bla NDM-1 Carriage on IncR Plasmid in Enterobacteriaceae Strains

Abstract

Four NDM-1-producing Enterobacteriaceae strains (three Klebsiella pneumoniae and one Citrobacter koseri) were isolated between 2009 and 2011 through a nationwide surveillance for carbapenem-resistant Enterobacteriaceae in Croatia to study the molecular genetic background of bla_NDM and the responsible plasmid types. Phenotypically, the clinical strains proved to be multidrug resistant. All strains remained susceptible to tigecycline and colistin. The clinical strains harbored variable antibiotic resistance determinants, notably, bla_NDM-1, bla_TEM-1, bla_SHV-1, bla_SHV-12, bla_OXA-1, bla_OXA-9, bla_CTX-M-15, bla_CMY-4, qnrB1, and aac(6′)Ib-cr in different combinations. Two K. pneumoniae belonged to sequence type ST15 and one strain to ST16. As for the plasmid types, C. koseri and one of the ST15 K. pneumoniae carried IncR, and the second ST15 K. pneumoniae carried IncR and colE. The K. pneumoniae ST16 strain hosted A/C and colE plasmids. The bla_NDM-1 gene was detected on conjugative high-molecular-weight plasmids, namely, A/C and IncR types. It is noteworthy that this is the first description of K. pneumoniae ST16 expressing NDM-1 in Europe. Remarkably, our study underscores the importance of the IncR plasmid as a reservoir of multidrug resistance. To the best of our knowledge, the IncR plasmid carrying bla_NDM-1 in C. koseri is reported for the first time.

Introduction

The first clinical isolates carrying the gene encoding New Delhi metallo-beta-lactamase-1 (bla_NDM-1) were Klebsiella pneumoniae and Escherichia coli found in Sweden, originating from an Indian patient previously hospitalized in New Delhi.²⁷ Since then, many enterobacterial species (among the others Proteus mirabilis, Citrobacter freundii, Enterobacter cloacae, Morganella morganii), and among nonfermenters, Acinetobacter baumannii and Pseudomonas aeruginosa, have been detected harboring this enzyme.^15,21,22 Although the Indian subcontinent is the primary cradle, the Balkan countries can be witnessed as the secondary reservoir area of bla_NDM-carrying bacterial pathogens.¹⁶

Strains producing the NDM-1 enzyme are described by diverse genetic features, in that, they have different sequence types (ST) and possess the bla_NDM-1 gene on different plasmid types, namely, L/M, A/C, and F. Usually, they are multidrug resistant due to additional antibiotic-resistant determinants, notably, other beta-lactamases, 16S rRNA methylase, and plasmid-mediated quinolone resistance (PMQR) determinants [qnr, aac(6′) - Ib-cr, and qepA genes].²¹

In Croatia, the first NDM-1-expressing Enterobactericeae as K. pneumoniae KLZA was recovered in May 2009 from a patient who had been hospitalized previously in Bosnia and Herzegovina following a car accident.¹⁷

The aims of our study were to examine the molecular genetic features and plasmid profiles of three bla_NDM-1-positive K. pneumoniae and one Citrobacter Koseri, originating from the collection of a nationwide survey conducted in Croatia.

Materials and Methods

Bacterial isolates

Four multidrug-resistant Enterobacteriaceae strains, namely, three K. pneumoniae and one C. koseri, were isolated between November 2009 and June 2011 through a nationwide surveillance in Croatia. The isolates were recovered from urine samples, originating from four different patients admitted to different clinical wards in Zagreb. Records related to the Indian subcontinent were not found in any of the patients' histories. According to medical data, the patients were only hospitalized in Croatia.

Antimicrobial susceptibility testing

Minimal inhibitory concentrations (MICs) of carbapenems, cephalosporins, aztreonam, fluoroquinolones, aminoglycosides, colistin, and tigecycline were measured by broth microdilution and interpreted according to the latest documents of the European Committee on Antimicrobial Susceptibility Testing (EUCAST) (www.eucast.org/clinical_breakpoints/version 5.0).

Polymerase chain reaction for antibiotic resistance determinants

Beta-lactamase genes encoding TEM, SHV, CTX-M, AmpC, and carbapenemases were screened by polymerase chain reaction (PCR).^3,9 Additional genetic determinants conferring resistance to other antibiotic classes, such as PMQRs [qnrA, qnrB, qnrS, qnrC, qnrD, aac(6′)-Ib-cr, qepA]^6,21,23,26 and 16S rRNA methylase (armA, rmtB, rmtC),⁹ were also examined. All the positive PCR products were purified (QIAquick PCR Purification Kit; Qiagen, Hilden, Germany) and sent to be sequenced (MWG Eurofins Operon, Ebersberg, Germany). The obtained DNA sequences were analyzed by the NCBI Blast program (www.ncbi.nlm.nih.gov/).

Mapping the genetic environment of bla_NDM-1 gene

PCR was performed by specific primers for ISAba125 and for the bleomycin resistance (ble_MBL) gene to examine the genetic surrounding of bla_NDM-1.²¹ An additional primer pair was also designed by the tool on the homepage of MWG Eurofins Operon to clarify the neighboring sequences further, namely, fosfo fw: cgaacaagatcaagtccgcc and fosfo rv: atgccgacactgagcactac, corresponding to regions of 187164-187183 and 188073-188054, respectively, of plasmid of accession number AP012055.¹³

Conjugation assay

Broth-mating assay was performed to assess the transferability of bla_NDM-1, with the J53 azide-resistant E. coli as the recipient strain. A ratio of 1:1 of donor and recipient cells was applied, and the conjugation reactions were incubated at 37°C. Transconjugant (Tc) cells were harvested from Luria–Bertani agar plates and supplemented with 10 mg/L ceftazidime and 100 mg/L sodium azide.

PCR-based replicon typing

Characterization of plasmid incompatibility groups of clinical strains and Tcs was carried out by specific primers and thermal conditions.^5,11 Furthermore, a secondary primer pair was also designed to obtain a longer 774 bp sequence of the IncR replicon, namely, rep R fw: tcagagcaggttccaggaag and rep R rev: tgggaaagaggtcaagttcag, corresponding to 19099–19118 and 19872-19852 regions, respectively, of the accession number of DQ449578, the previously published reference sequence.¹¹ Based on the nucleotide sequence of plasmid of accession number AP012055, the repA fw: (37-atcggcgaggttataggtccag-58) and repA rv: (741-agagagcaatgagagcctgtc-721) and repB fw: (91893-agctggatgtcaacagcacc-91912) and repB rev: (92792-taagaggatcgatgccagcag-92772) primers were also designed.

Plasmid partition gene typing

The multiplex PCR method was performed to give complementary characterization of the resistance plasmids following the recent publication of Bousquet et al.⁴

Clonality analysis

The K. pneumoniae genotypes were characterized by multilocus sequence typing (MLST) to define the ST of the clinical isolates. Allelic numbers were obtained at the homepage of www.pasteur.fr/recherche/genopole/PF8/mlst/Kpneumoniae, according to the sequences of seven housekeeping genes. MLST is still not applicable to C. koseri.

For pulsed-field gel electrophoresis (PFGE), plugs were prepared in agarose blocks for the K. pneumoniae strains and digested with 20 units of XbaI (Sigma-Aldrich, St. Louis, Missouri) overnight at 37°C and run in CHEF DR™ Electrophoresis BioRad with 6V/cm, 120° angle, 2 sec initial switch time, and 35 sec final switch time for 21 hr.

Southern blot hybridization

Southern blot was performed on the plasmid extraction (Qiagen) of clinical strains and Tcs with digoxigenin-11-dUTP-labeled probes for bla_NDM-1 and IncR (Roche, Mannheim, Germany). Plasmid extractions (QIAprep Spin Miniprep Kit; Qiagen) were run in a 0.6% (w/v) agarose gel (Sigma-Aldrich), blotted on a positively charged nylon membrane, and hybridized with the specific probe. The chemiluminescence detection film was developed according to the manufacturer's protocol (Roche).

Plasmid sizing by S1 nuclease digestion

Whole genomic DNA of clinical strains and their Tcs was digested by S1 nuclease (Sigma-Aldrich) and run in CHEF DR Electrophoresis BioRad with 120° angle, with pulse time 5–25 sec for 6 hr and 30–45 sec for 18 hr at 6V/cm, and temperature at 14°C. Large plasmids migrated as discrete bands in the gel, and the molecular weight marker for DNA 50–1,000 kb (Sigma-Aldrich) was used to define the plasmid size.²

Results

As Table 1 shows, the clinical strains proved to be resistant to third- and fourth-generation cephalosporins, aztreonam, gentamicin, and fluoroquinolones, although the ciprofloxacin and levofloxacin MICs for C. koseri remained in the susceptible range. With regard to the carbapenem MICs, only K. pneumoniae 107 exhibited resistance to all three agents (imipenem, meropenem, and ertapenem). As for the remaining three clinical strains, the imipenem and meropenem MICs fell into the susceptible category, while the ertapenem MICs fell into the resistant category. Tigecycline and colistin remained active on all strains (Table 1).

Table 1.

Minimal Inhibitory Concentrations (mg/L) for NDM-1-Producing Clinical Enterobacteriaceae Strains, Their Transconjugants, and J53 Azide-Resistant Escherichia coli

Strain	CTX	CAZ	FEP	ATM	IPM	MEM	ETP	CIP	LVX	GEN	TGC	CST
107 Klebsiella pneumoniae	>128	>128	>128	>128	32	32	64	>128	128	32	2	0.25
Tc 107 E. coli	>128	>128	32	128	1	1	4	0.06	0.06	0.5	0.125	0.125
117 K. pneumoniae	>128	>128	128	>128	2	2	8	32	16	4	0.5	0.5
Tc 117 E. coli	>128	>128	>128	64	2	2	8	0.06	0.06	2	0.125	0.125
268 K. pneumoniae	>128	>128	64	>128	0.5	0.5	4	64	8	16	0.5	1
Tc 268 E. coli	>128	>128	32	64	0.5	0.5	2	0.125	0.06	16	0.06	0.125
40 Citrobacter koseri	>128	>128	64	>128	2	2	8	0.25	0.125	32	0.125	0.125
Tc 40 E. coli	>128	>128	32	128	2	2	8	0.25	0.06	16	0.125	0.125
J53 E.coli	0.03	0.125	0.03	0.03	0.03	0.03	0.03	0.03	0.03	0.06	0.06	0.125

CTX, cefotaxime; CAZ, ceftazidime; FEP, cefepime; ATM, aztreonam; IPM, imipenem; MEM, meropenem; ETP, ertapenem; CIP, ciprofloxacin; LVX, levofloxacin; GEN, gentamicin; Tc, transconjugant; TGC, tigecycline; CST, colistin.

According to the sequence results, the strains turned out to carry multiple beta-lactamase genes, namely, bla_TEM-1, bla_SHV-1, bla_SHV-12, bla_OXA-1, bla_OXA-9, bla_CTX-M-15, bla_CMY-4, and bla_NDM-1 in variable combinations. As for the PMQRs, three strains (2 K. pneumoniae, namely, 107 and 268, and C. koseri) carried qnrB1, and all the strains possessed the aac(6′)Ib-cr gene (Table 2).

Table 2.

Summary of the Clinical Data and Genetic Background of NDM-1-Producing Enterobacteriaceae Strains and Transconjugant

Strain	Date of isolation, origin	bla_NDM	ISAba125	ble_MBL	Additional antibiotic resistance determinants	PCR-based replicon typing	MLST
107 K. pneumoniae	16/05/2011, Zagreb KIB 6/2	NDM-1	Truncated	ble _MBL	CTX-M-15, SHV-12, TEM-1, OXA-1, OXA-9, QnrB1, AAC(6′)-Ib-cr	IncR	ST15
Tc 107 E. coli	-	NDM-1	Truncated	ble _MBL	CTX-M-15, SHV-12, TEM-1, OXA-1, OXA-9, AAC(6′)-Ib-cr	IncR	-
117 K. pneumoniae	07/06/2011, Zagreb Merkur	NDM-1	Truncated	Truncated	CTX-M-15, SHV-1, TEM-1, OXA-1, CMY-4, AAC(6′)-Ib-cr	A/C, colE	ST16
Tc 117 E. coli	-	NDM-1	Truncated	Truncated	SHV-1, CMY-4, AAC(6′)-Ib-cr	A/C	-
268 K. pneumoniae	02/11/2009, Zagreb Traumatology	NDM-1	Truncated	Truncated	CTX-M-15, SHV-12, TEM-1, OXA-1, QnrB1, AAC(6′)-Ib-cr	IncR, colE	ST15
Tc 268 E. coli	-	NDM-1	Truncated	Truncated	CTX-M-15, SHV-12, TEM-1, OXA-1, QnrB1, AAC(6′)-Ib-cr	IncR	-
40 C. koseri	18/01/2011, Zagreb Dubrava	NDM-1	Truncated	Truncated	CTX-M-15, SHV-12, TEM-1, OXA-1, QnrB1, AAC(6′)-Ib-cr	IncR	NA
Tc 40 E. coli	-	NDM-1	Truncated	Truncated	CTX-M-15, SHV-12, TEM-1, OXA-1, QnrB1, AAC(6′)-Ib-cr	IncR	-

MLST, multilocus sequence typing; NA, nonapplicable; PCR, polymerase chain reaction; ST, sequence types.

The amplification of the genetic surrounding revealed the presence of the truncated ISAba125 sequence upstream of the bla_NDM-1 gene in all isolates. Downstream, only one strain, namely, K. pneumoniae strain 107 carried the entire sequence of the ble_MBL gene, while the rest of the strains harbored 174 bp, a truncated version (Table 2).

MLST revealed that two K. pneumoniae strains (107 and 268) belonged to ST15 and one strain (117) to ST16 (Table 2). By PFGE, the two ST15 K. pneumoniae strains showed highly similar nonidentical PFGE patterns, while the strain ST16 was unrelated, confirming that the bla_NDM-carrying K. pneumoniae strains under study were sporadic isolations.

The two K. pneumoniae strains belonging to ST15 differed in their plasmid scaffold: strain 107 hosted IncR and strain 268 IncR, colE plasmid types. K. pneumoniae strain 117 belonged to ST16 and carried A/C and colE plasmids. The broth-mating assay confirmed the transfer of bla_NDM-1. The Tcs of the two K. pneumoniae belonging to ST15, namely, strain 107 and 268, possessed the IncR plasmid, while the A/C plasmid appeared in the case of the Tc of ST16 K. pneumoniae strain 117. The C. koseri strain 40 and its Tc hosted only the IncR plasmid (Table 2).

The IncR replicon sequence obtained from the clinical strains and their Tcs matched identically with the correlating sequence region (19367–19617) of plasmid pK245 under the accession number of DQ449578.¹¹ The newly designed primer pair for IncR replicon confirmed the presence of the 774 bp product, showing 100% similarity with DQ449578 in the case of strain 107, 268, 40, and their Tcs. Recently, the IncR replicon possessing plasmids, one carrying bla_NDM-1 (accession number AP012055)¹³ and the other one expressing VIM-1 (accession number JQ824049),¹⁰ have been reported, and their available sequences in NCBI Blast provided the alignment with our DNA sequences under study. Interestingly, the analysis with respect to the IncR replicon revealed no significant similarity with plasmid AP012055, while a 100% match was found with plasmid JQ824049.

Characterizing the IncR plasmid further, the Southern blot hybridization was performed on the plasmid extraction of clinical strains and their Tcs. Positive signals were detected at the size of high-molecular-weight plasmids with both bla_NDM-1 and IncR probes, confirming that bla_NDM-1 was harbored on the IncR plasmid. By S1 nuclease digestion, the responsible plasmids carrying bla_NDM-1 were sized. Compared to the clinical strains, one plasmid in each Tc was detected. The IncR- and the A/C-type plasmids appeared at the size of ∼300 and ∼194 kb, respectively.

Discussion

Nowadays, the treatment of infections caused by carbapenem-resistant Enterobacteriaceae plays a cardinal issue in the clinical settings. The major part of these pathogens acquires carbapenemase genes and besides, they possess additional antibiotic-resistant determinants, thus, leaving few antibiotics as therapeutic options.¹⁹

The Croatian clinical strains under study expressed a multidrug-resistant phenotype. Tigecycline and colistin remained constantly susceptible on these clinical isolates. With regard to carbapenem MICs, values ranged from the susceptible to the resistant categories. Our results are consistent with the literature, since any Enterobacteriaceae with reduced susceptibility to carbapenems should be screened for carbapenemase carriage.¹⁹

Regarding carbapenem MICs, differences were revealed comparing the clinical strain 107 and 268 and their Tcs. The increased carbapenem MICs in the case of the strain 107 could be due to the alteration of the outer-membrane proteins as it has been demonstrated previously.¹ Our current project focused on the genetic characterization of bla_NDM-1-positive plasmids; therefore, a subsequent study will be conducted to explore additional mechanisms related to carbapenem resistance.

Examining the genetic background, this collection of Croatian NDM-1-producing Enterobacteriaceae strains displayed heterogenic features. They carried several resistance genes [beta-lactamases and two types of PMQRs, namely, QnrB1 and AAC(6′)-Ib-cr] and hosted different plasmid scaffolds.

It is noteworthy that we characterized bla_NDM-1-bearing C. koseri in our collection, since formerly NDM-expressing C. freundii was only reported.²¹ By comparing the genetic features of the first Croatian NDM-1-producing K. pneumoniae KLZA and this recent collection, differences were revealed in the additional resistance determinants and in the ST, confirming that the other bla_NDM-1-bearing clones are emerging in this country.

Notably, K. pneumoniae KLZA belonged to ST25 and hosted the IncA/C-type plasmid, and bla_CTX-M-15, bla_CMY-16, and qnrA₆ were listed as associated determinants of resistance.¹⁷ In the study collection, K. pneumoniae ST15 and ST16 were defined. K. pneumoniae ST16 was associated with the IncA/C plasmid, and the IncR-type was hosted dominantly by K. pneumoniae ST15. ST15 is a one-allelic variant of ST14, as the initial bla_NDM-1-carrying K. pneumoniae in the literature,²⁷ while ST16 is unrelated. ST25 relates neither to ST15 nor ST16. The genetic differences can be explained by the fact that the NDM-1-producing K. pneumoniae KLZA is a transported strain from Bosnia and Herzegovina.¹⁷ This collection under study, to the best of our knowledge, is connected to Croatia.

Epidemiologically, ST15 K. pneumoniae strains harboring bla_NDM-1 have already been reported from Morocco and Belgium.^3,20 The latter case had linkage with Montenegro.³ ST16 NDM-1-producing K. pneumoniae has been identified previously in Canada, and the patient had been formerly hospitalized in India.¹⁸ This is the first time that, to the extent of our knowledge, ST16 NDM-1-producing K. pneumoniae is described in Europe. Recently, ESBL-producing K. pneumoniae ST15 has been detected in vegetables imported from India to Switzerland.²⁸ It is worrisome, since this route can also facilitate the potential spread of bla_NDM.

Evaluating the genetic environment, in all the strains, bla_NDM-1 was flanked upstream by partial sequence of ISAba125, showing that this region was mobilized originally from A. baumannii.²² Downstream, the intact ble_MBL gene was carried by one strain, and the rest of the isolates harbored a truncated version of this gene. Usually, bla_NDM-1 is highly associated with the presence of the entire ble_MBL gene, although occasionally the ble_MBL gene can be deleted, as in the case of NDM-1-expressing P. aeruginosa ST235 from France.¹⁴

Regarding the IncR replicon, it was assigned by García-Fernández et al. by characterizing plasmids carrying qnrS1, qnrB2, and qnrB19 genes deriving from the quinolone-resistant Salmonella strains isolated from humans in the Netherlands, concluding that the IncR plasmid (DQ449578) was associated with the qnrS1 gene.¹¹ From Barcelona, the majority of CTX-M-15-expressing K. pneumoniae strains carried the IncR plasmid by providing linkage between the bla_CTX-M-15 gene and the IncR replicon.⁷ A Dutch report proved the detection of the qnrB19 gene on the IncR-type plasmid in E. coli.¹² Low- and high-molecular-weight IncR plasmids were described among Klebsiella spp. harboring bla_CTX-M-15, qnrS1, and aac(6′)-Ib-cr genes.²⁴ Recently, carbapenemase carriage has been reported on high-molecular size multireplicon plasmids harboring IncR characteristic regions, notably, bla_VIM-1 in Providencia stuartii from Greece¹⁰ and bla_NDM-1 in K. pneumoniae from Taiwan and Czech Republic.^13,25 According to the IncR replicon, the Croatian sequences under study demonstrated an identical match with the initial IncR plasmid (DQ449578) and the plasmid from Greece (JQ824049). Interestingly, no additional replication or partition regions could be detected using PCR-based replicon typing and plasmid partition gene typing in the IncR plasmids described in our study. However, the presence of regions not detectable by these two methods cannot be excluded. Although in the literature, IncR plasmids can be found dominantly among Klebsiella spp. and less frequently in other Enterobacteriaceae species,²⁴ our results revealed the high-molecular-weight IncR plasmids found in K. pneumoniae ST15 and in C. koseri. Remarkably, our study extended the bacterial species spectrum by the detection of the IncR replicon in C. koseri. In this Croatian collection, beside the bla_NDM-1, the three IncR plasmids cocarried the additional resistance genes in two different patterns, notably, bla_TEM-1, bla_OXA-1, bla_OXA-9, bla_CTX-M-15, bla_SHV-12, and aac(6′)-Ib-cr (Tc107) and bla_TEM-1, bla_OXA-1, bla_CTX-M-15, bla_SHV-12, aac(6′)-Ib-cr, and qnrB1 (Tc268 and Tc40).

To the best of our knowledge, this is the first time that bla_NDM-1 carriage on the IncR plasmid is reported in C. koseri. Since NDM-producing Enterobacteriaceae strains frequently coexpress CTX-M-15, the awareness of the detection of IncR plasmid as a reservoir of the multidrug resistance phenotype and contributing to the plasmid plasticity is of particular relevance. Our study underlines that the Balkan area serves an important geographic source of NDM-1-expressing pathogens.

In conclusion, our findings emphasized the diverse genetic features of the NDM-1-producing Enterobacteriaceae strains and with the detection of the IncR plasmid type give a further contribution to mapping this heterogenic landscape.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Baroud

, Dandache

, Araj

G.F.

, Wakim

, Kanj

, Kanafani

, Khairallah

, Sabra

, Shehab

, Dbaibo

, and Matar

G.M.

2013. Underlying mechanisms of carbapenem resistance in extended-spectrum β-lactamase-producing Klebsiella pneumoniae and Escherichia coli isolates at a tertiary care centre in Lebanon: role of OXA-48 and NDM-1 carbapenemases. Int. J. Antimicrob. Agents., 41: 75–79.

Barton

B.M.

, Harding

G.P.

, and Zuccarelli

A.J.

1995. A general method for detecting and sizing large plasmids. Anal. Biochem., 226:235–240.

Bogaerts

, Bouchahrouf

, de Castro

R.R.

, Deplano

, Berhin

, Piérard

, Denis

, and Glupczynski

2011. Emergence of NDM-1-producing Enterobacteriaceae in Belgium. Antimicrob. Agents Chemother., 55:3036–3038.

Bousquet

, Henquet

, Compain

, Genel

, Arlet

, and Decré

2015. Partition locus-based classification of selected plasmids in Klebsiella pneumoniae, Escherichia coli and Salmonella enterica spp.: an additional tool. J. Microbiol. Methods., 110:85–91.

Carattoli

, Bertini

, Villa

, Falbo

, Hopkins

K.L.

, and Threlfall

E.J.

2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods., 63:219–228.

Cavaco

L.M.

, Hasman

, Xia

, and Aarestup

F.M.

2009. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica Serovar Kentucky and bovismorbificans strains of human origin. Antimicrob. Agents Chemother., 58:603–608.

Coelho

, González-López

J.J.

, Miró

, Alonso-Tarrés

, Mirelis

, Nieves Larrosa

, Bartolomé

R. M.

, Andreu

, Navarro

, Johnson

J.R.

, and Prats

2010. Characterisation of the CTX-M-15-encoding gene in Klebsiella pneumoniae strains from the Barcelona metropolitan area: plasmid diversity and chromosomal integration. Int. J. Antimicrob. Agents., 36:73–78.

Dallenne

, Da Costa

, Decré

, Favier

, and Arlet

2010. Development of a set of multiplex PCR assays for the detection of genes encoding important ß-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother., 65:490–495.

Doi

, and Arakawa

2007. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin. Infect.Dis., 45:88–94.

10.

Drieux

, Decré

, Frangeu

, Arlet

, Jarlier

, and Sougakoff

2013. Complete nucleotide sequence of the large conjugative pTC2 multireplicon plasmid encoding the VIM-1 metallo-β-lactamase. J. Antimicrob. Chemother., 68:97–100.

11.

García-Fernández

, Fortini

, Veldman

, Mevius

, and Carattoli

2009. Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella. J. Antimicrob. Chemother., 63:274–281.

12.

Hordijk

, Bosman

A.B.

, van Essen-Zandbergen

, Veldman

, Dierikx

, Wagenaar

J.A.

, and Mevius

2011. qnrB19 gene bracketed by IS26 on a 40-kilobase IncR plasmid from an Escherichia coli isolate from a veal calf. Antimicrob. Agents Chemother., 55:453–454.

13.

Huang

T.W.

, Chen

T.L.

, Chen

Y.T.

, Lauderdale

T.L.

, Liao

T.L.

, Lee

Y.T.

, Chen

C.P.

, Liu

Y.M.

, Lin

A.C.

, Chang

Y.H.

, Wu

K.M.

, Kirby

, Lai

J.F.

, Tan

M.C.

, Siu

L.K.

, Chang

C.M.

, Fung

C.P.

, and Tsai

S.F.

2013. Copy number change of the NDM-1 sequence in a multidrug-resistant Klebsiella pneumoniae clinical isolate. PLoS One., 8:e62774.

14.

Janvier

, Jeannot

, Tessé

, Robert-Nicoud

, Delacour

, Rapp

, and Mérensa

2013. Molecular characterization of bla_NDM-1 in a sequence type 235 Pseudomonas aeruginosa isolate from France. Antimicrob. Agents Chemother., 57:3408–3411.

15.

Jovcic

, Lepsanovic

, Suljagic

, Rackov

, Begovic

, Topisirovic

, and Kojic

2011. Emergence of NDM-1 metallo-β-lactamase in Pseudomonas aeruginosa clinical isolates from Serbia. Antimicrob. Agents Chemother., 55:3929–3931.

16.

Livermore

D.M.

, Walsh

T.R.

, Toleman

, and Woodford

2011. Balkan NDM-1: escape or transplant?. Lancet Infect. Dis., 11:164.

17.

Mazzariol

, Bošnjak

, Ballarini

, Budimir

, Bedenić

, Kalenić

, and Cornaglia

2012. NDM-1-producing Klebsiella pneumoniae, Croatia. Emerg. Infect. Dis., 18:532–534.

18.

Mulvey

M.R.

, Grant

J.M.

, Plewes

, Roscoe

, and Boyd

D.A.

2011. New Delhi metallo-β-lactamase in Klebsiella pneumoniae and Escherichia coli, Canada. Emerg. Infect. Dis., 17:103–106.

19.

Nordmann

, Dortet

, and Poirel

2012. Carbapenem resistance in Enterobacteriaceae: here is the storm!. Trends Mol. Med., 18:263–272.

20.

Poirel

, Benouda

, Hays

, and Nordmann

2011. Emergence of NDM-1-producing Klebsiella pneumoniae in Morocco. J. Antimicrob. Chemother., 66:2781–2783.

21.

Poirel

, Dortet

, Bernabeu

, and Nordmann

2011. Genetic features of bla_NDM-1-positive Enterobacteriaceae. Antimicrob. Agents Chemother., 55:5403–5407.

22.

Poirel

, Bonnin

R.A.

, Boulanger

, Schrenzel

, Kaase

, and Nordmann

2012. Tn125-related acquisition of bla_NDM-like genes in Acinetobacter baumannii. Antimicrob. Agents Chemother., 56:1087–1089.

23.

Robicsek

, Strahilevitz

, Sahm

D.F.

, Jacoby

G.A.

, and Hooper

D.C.

2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother., 50:2872–2874.

24.

Ruiz

, Sáenz

, Zarazaga

, Rocha-Gracia

, L.Martínez-Martínez,

Arlet

, and Torres

2012. qnr, aac(6′)-Ib-cr and qepA genes in Escherichia coli and Klebsiella spp.: genetic environments and plasmid and chromosomal location. J. Antimicrob. Chemother., 67:886–897.

25.

Studentova

, Dobiasova

, Hedlova

, Dolejska

, Papagiannitsis

C.C.

, and Hrabak

2015. Complete nucleotide sequences of two NDM-1encoding plasmids from the same sequence type 11 Klebsiella pneumoniae strain. Antimicrob. Agents Chemother., 59:1325–1328.

26.

Wang

, Guo

, Xu

, Wang

, Ye

, Wu

, Hooper

D.C.

, and Wang

2009. New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother., 53:1892–1897.

27.

Yong

, Toleman

M.A.

, Giske

C.G.

, Cho

H.S.

, Sundman

, Lee

, and Walsh

T.R.

2009. Characterization of a new metallo-ß-lactamase gene, bla_NDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob. Agents Chemother., 53:5046–5054.

28.

Zurfluh

, Nüesch-Inderbinen

, Morach

, Zihler Berner

, Hächler

, and Stephan

2015. Extended-spectrum-β-lactamase-producing Enterobacteriaceae isolated from vegetables imported from the Dominican Republic, India, Thailand, and Vietnam. Appl. Environ. Microbiol., 81:3115–3120.

bla NDM-1 Carriage on IncR Plasmid in Enterobacteriaceae Strains

Abstract

Introduction

Materials and Methods

Bacterial isolates

Antimicrobial susceptibility testing

Polymerase chain reaction for antibiotic resistance determinants

Mapping the genetic environment of blaNDM-1 gene

Conjugation assay

PCR-based replicon typing

Plasmid partition gene typing

Clonality analysis

Southern blot hybridization

Plasmid sizing by S1 nuclease digestion

Results

Discussion

Footnotes

Disclosure Statement

References

Mapping the genetic environment of bla_NDM-1 gene