	Amplicon size (bp)	Ref.
intI-1F	CAGTGGACATAAGCCTGTTC	160	6
intI-1R	CCCGAGGCATAGACTGTA
intI-2F	CACGGATATGCGACAAAAAGGT	788	6
intI-2R	GATGACAACGAGTGACGAAATG
intI-3F	GCCTCCGGCAGCGACTTTCAG	979	6
intI-3R	ACGGATCTGCCAAACCTGACT
in-F (5′CS)	GGCATCCAAGCAGCAAGC	Variable	16
in-R (3′CS)	AAGCAGACTTGACCTGAT
hep-F	CGGGATCCCGGACGGCATGCACGATTTGT	Variable	16
hep-R	GATGCCATCGCAAGTACGAG

Conjugal transfer of plasmids carrying integrons

E. coli strains RG488 Rif^r and RG176 Nal^r were used as the recipients for the conjugation experiment. A single colony of each strain on the MacConkey agar plate (Merck) was inoculated in trypticase soy broth (Merck) and grown at 37°C for 20 hr. The donor and recipient strains, in an exponential growing phase, mixed and incubated at 37°C for 20 hr. The transconjugants were selected on Mueller-Hinton agar supplemented with trimethoprim (50 mg/L) or streptomycin (50 mg/L) and rifampicin (50 mg/L) or nalidixic acid (50 mg/L).

Plasmid DNA isolation and Southern hybridization

Extraction of plasmid DNA was performed according to the protocol provided with the GeneJET Plasmid Miniprep Kit (Thermo Scientific). The extracted plasmids were ascertained by electrophoresis on 0.7% agarose gel, and denatured DNA was transferred onto a positively charged nylon membrane (Boehringer Mannheim) using the capillary method. For the hybridization assays, a DIG DNA labeling and detection kit (Roche) was used according to the manufacturer's instructions. The purified intI1 gene from the PCR products was used as the DNA probe and labeled with digoxigenin-11-dUTP according to the random labeling method.

Statistical analysis

The data were analyzed with SSPS version 17.0 software (SPSS, Inc.). The chi-square test was used to determine the statistical significance of the data. A p value of <0.05 was considered significant.

Results

Susceptibility to antimicrobial agents

Antimicrobial resistance patterns of isolates are presented in Table 2. In all, 192 (96%) isolates were resistant to 1 or more of the 13 tested antimicrobial agents. The most frequent resistance was found against amoxicillin (80%), aztreonam (71%), tetracycline (62.5%), ceftazidime (58%), and gentamicin (56.5%) (Table 2). Imipenem showed the highest activity against isolates and only 3.5% of isolates were imipenem resistant. A total of 128 (64%) isolates were resistant to at least three different classes of antimicrobial agents and considered as MDR. The most prevalent MDR pattern was resistance to β-lactams, tetracycline, gentamicin, and co-trimoxazole. Antimicrobial drug resistance patterns varied among UPEC and DEC isolates (shown in Table 2). The prevalence of resistance to all antibiotics except co-trimoxazole and cefepime among UPEC and DEC isolates was significantly different (p<0.05). Antimicrobial resistance among DEC isolates was higher compared with the UPEC. However, imipenem showed the highest activity against both UPEC and DEC isolates. Among the 128 MDR isolates, 71 isolates of DEC and 57 isolates of UPEC were MDR.

Table 2.

Antimicrobial Drug Resistance Patterns Among 200 UPEC and DEC Isolates

	UPEC (n=100)		DEC (n=100)		Total (n=200)
Antimicrobial agents	R (%)	S (%)	R (%)	S (%)	R (%)	S (%)	p-Value
Amoxicillin	71 (35.5%)	29 (14.5%)	89 (44.5%)	11 (5.5%)	160 (80%)	40 (20%)	0.001
Cefoxitin	13 (6.5%)	87 (43.5%)	30 (15%)	70 (35%)	43 (21.5%)	157 (78.5%)	0.003
Ceftazidime	37 (18.5%)	63 (31.5%)	79 (39.5%)	21 (10.5%)	116 (58%)	84 (42%)	<0.001
Cefotaxime	36 (18%)	64 (32%)	52 (26%)	48 (24%)	88 (44%)	112 (56%)	0.023
Cefepime	35 (17.5%)	65 (32.5%)	36 (18%)	64 (32%)	71 (35.5%)	129 (64.5%)	0.88
Co-amoxiclav	16 (8%)	84 (42%)	90 (45%)	10 (5%)	106 (53%)	94 (47%)	<0.001
Imipenem	0	100 (50%)	7 (3.5%)	93 (46.5%)	7 (3.5%)	193 (96.5%)	0.007
Aztreonam	54 (27%)	46 (23%)	88 (44%)	12 (6%)	142 (71%)	58 (29%)	<0.001
Gentamicin	38 (19%)	62 (31%)	75 (37.5%)	25 (12.5%)	113 (56.5%)	87 (43.5%)	<0.001
Tetracycline	50 (25%)	50 (25%)	75 (37.5%)	25 (12.5%)	125 (62.5%)	75 (37.5%)	<0.001
Co-trimoxazole	53 (26.5%)	47 (23.5%)	53 (26.5%)	47 (23.5%)	106 (53%)	94 (47%)	1.00
Amikacin	11 (5.5%)	89 (44.5%)	58 (29%)	42 (21%)	69 (34.5%)	131 (65.5%)	<0.001
Ciprofloxacin	30 (15%)	70 (35%)	53 (26.5%)	47 (23.5%)	83 (41.5%)	117 (58.5%)	0.001

% shown for UPEC or DEC is % compared to the total number of isolates.

R isolates include intermediate+resistant.

DEC, diarrheagenic Escherichia coli; R, resistant; S, susceptible; UPEC, uropathogenic Escherichia coli.

Analysis of integrons

In all, 185 (92.5%) isolates were positive for the presence of integrases, with 170 (85%) isolates being positive only for class 1 integron-associated integrase, while 4 (2%) isolates were positive only for the intI2 gene. Eleven (5.5%) isolates harbored both intI1 and intI2. Class 3 was not detected among the isolates. Class 1 integrase was more frequent in comparison with class 2 (p<0.001). Comparison of integrons among UPEC and DEC showed that DEC isolates harbored integrases (94% for intI1, 8% for intI2) with a slightly higher frequency than in UPEC isolates (87% for intI1, 7% for intI2) (p>0.05). All except eight isolates (n=177) carrying intI genes were resistant to one or more antimicrobial agents. Prevalence of antimicrobial drug resistance in UPEC and DEC isolates with and without integron-associated intI genes are presented in Table 3. The prevalence of MDR isolates among the integrase-positive strains was significantly (p<0.05) higher than that found among the integrase-negative strains. All MDR isolates of DEC and UPEC (71 and 57 isolates, respectively) harbored the intI gene.

Table 3.

Prevalence of Antimicrobial Drug Resistance Among 200 UPEC and DEC Strains With and Without Integron-Associated intI Genes

	UPEC (n=100)				DEC (n=100)
	intI⁺ isolates (n=90)		intI⁻ isolates (n=10)		intI⁺ isolates (n=95)		intI⁻ isolates (n=5)
Antimicrobial agents	R (n=%)	S (n=%)	R (n=%)	S (n=%)	R (n=%)	S (n=%)	R (n=%)	S (n=%)
Amoxicillin	65	25	6	4	85	10	4	1
Cefoxitine	13	77	0	10	28	67	2	3
Ceftazidime	35	55	2	8	74	21	5	0
Cefotaxime	35	55	1	9	48	47	4	1
Cefepime	33	57	2	8	34	61	2	3
Co-amoxiclav	16	74	0	10	86	9	4	1
Imipenem	0	90	0	10	6	89	1	4
Aztreonam	49	41	5	5	83	12	5	0
Gentamicin	34	56	4	6	71	24	4	1
Tetracycline	45	45	5	5	71	24	4	1
Co-trimoxazole	47	43	6	4	51	44	2	3
Amikacin	10	80	1	9	54	41	4	1
Ciprofloxacin	28	62	2	8	51	44	2	3

% shown for intI⁺ or intI⁻ isolates is % of all UPEC or DEC.

R isolates include intermediate+resistant.

To identify gene cassettes in integrons, each gene cassette region in classes 1 and 2 integrons was amplified by primers 5′CS/3′CS and hepF/hepR, respectively. Ten different gene cassette arrays were found in class 1 integrons (Table 4). Ten gene cassettes encoding resistance to trimethoprim (dfrA1, dfrA7, dfr2d, dfrA12, and dfrA17), aminoglycosides (aadA1, aadA2, and aadB), and streptothricin (sat and sat2) were detected in different class 1 integrons. DfrA1 was the most prevalent gene cassette among intI1-positive isolates, followed by dfr2d and dfrA17. Among 181 isolates carrying intI1, 24 isolates harbored integrons without cassettes. Two different gene cassette arrays, dfrA1-aadA1 and dfrA1-sat-aadA1-orfX, were found in intI2-positive isolates. Two intI2-positive uropathogenic isolates harbored the dfrA1-aadA1 gene cassette, while diarrheagenic isolates carried the dfrA1-sat-aadA1-orfX gene cassette.

Table 4.

Gene Cassette Arrays Among UPEC and DEC Isolates

		No. of isolates carrying cassettes of class 1 integron		No. of isolates carrying cassettes of class 2 integron
Length of variable region (bp)	Gene cassettes	UPEC	DEC	UPEC	DEC	Total
450	dfrA1	29	28	—	—	57
500	dfrA17	15	6	—	—	21
600	dfr2d	25	3	—	—	28
700	aadB	2	2	—	—	4
750	dfrA7	0	18	—	—	18
1000	aadA1	0	4	—	—	4
1300	dfrA1-sat2	0	1	—	—	1
1500	dfrA1-aadA1	7	7	2	—	16
1800	dfrA12-orfF-aadA2	6	1	—	—	7
2000	dfrA1-sat-aadA1-orfX	0	3	—	2	5

Genetic localization of class 1 integrons

To determine the genetic localization of class 1 integrons, 40 E. coli isolates comprising 14 isolates carrying dfrA1-aadA1 (7 UPEC, 7 DEC), 7 isolates carrying dfrA12-orfF-aadA2 (6 UPEC, 1 DEC), and 19 isolates carrying dfrA1 (9 UPEC, 10 DEC) were selected randomly and the conjugation experiment, plasmid analysis, and Southern hybridization with the intI1 probe were performed. The results showed that all the tested isolates carried their class 1 integrons on plasmid, and the gene cassettes could be transferred to recipient strains in the conjugation experiment as shown by PCR amplification of class 1 integrons. The plasmid profiles of transconjugants were different from each other and 32 different profiles were detected. However, the intI1 probe was hybridized at plasmids of sizes 70–95 kb.

Discussion

Antimicrobial resistance and the spread of resistance genes among pathogenic E. coli isolates have become a major public health problem in developing countries.²² Treatment of infections associated with MDR E. coli is further complicated in Asian countries such as Taiwan, India, and Iran.^17,20 In our study, 96% of E. coli isolates were resistant to one or more antimicrobial agents and 64% were MDR. Imipenem (96.5%) showed the highest activity against all isolates followed by cefoxitin (78.5%) and amikacin (65.5%). The high incidence of antibiotic resistance found in this survey is most probably due to the widespread use of numerous antimicrobial agents in our country. Furthermore, the loss and gain of resistance genes by mobile genetic elements is an important mechanism in the development of MDR isolates.²⁴ Antimicrobial resistance (except co-trimoxazole and cefepime) among DEC isolates was higher compared with the uropathogenic isolates (p<0.05). The high prevalence of antibiotic resistance in DEC isolates may be due to acquisition of the resistance genes from intestinal microbiota as reservoirs for transmission of these genes.¹⁹

Integron distribution in clinical isolates of E. coli has been the subject of several studies. These studies have established a strong association between the presence of integrons and antimicrobial resistance.^2,4,7 E. coli isolates especially enteric pathotypes carrying several antibiotic resistance genes may act as a reservoir or donor of resistance genes to other pathogenic E. coli and other species.¹⁹ As reported by previous studies, the prevalence of integrons in clinical E. coli isolates has ranged from 16.6% to 99%.^{8,13,18,21,22} This large difference in integron prevalence may be due to the analyzed E. coli isolates, the patient population, type of specimens, and the geographical region. National survey data have indicated the prevalence of class 1 integrons in 57.6% of UPEC isolates from 16 western European countries and Canada.¹ According to our results, 92.5% of E. coli isolates carry class 1 or 2 integrases. We found a high occurrence of class 1 integrons in both uropathogenic and diarrheagenic isolates. Several other reports have indicated the elevated occurrence of class 1 integrons in comparison to class 2.^11,12,26 Similar to results of Mokracka et al.¹⁴ and Gundogdu et al.,¹⁰ the presence of integrons was also associated with MDR.

Ten different gene cassette arrays were detected in class 1 integrons. Gene cassettes encoding resistance to trimethoprim (dfrA) were found to be predominant in the class 1 integrons. The results suggest the stability of this gene cassette in class 1 integrons, which may reflect the selective pressure, exerted over a long period, by the use of trimethoprim in clinics. The aad cassettes that confer resistance to aminoglycosides were also detected in 21% of the isolates harboring intI1. The gene cassette arrays of dfrA-aadA detected in class 1 integrons may reflect cotransfer of resistance genes due to the genetic linkage of dfrA and aadA cassettes. Our data are consistent with the previous reports worldwide on the predominance of dfrA and aadA gene cassettes among Enterobacteriaceae. In addition, all resistance gene cassettes in our study were described most commonly elsewhere.^11,22,26 A conjugation experiment and Southern hybridization showed that three prevalent gene cassettes of class 1 integron in tested isolates were located in plasmids and conjugally transferable, which suggest the horizontal transfer of these integrons through conjugative plasmids. Nucleotide sequencing of the variable region in intI2-positive isolates revealed two different gene cassette arrays dfrA1-aadA1 and dfrA1-sat-aadA1-orfX conferring resistance to trimethoprim, streptothricin, and streptomycin/spectinomycin. These gene arrays were described in class 2 integrons in different bacterial species previously.¹⁵

In conclusion, appropriate surveillance and control measures are essential to prevent the further spread of integron-carrying isolates in hospitals. Further studies should be carried out for a better understanding of the impact of integrons on the dissemination of antimicrobial resistance in clinical practice.

Footnotes

Acknowledgments

We are grateful to Mehdi Kashefiyeh for the collection of samples and technical assistance. The funding source for our research was the Zanjan University of Medical Sciences, Zanjan, Iran.

Disclosure Statement

No competing financial interests exist.

References

Blahna

M.T.

, Zalewski

C.A.

, Reuer

, Kahlmeter

, Foxman

, and Marrs

C.F.

2006. The role of horizontal gene transfer in the spread of trimethoprim-sulfamethoxazole resistance among uropathogenic Escherichia coli in Europe and Canada. J. Antimicrob. Chemother., 57:666–672.

Boucher

, Labbate

, Koenig

J.E.

, and Stokes

H.W.

2007. Integrons: mobilizable platforms that promote genetic diversity in bacteria. Trends Microbiol., 15:301–309.

Cambray

, Guerout

, and Mazel

2010. Integrons. Annu. Rev. Genet., 44:141–146.

Chen

, Zheng

, Yu

, Huang

, Zheng

, Zhang

, Guan

, Zhuang

, Chen

, and Topp

2011. Class I integrons, selected virulence genes, and antibiotic resistance in Escherichia coli isolates from the Minjiang river, Fujian province, China. Appl. Environ. Microbiol., 77:148–155.

Clinical and Laboratory Standards Institute. 2013. Performance standards for antimicrobial susceptibility testing; 23th informational supplement (M100-S23) Vol. 31 No. 1. CLSI, Wayne, PA.

Copur-Cicek

, Ozgumus

O.B.

, Saral

, and Sandalli

2014. Antimicrobial resistance patterns and integron carriage of Escherichia coli isolates causing community-acquired infections in Turkey. Ann. Lab. Med., 34:139–144.

Dıaz-Mejıa

J.J.

, Amabile-Cuevas

C.F.

, Rosas

, and Souza

2008. An analysis of the evolutionary relationships of integron integrases, with emphasis on the prevalence of class I integrons in Escherichia coli isolates from clinical and environmental origins. Microbiology, 154:94–102.

Farshad

, Japoni

, and Hosseini

2008. Low distribution of integrons among multidrug resistant E. coli strains isolated from children with community-acquired urinary tract infections in Shiraz, Iran. Pol. J. Microbiol., 57:193–198.

Gillings

M.R.

2014. Integrons: past, present and future. Microbiol. Mol. Biol. Rev., 78:257–277.

10.

Gundogdu

, Beverley Long

, Vollmerhausen

T.L.

, and Katouli

2011. Antimicrobial resistance and distribution of sul genes and integron-associated intI genes among uropathogenic Escherichia coli in Queensland, Australia. J. Med. Microbiol., 60:1633–1642.

11.

Kang

H.Y.

, Jeong

Y.S.

, Oh

J.U.

, Tae

S.H.

, Choi

C.H.

, Moon

D.S.

, Lee

W.K.

, Lee

Y.C.

, Seol

S.Y.

, Cho

D.T.

, and Lee

J.C.

2005. Characterization of antimicrobial resistance and class 1 integrons found in Escherichia coli isolates from humans and animals in Korea. J. Antimicrob. Chemother., 55:639–644.

12.

Machado

, Cantón

, Baquero

, Galán

J.C.

, Rollán

, Peixe

, and Coque

T.M.

2005. Integron content of extended-spectrum-ß-lactamase-producing Escherichia coli strains over 12 years in a single hospital in Madrid, Spain. Antimicrob. Agents Chemother., 49:1823–1829.

13.

Marquez

, Labbate

, Raymondo

, Fernandez

, Gestal

A.M.

, Holley

, Borthagaray

, and Stokes

H.W.

2008. Urinary tract infections in a South American population: dynamic spread of class 1 integrons and multidrug resistance by homologous and site-specific recombination. J. Clin. Microbiol., 46:3417–3425.

14.

Mokracka

, Oszynska

, and Kaznowski

2013. Increased frequency of integrons and ß-lactamase-coding genes among extra-intestinal Escherichia coli isolated with a 7-year interval. Antonie Leeuwenhoek, 103:163–174.

15.

Moura

, Soares

, Pereira

, Leitão

, Henriques

, and Correia

2009. INTEGRALL: a database and search engine for integrons, integrases and gene cassettes. Bioinformatics, 25:1096–1098.

16.

Partridge

S.R.

, Tsafnat

, Coiera

, and Iredell

J.R.

2009. Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol. Rev., 33:757–784.

17.

Phongpaichit

, Tunyapanit

, and Pruekprasert

2011. Antimicrobial resistance, class I integrons and extended spectrum betalactamases in E. coli clinical isolates from patients in south Thailand. J. Health Sci., 57:281–288.

18.

Pongpech

, Naenna

, Taipobsakul

, Tribuddharat

, and Srifuengfung

2008. Prevalence of extended spectrum beta-lactamase and class I integron integrase gene intI1 in Escherichia coli from Thai patients and healthy adults. Southeast Asian J. Trop. Med. Public Health, 39:425–433.

19.

Ravi

, Avershina

, Ludvigsen

, L'Abée-Lund

T.M.

, and Rudi

2014. Integrons in the intestinal microbiota as reservoirs for transmission of antibiotic resistance genes. Pathogens, 3:238–248.

20.

Rice

L.B.

2009. The clinical consequences of antimicrobial resistance. Curr. Opin. Microbiol., 12:476–481.

21.

Solberg

O.D.

, Ajiboye

R.M.

, and Riley

L.W.

2006. Origin of class I and II integrons and gene cassettes in a population-based sample of uropathogenic Escherichia coli. J. Clin. Microbiol., 44:1347–1351.

22.

, Shi

, Yang

, Xiao

, Li

, and Yamasaki

2006. Analysis of integrons in clinical isolates of Escherichia coli in China during the last six years. FEMS Microbiol. Lett., 254:75–80.

23.

Tobias

, and Vutukuru

S.R.

2012. Simple and rapid multiplex PCR for identification of the main human diarrheagenic Escherichia coli. Microbiol. Res., 167:564–570.

24.

Wozniak

R.A.F.

, and Waldor

M.K.

. 2010. Integrative and conjugative elements: mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat. Rev. Microbiol., 8:552–563.

25.

, Li

, Shirtliff

M.E.

, Alam

M.J.

, Yamasaki

, and Shi

2009. Occurrence and characteristics of class I and II integrons in Pseudomonas aeruginosa isolates from patients in southern China. J. Clin. Microbiol., 47:230–234.

26.

Yan

, Li

, Zong

, Alam

M.J.

, and Shinoda

2010. Occurrence and characteristics of class I and II integrons in clinical bacterial isolates from patients in south China. J. Health Sci., 56:442–450.