Frequency of Plasmid-Mediated AmpC β-Lactamases in Escherichia coli Isolates from Urine Samples in São Paulo,Brazil

Abstract

Plasmid-mediated AmpC β-lactamases (PMACBLs) in Enterobacteriaceae encode resistance to third-generation cephalosporins, and these can mediate carbapenem resistance when associated with porin loss. However, no standardized phenotypic method is available for detecting these enzymes in the clinical microbiology laboratory. Limited data are available concerning the frequency of PMACBLs in Enterobacteriaceae in Brazil. This study was conducted in response to an increased cefoxitin (CFO) resistance rate of 3.7% in Escherichia coli isolates from urine samples from patients with suspected urinary tract infections during 2010. We collected 2,266 E. coli isolates prospectively during January 2012. A total of 109 (4.8%) isolates were nonsusceptible to CFO. These strains were further examined using multiplex PCR for the presence of genes encoding PMACBLs and using inhibitor assays with CFO and ceftazidime (CAZ) disks with and without phenylboronic acid. Pulsed-field gel electrophoresis was used to evaluate clonal dissemination. Genes encoding PMACBLs were detected in 1.8% of the isolates from inpatients and 0.46% of isolates from outpatients. The most prevalent gene was bla_CMY-2 and bla_CMY-4 was also detected. The phenotypic analysis showed 100% sensitivity and specificity for CMY-2 and CMY-4 when CFO-resistant isolates with a minimum zone diameter difference of 5 mm for CAZ or CAZ and CFO were considered positive. Although most of the isolates were nonclonal, one clonal group with two isolates was observed. Thus, the most frequent PMACBL in E. coli from São Paulo, Brazil is CMY-2, and both clonal and plasmid-mediated dissemination occur.

Introduction

In Escherichia coli AmpC β-lactamases can be encoded by genes located on the chromosome or on plasmids.²⁰ Most E. coli strains express the chromosome-encoded enzyme at a very low level due to the absence of the ampR regulator gene. The absence of this gene also causes ampC expression to be noninducible, but mutations in the ampC promoter/attenuator region can result in increased AmpC expression and β-lactam resistance.^18,29 In contrast to the typically low expression level of the chromosome-located ampC gene, the plasmid-located genes that encode plasmid-mediated AmpC β-lactamases (PMACBLs) in E. coli are often expressed at a level that confers resistance to many β-lactams including oxy-imino-β-cephalosporins (e.g., ceftazidime, cefotaxime, and ceftriaxone), cephamycins (e.g., cefotetan and cefoxitin), and semi-synthetic penicillins.²⁰ CMY enzymes are the most frequently detected PMACBLs worldwide although there are other PMACBL families, such as FOX, ACC, LAT, MIR, ACT, MOX, CFE, and DHA.²⁰ PMACBL-producing E. coli can also be carbapenem-resistant when porin loss occurs concomitantly²⁵; consequently, the detection of these enzymes in the clinical microbiology laboratory is of epidemiological importance.Various strategies have been used to detect AmpC production in E. coli including cefoxitin (CFO) agar, CFO, cefotetan, ceftazidime (CAZ), or cefotaxime (CTX) disks with added boronic acid compounds or cloxacillin (CLOX), but none of these strategies can accurately differentiate PMACBLs from upregulated chromosomal AmpC (Table 1).^{1,3,9,10,21,23,33,35,36,39} The lack of a standardized phenotypic method for the detection of PMACBL-producing isolates makes it difficult to compare data on the worldwide frequency of these enzymes, and both CFO resistance and amoxicillin-clavulanic acid resistance have been used as phenotypic markers for screening for AmpC production.¹⁵

Table 1.

Disk Diffusion-Based Methods for AmpC Detection in Escherichia coli

Screening	Method	Interpretation/positive test	Best test performance	Reference
CFO disk inhibition zone diameter <18 mm	Three-dimensional extract test with CFO disk	Growth of the ATCC25922 E. coli strain in the inhibition zone along the test strain	SN and SP not reported	Coudron et al.¹⁰
No	CFO, CTT, CPD, CAZ, or CTX alone and in combination with 20 μg of 48-1220 or LN-2-128	Inhibition zone diameter difference ≥4 mm	CTT plus LN-2-128 and CTT plus 48-1220: 100% SN and 90% SP	Black et al.¹
CFO resistance	Modified hodge test with CFO disk	Growth of the ATCC25922 E. coli strain in the inhibition zone along the test strain	71.5% SN and 81.3% SP; DHA-1 57.3% SN; CMY 98.2% SN	Lee et al.²³
CFO disk inhibition zone diameter <18 mm	CTT disks alone and in combination with PBA	Inhibition zone diameter difference ≥5 mm	SN and SP not reported	Coudron⁹
CFO hydrolysis	CFO, CPD or CPD plus CA alone and combined with BZBTH2B	Inhibition zone diameter difference ≥5 mm with combined disk	SN and SP not reported	Brenwald et al.³
No	CTX and CAZ disks alone and in combination with 300 μg of APBA	Inhibition zone diameter difference ≥5 mm	SN and SP not reported	Yagi et al.³⁹
	Double-disk synergy test using CAZ and CTX disks and a 300 μg of APBA disk	Enhancement of the CAZ and CTX inhibition zones
No	Double-disk synergy test with CAZ and CTX disks and a 500 μg CLOX disk	ACC-1 producer if an enhancement of the CAZ and CTX inhibition zone present	SN and SP not reported	Ruppe et al.³⁵
No	CFO disks and CAZ disks alone and combined with APBA	Inhibition zone diameter difference ≥5 mm	SN and SP not reported	Jacoby et al.²¹
CFO hydrolysis	CFO and CPD disks with a 400 μg PBA and/or 200 μg CLOX	Inhibition zone diameter difference	CFO plus PBA: 95% SN and SP	Tan et al.³⁶
	Double-disk synergy test with CAZ disks and IMP, CFO or AMC disks	Blunting or flattening of the CAZ disk inhibition zone	CAZ/IMP: 25. 2% SN and 99. 2% SP
Reduced susceptibility to AMC, PTZ, CRO, CAZ or CTX	CFO-CLOX disk test	Inhibition zone diameter difference ≥4 mm	SN and SP not reported	Peter-Getzlaff et al.³³
	CFO-EDTA disk test	Flattening of the CFO inhibition zone

AMC, amoxicillin-clavulanic acid; APBA, 3-aminophenylboronic acid; CA, clavulanic acid; CAZ, ceftazidime; CLOX, cloxacillin; CPD, cefpodoxime; CRO, ceftriaxone; CTT, cefotetan; CTX, cefotaxime; EDTA, ethylenediamine tetraacetic acid; CFO, cefoxitin; PBA, phenylboronic acid; PTZ, piperacillin-tazobactam; SN, sensitivity; SP, specificity.

In Brazil only two reports of PMACBL detection in E. coli are available.^2,31 One of these studies was undertaken in Rio de Janeiro to evaluate E. coli strains collected from chicken carcasses from August 2010 to April 2011 and the authors reported the detection of the bla_CMY-2 gene in 19 isolates.² The other study was conducted in São Paulo, and described the detection of carbapenem-resistant isolates.³¹ In both studies only a 462 bp fragment of a 1,146 bp gene was sequenced and frequency was not calculated.

There is one report of bla_CMY-2-like detection in Salmonella enterica³² and one publication from São Paulo describing a Klebsiella pneumoniae strain producing a CMY-2-like enzyme,⁴ but none of these publications determined the full bla_CMY gene sequence. There was also a prevalence study that was not successful in finding PMACBLs in clinical isolates from patients at a university hospital located in the city of Rio de Janeiro.¹²

This study was prompted by an analysis of the susceptibility profiles of E. coli isolates from patients attending a large private laboratory in São Paulo, the largest city in Latin America. From January 2006 to December 2010, a sustained increase in the frequency of CFO-resistant E. coli was observed. While that rate was 0.03% among 91,400 E. coli isolates from 2006 to 2007, the rates were 0.35%, 0.70%, and 0.65%, in 2008, 2009, and 2010, respectively. Among all clinical samples tested, the highest CFO resistance rate 3.7% in 2010 was observed among E. coli isolates cultured from urine samples collected from patients with suspected urinary tract infections. Because no methodological changes were implemented, the main hypothesis for the cause of this increase was the spread of clones or genes located in transposons or integrons through transfer on plasmids. The objectives of this study were to determine the relative frequency of PMACBLs among E. coli isolates from urine samples from patients with suspected urinary tract infections, to evaluate a possible phenylboronic acid (PBA)-based phenotypic confirmatory test for PMACBLs using multiplex PCR and DNA sequencing as the gold standard and to evaluate the occurrence of clonal dissemination.

Materials and Methods

Bacterial strains

From January 2nd to February 1st 2012, a total of 2,266 urine cultures, one per patient, were positive for E. coli at a large private laboratory from São Paulo, Brazil. Among these, 2,153 cultures were obtained from outpatients and 113 were obtained from inpatients admitted to seven different private hospitals. Among the 2,266 E. coli isolates, 109 isolates (4.8%) were intermediate or resistant to CFO, as determined using the Vitek2 system (bioMérieux), and were included in this study. Species identification was achieved through the production of pink colonies on ChromID CPS agar (bioMérieux) and through mass spectrometry using the Vitek MS system (bioMérieux).

PMACBL detection using the disk diffusion method

Enzyme blocking was evaluated after adding PBA (Sigma-Aldrich) to 30 μg CAZ and CFO disks (Oxoid). The PBA solution was prepared after dissolving 240 mg of PBA in 3 ml of DMSO, followed by the addition of an equal volume of reagent-grade water. The disks were prepared immediately before use by adding 10 μl of PBA solution. A bacterial suspension with a turbidity equivalent to 0.5 McFarland standard was prepared from cultures incubated for 18–24 hr and plated on Mueller–Hinton agar (Becton-Dickinson). After the evaporation of excess suspension, CFO and CAZ disks with and without PBA were applied. After 18–24 hr of incubation at 36°C ± 1°C, the diameters of the inhibition zones were measured, and the differences between the values were calculated. Susceptibility to CFO, ertapenem, imipenem, and meropenem were evaluated by disk diffusion in accordance with the Clinical and Laboratory Standards Institute.^6,7

Detection of genes encoding PMACBLs using multiplex PCR

Multiplex PCR reactions were performed as previously described,¹¹ except primers rrs27FW 5′ AGAGTTTGATYMTGGCTCAG and rrs1492RV 5′ GGTTACCTTGTTACGACTT²⁴ were included at a final concentration of 0.2 μM to target the 16S rRNA genes as an internal control in each reaction, and Platinum^® Taq DNA polymerase (Invitrogen) was used. Hafnia alvei C4171841, Aeromonas caviae 82251942, Morganella morganii D4141434, Citrobacter freundii D4042263, and Enterobacter asburie D4040536 were used as controls for the detection of genes encoding ACC, MOX, DHA, CMY, and LAT or the ACT and MIR enzymes, respectively. The FOX-1 E. coli control strain for genes encoding FOX enzymes was kindly provided by Dr. Ana Gales.

Pulsed-field gel electrophoresis

The pulsed-field gel electrophoresis (PFGE) was performed as described previously, with minor modifications.³⁴ The plugs were cut in half, placed into a 96-well microdilution plate containing 200 μl of 1X enzyme buffer, and incubated for 30 min at room temperature, followed by digestion with 3 μl of Xbal (Invitrogen) for 4 hr at 36°C ± 1°C.

The plugs and the size marker lambda phage concatamers (NewEngland Biolabs) were loaded onto a 1% agarose gel. Electrophoresis was carried out in a CHEF-DR III system with a 5 sec initial pulse and a 35 sec final pulse; a 19 hr run time and 6 V/cm² voltage at a 120° angle. After the run, the agarose gel was stained with GelRed for 30 min and visualized under ultraviolet light. The profiles were compared using BioNumerics software version 6.0 (Applied Maths) with the UPGMA method to calculate Dice's similarity index with 1% tolerance and optimization. Strains were defined as having a clonal relationship if their profiles possessed a minimum similarity index of 85%.¹⁴ The profiles were also compared visually and classified according to Tenover's criteria.³⁷

Two epidemiologically unrelated E. coli strains (C1101689 and C1210549) were included as controls.

Full PMACBL genes sequencing

Genomic DNA was extracted from 18 to 24 hr cultures using the Illustra Bacteria Genomic Prep Mini Spin Kit^® (GE Healthcare). One microliter of DNA solution was added to a 50 μl PCR reaction containing 1X PCR buffer (150 mM Tris- HCl and 500 mM KCl, pH 8.0), 0.2 mM of each deoxynucleotide, 1.5 mM MgCl₂, 0.16 mM of each primer, and 1 U of Platinum Taq DNA polymerase (Invitrogen). The primers pairs used in this study were published previously (ISEcp1-3′-cmy-F-c 5′AAAAATGATTGAAAGGTGGT and CIT-MR-cmy-rv-d 5′TTTCTCCTGAACGTGGCTGGC²⁷) or designed for this study using the Primer-BLAST program and GenBank deposit number AY581207¹⁶: JS-cmy-blc-F 5′GCGGTGAAACCCTCAGGAAT and JS-blc-cmy-RV 5′AACCAGGAATGCAGCCGTAA; JS-cmy-blc-F2 5′CCAGCATTGGTCTGTTTGGC and JS-blc-cmy-RV2 5′TCGCCGGTGAAATAGGCTTT; JS-CMY-2-1-25-FW 5′ATGATGAAAAAATCGWTATGCTGCCG and JS-CMY-2-1139-20-RV 5′AGCTTTTCAAGAATGCGCCA. Amplifications were performed with a single cycle of 3 min at 94°C, followed by 35 amplification cycles consisting of 30 sec at 94°C, 30 sec at 55°C, 1 min at 72°C, and a final extension for 7 min at 72°C. The amplicons were purified using the GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and sequenced using the same primers and the BigDye Terminator version 3.1 Cycle Sequencing kit (Applied Biosystems^®) in a 3130xl Genetic Analyzer (Applied Biosystems). The contigs were assembled using SeqMan Pro version 8.1 (DNAStar) and subsequently translated and compared with the sequences available in GenBank using the BLAST program.

Results

Frequency of genes encoding PMACBLs

When the 109 isolates that were not susceptible to CFO were examined using multiplex PCR, 12 isolates had amplification products with an estimated size of 538 bp, which is compatible with the bla_CMY-2-like or bla_LAT genes. In all other isolates tested, only amplicons of ∼1,492 bp (16S rRNA gene) were observed. Two isolates were obtained from inpatients and 10 isolates were obtained from outpatients. Considering the total number of 2,153 outpatients and 113 inpatients, the frequency of genes encoding PMACBLs was 0.46% in E. coli isolates from outpatients and 1.8% in E. coli isolates from inpatients. When the DNA sequences were translated and compared with the sequences available in GenBank, 11 isolates were confirmed to have the bla_CMY-2 gene, while the bla_CMY-4 gene was detected in only one isolate (C1310573). Two DNA sequences, one for bla_CMY-2 and one for bla_CMY-4, were deposited at GenBank under accession numbers KJ488945.1 and KJ496347.1, respectively.

The best sensitivity and specificity for CMY-2 and CMY-4 detection are achieved using CFO resistance as a screening method in combination with CAZ disks with PBA

All 109 isolates that were classified as not susceptible to CFO by the Vitek2 system were examined via disk diffusion using CFO and CAZ disks with and without PBA. A total of 32 CFO-intermediate isolates and 11 CFO-resistant isolates, as determined by the Vitek2 system, were found to be susceptible by disk diffusion. All of these isolates were negative when tested using multiplex PCR. Seven isolates (6.4%), one resistant, three intermediate and three susceptible to CFO by disk diffusion, were found to be negative for PCR and have an inhibition zone diameter enhancement ≥5 mm with CFO with added PBA (Table 2). These isolates were considered to have upregulation of the chromosomally encoded AmpC. Using PCR as the gold standard for PMACBL detection, the best sensitivity, specificity, negative predictive, and positive predictive values (100%) were achieved by combining CFO resistance (inhibition zone diameter ≤14 mm) with an inhibition zone enhancement ≥5 mm after the addition of PBA solution to 30 μg CAZ disks (Table 1). Using CFO resistance and an inhibition zone enhancement ≥5 mm after the addition of PBA solution to 30 μg CFO disks as the criteria to identify CMY-2 and CMY-4 resulted in 95.0% specificity (Table 2). All 109 isolates were susceptible to carbapenems.

Table 2.

Distribution of E. coli Isolates According to Cefoxitin Susceptibility, PCR for PMACBL and Inhibition Zone Diameter Difference After PBA Addition to Ceftazidime or Cefoxitin Disks

		Number of isolates (sensitivity, %; specificity, %)
		CAZ		CFO		CAZ and CFO
CFO disk diffusion susceptibility (n)	PCR for PMACBL	≥5 mm	<5 mm	≥5 mm	<5 mm	≥5 mm	<5 mm or divergent
Resistant (n = 32)	Positive (n = 12)	12 (100; 100)	0	12 (100; 95.0)	0	12 (100; 100)	0
	Negative (n = 20)	0	20	1	19	0	20
Intermediate or resistant (n = 66)	Positive (n = 12)	12 (100; 81.5)	0	12 (100; 92.6)	0	12 (100; 96.3)	0
	Negative (n = 54)	10	44	4	50	2	52
All (n = 109)^a	Positive (n = 12)	12 (100; 79.4)	0	12 (100; 92.8)	0	12 (100; 94.8)	0
	Negative (n = 97)	20	77	7	90	5	92

PMACBL, plasmid-mediated AmpC β-lactamases. ≥5 mm and <5 mm refer to inhibition zone diameter differences when comparing results obtained with and without addition of PBA.

All (n = 109) refers to the isolates that were nonsusceptible to CFO by Vitek2 testing.

PMACBL dissemination in São Paulo, Brazil, occurs by both clonal spread and plasmid dissemination

Most patients infected with AmpC-producing E. coli were female (83%), but this proportion was similar to that observed for the whole population studied (91%). Patient age ranged from 4 to 100 years with a median of 69 years (Fig. 1). All PMACBL-producing E. coli were evaluated by PFGE. When the profiles were compared, most of the isolates had a Dice's index below 85% and had seven or more band differences and were consequently interpreted as unrelated. One clonal group with two isolates with a 94.4% similarity index and a single band difference was detected. Of note, those isolates were isolated from patients in home care who had previous admissions to different hospitals (Fig. 1).

FIG. 1.

Pulsed-field gel electrophoresis profile of CMY-producing Escherichia coli after digestion with XbaI. Patient age is expressed in years.

Discussion

In this study, we detected a frequency of 0.46% for PMACBL production in E. coli isolates from urine samples from outpatients with suspected urinary tract infections and a frequency of 1.8% in E. coli isolates from inpatients from São Paulo, Brazil. In contrast, the frequency of ESBL-producing E. coli was 3.5% in samples from outpatients and 6.9% in samples from inpatients, as detected by the Vitek2.

The difference between the PMACBL frequencies observed in this study and those previously reported in Brazilian studies^4,12 (0% and 0.75%) likely reflect the differences between samples. Notably, in the study that was performed in Rio de Janeiro,¹² only 42 E. coli isolates from various clinical samples were studied, in contrast with this study, in which only isolates from urine samples were analyzed. In addition, in the study performed in São Paulo, the frequency refers to all Enterobacteriaceae species cultured from blood cultures.⁴

The frequencies of PMACBLs obtained in this study are lower than those reported in other countries in Latin America. Cejas et al.⁵ reported that 0.9% of E. coli produce CMY-2 in Argentina, while Leal el al.²² reported that 2.7% of E. coli isolated from urine samples produce PMACBL in Colombia, and Marcano et al.²⁶ reported that 4.3% of Enterobacteriaceae produce PMACBL in Venezuela. The differences between this study and the available data from Latin America may reflect the samples analyzed and the microorganisms evaluated. Cejas et al.⁵ not only identified PMACBLs in isolates from urine samples but also used isolates cultured from other biological fluids and blood from nosocomial and community-acquired infections, whereas Leal et al.²² used urine samples from patients with pyelonephritis and Marcano et al.²⁶ used enterobacterial isolates from various infection sites.

An extensive review that included population studies of PMACBL was published by George Jacoby in 2009²⁰ and revealed a wide range of frequency values among E. coli isolates throughout the world, with values ranging from 0.09% in Canadian hospitals from 1999 to 2000²⁸ to 49% in London from 2004 to 2006.³⁸

More recently, Denisuik et al.¹³ examined a total of 5,451 E. coli isolates obtained from patients in Canadian hospitals, and the frequency of PMACBL producers was 2.9%. Ortega et al.³⁰ conducted a multicenter study in Spain screening for PMACBLs in E. coli through the expression of resistance to amoxicillin/clavulanic acid. Among the 257 isolates resistant to amoxicillin/clavulanic acid, 19.5% produced these enzymes. The most frequently detected enzymes were bla_CMY-2, bla_DHA-1, bla_CMY-30, and bla_CMY-42. Yilmaz et al.⁴⁰ conducted a study with 191 E. coli isolates in India, in which the isolates were screened using CFO disks with PBA, and the results were confirmed using multiplex PCR assays. The frequency of PMACBL-producing E. coli was 10.9%. In this study, we used PBA to detect PMACBLs in E. coli isolates susceptible to carbapenems. The main limitation for the detection of PMACBLs in E. coli using PBA or CLOX is the generation of false positive results when E. coli isolates express chromosome-encoded AmpCs; consequently, there is a need to confirm the presence of PMACBLs by PCR. Considering that a high sensitivity and specificity are desirable for diagnostic methods, phenotypic tests were compared with the results obtained using PCR. The best correlation with PCR results was obtained with a combination of resistance to CFO and a difference in inhibition zones between CAZ or CFO and CAZ disks with and without PBA ≥5 mm, leading to high sensitivity and specificity, with positive and negative predictive values of 100%.

Tan et al.³⁶ found a 94% sensitivity for the detection of PMABLs using CFO disks with added PBA and interpreting as positive those isolates with an inhibition zone diameter ≥4 mm. These results differ from those obtained in this study probably due to the fact that Tan et al. evaluated E. coli, K. pneumoniae, and Proteus mirabilis as a single group, while we determined these values for E. coli alone. Black et al.¹ found 100% sensitivity for PMACBL in a collection of E. coli and K. pneumoniae strains known to produce ACT, FOX, CMY, DHA, MIR, or MOX enzymes, but they used CFO disks with new inhibitors 48-1220 and LN-2-128.

In this work we detected seven isolates (6.4%) with an inhibition zone diameter enhancement ≥5 mm with CFO with added PBA and with a negative PCR result, which were considered to have chromosomally upregulated AmpC. Sequencing of the ampC promoter/attenuator region⁸ would confirm the presence of mutations but was not performed in this study or in the studies conducted by Tan et al.³⁶ and Black et al.¹ Consequently, our findings concerning specificity of the test for PMACBL detection, as the published data, are of limited value.

Although we analyzed a large number of E. coli isolates (∼2,266 strains), one limitation of this study is the initial screening using CFO, as ACC-1, a PMACBL, cannot hydrolyze this antimicrobial; however, we also included isolates intermediate for CFO. An alternative to the initial screening for PMACBLs that would also detect ACC enzymes is nonsusceptibility to amoxicillin/clavulanic acid.¹⁵

The presence of one clonal group was observed using PFGE. The strains that exhibited a clonal relationship were isolated from elderly patients in home care. These patients require hospital care more often; one explanation for finding the same clone in patients from different institutions could be the movement of elderly patients among different hospitals and homecare facilities. Our findings are in accordance with previous publications that reported PMACBL-producing E. coli in elderly patients¹⁷ and clonal dissemination in rehabilitation centers.¹⁹ Our finding that only 2 of 12 isolates had a clonal relation, suggests that AmpC dissemination among E. coli in the city of São Paulo occurs mainly via horizontal plasmid transfer.

In summary, we provided a description of the relative frequency of PMACBLs in Brazil and showed that CMY-2 is the most frequently occurring enzyme in E. coli isolates from urine samples from patients with suspected urinary tract infection. This is the first report from Brazil to determine full bla_CMY gene nucleotide sequences. We also demonstrated that clonal dissemination is not the main mechanism of dissemination for PMACBLs in São Paulo. Our results also indicated that using CFO resistance as an initial screening method in combination with CAZ or CAZ and CFO disks with PBA can accurately detect the CMY-2 and CMY-4 enzymes.

Footnotes

Acknowledgments

This work was financially supported by grants from the Fleury Institute and CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior).

Author Disclosure Statement

No competing financial interests exist.

References

Black

J.A.

, Thomson

K.S.

, and Pitout

J.D.

2004. Use of beta-lactamase inhibitors in disk tests to detect plasmid-mediated AmpC beta-lactamases. J. Clin. Microbiol., 42:2203–2206.

Botelho

L.A.

, Kraychete

G.B.

, Costa

E.S.J.L.

, Regis

D.V.

, Picao

R.C.

, Moreira

B.M.

, and Bonelli

R.R.

2015. Widespread distribution of CTX-M and plasmid-mediated AmpC beta-lactamases in Escherichia coli from Brazilian chicken meat. Mem. Inst. Oswaldo Cruz., 110:249–254.

Brenwald

N.P.

, Jevons

, Andrews

, Ang

, and Fraise

A.P.

2005. Disc methods for detecting AmpC {beta}-lactamase-producing clinical isolates of Escherichia coli and Klebsiella pneumoniae. J. Antimicrob. Chemother., 56:600–601.

Campana

E.H.

, Barbosa

P.P.

, Fehlberg

L.C.

, and Gales

A.C.

2013. Frequency of plasmid-mediated AmpC in Enterobacteriaceae isolated in a Brazilian Teaching Hospital. Braz. J. Microbiol., 44:477–480.

Cejas

, Fernandez Canigia

, Quinteros

, Giovanakis

, Vay

, Lascialandare

, Mutti

, Pagniez

, Almuzara

, Gutkind

, et al. 2012. Plasmid-Encoded AmpC (pAmpC) in Enterobacteriaceae: epidemiology of microorganisms and resistance markers. Rev. Argent. Microbiol., 44:182–186.

[CLSI] Clinical and Laboratory Standards Institute. 2012. Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard—Eleventh Edition. CLSI document M02-A11. CLSI, Wayne, PA.

[CLSI] Clinical and Laboratory Standards Institute. 2014. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement. CLSI document M100-S24. CLSI, Wayne, PA.

Corvec

, Prodhomme

, Giraudeau

, Dauvergne

, Reynaud

, and Caroff

2007. Most Escherichia coli strains overproducing chromosomal AmpC beta-lactamase belong to phylogenetic group A. J. Antimicrob. Chemother., 60:872–876.

Coudron

P.E.

2005. Inhibitor-based methods for detection of plasmid-mediated AmpC beta-lactamases in Klebsiella spp., Escherichia coli, and Proteus mirabilis. J. Clin. Microbiol., 43:4163–4167.

10.

Coudron

P.E.

, Moland

E.S.

, and Thomson

K.S.

2000. Occurrence and detection of AmpC beta-lactamases among Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis isolates at a veterans medical center. J. Clin. Microbiol., 38:1791–1796.

11.

Dallenne

, Da Costa

, Decre

, Favier

, and Arlet

2010. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother., 65:490–495.

12.

da Silva Dias

R.C.

, Borges-Neto

A.A.

, D'Almeida Ferraiuoli

G.I.

, de-Oliveira

M.P.

, Riley

L.W.

, and Moreira

B.M.

2008. Prevalence of AmpC and other beta-lactamases in enterobacteria at a large urban university hospital in Brazil. Diagn. Microbiol. Infect. Dis., 60:79–87.

13.

Denisuik

A.J.

, Lagace-Wiens

P.R.

, Pitout

J.D.

, Mulvey

M.R.

, Simner

P.J.

, Tailor

, Karlowsky

J.A.

, Hoban

D.J.

, Adam

H.J.

, and Zhanel

G.G.

2013. Molecular epidemiology of extended-spectrum beta-lactamase-, AmpC beta-lactamase- and carbapenemase-producing Escherichia coli and Klebsiella pneumoniae isolated from Canadian hospitals over a 5 year period: CANWARD 2007–2011. J. Antimicrob. Chemother., 68 Suppl 1:i57–i65.

14.

Ejrnaes

, Sandvang

, Lundgren

, Ferry

, Holm

, Monsen

, Lundholm

, and Frimodt-Moller

2006. Pulsed-field gel electrophoresis typing of Escherichia coli strains from samples collected before and after pivmecillinam or placebo treatment of uncomplicated community-acquired urinary tract infection in women. J. Clin. Microbiol., 44:1776–1781.

15.

[EUCAST] European Committee on Antimicrobial Susceptibility Testing. 2013. EUCAST guidelines for detection of resistance mechanisms and specific resistances of clinical and/or epidemiological importance. EUCAST, Basel, Switzerland.

16.

Giles

W.P.

, Benson

A.K.

, Olson

M.E.

, Hutkins

R.W.

, Whichard

J.M.

, Winokur

P.L.

, and Fey

P.D.

2004. DNA sequence analysis of regions surrounding bla_CMY-2 from multiple Salmonella plasmid backbones. Antimicrob. Agents Chemother., 48:2845–2852.

17.

Gude

M.J.

, Seral

, Saenz

, Cebollada

, Gonzalez-Dominguez

, Torres

, and Castillo

F.J.

2013. Molecular epidemiology, resistance profiles and clinical features in clinical plasmid-mediated AmpC-producing Enterobacteriaceae. Int. J. Med. Microbiol., 303:553–557.

18.

Honore

, Nicolas

M.H.

, and Cole

S.T.

1986. Inducible cephalosporinase production in clinical isolates of Enterobacter cloacae is controlled by a regulatory gene that has been deleted from Escherichia coli. EMBO J., 5:3709–3714.

19.

Izdebski

, Baraniak

, Fiett

, Adler

, Kazma

, Salomon

, Lawrence

, Rossini

, Salvia

, Vidal Samso

, et al. 2013. Clonal structure, extended-spectrum beta-lactamases, and acquired AmpC-type cephalosporinases of Escherichia coli populations colonizing patients in rehabilitation centers in four countries. Antimicrob. Agents Chemother., 57:309–316.

20.

Jacoby

G.A.

2009. AmpC beta-lactamases. Clin. Microbiol. Rev., 22:161–182.

21.

Jacoby

G.A.

, Walsh

K.E.

, and Walker

V.J.

2006. Identification of extended-spectrum, AmpC, and carbapenem- hydrolyzing beta-lactamases in Escherichia coli and Klebsiella pneumoniae by disk tests. J. Clin. Microbiol., 44:1971–1976.

22.

Leal

A.L.

, Cortes

J.A.

, Arias

, Ovalle

M.V.

, Saavedra

S.Y.

, Buitrago

, Escobar

J.A.

, Castro

B.E.

, and Grebo . 2013. Emergence of resistance to third generation cephalosporins by Enterobacteriaceae causing community-onset urinary tract infections in hospitals in Colombia. Enferm. Infecc. Microbiol. Clin., 31:298–303.

23.

Lee

, Hong

S.G.

, Park

Y.J.

, Lee

H.S.

, Song

, Jeong

, Yong

, and Chong

2005. Evaluation of phenotypic screening methods for detecting plasmid-mediated AmpC beta-lactamases-producing isolates of Escherichia coli and Klebsiella pneumoniae. Diagn. Microbiol. Infect. Dis., 53:319–323.

24.

Maiwald

2004. Broad-range PCR for detection and identification of bacteria. In Persing

, (ed.), Molecular Microbiology Diagnostic Principles and Practice. American Society for Microbiology, Washington, DC, pp. 379–390.

25.

Mammeri

, Guillon

, Eb

, and Nordmann

2010. Phenotypic and biochemical comparison of the carbapenem-hydrolyzing activities of five plasmid-borne AmpC beta-lactamases. Antimicrob Agents Chemother., 54:4556–4560.

26.

Marcano

, De Jesus

, Hernandez

, and Torres

2011. Frequency of enzymes associated with reduced sensitivity to beta-lactam antibiotics in enterobacteria isolates, Caracas, Venezuela. Rev. Panam. Salud Publica., 30:529–534.

27.

Mata

, Miro

, Alvarado

, Garcillan-Barcia

M.P.

, Toleman

, Walsh

T.R.

, de la Cruz

, and Navarro

2012. Plasmid typing and genetic context of AmpC beta-lactamases in Enterobacteriaceae lacking inducible chromosomal ampC genes: findings from a Spanish hospital 1999–2007. J. Antimicrob. Chemother., 67:115–122.

28.

Mulvey

M.R.

, Bryce

, Boyd

D.A.

, Ofner-Agostini

, Land

A.M.

, Simor

A.E.

, and Paton

2005. Molecular characterization of cefoxitin-resistant Escherichia coli from Canadian hospitals. Antimicrob. Agents Chemother., 49:358–365.

29.

Olsson

, Bergstrom

, Lindberg

F.P.

, and Normark

1983. ampC beta-lactamase hyperproduction in Escherichia coli: natural ampicillin resistance generated by horizontal chromosomal DNA transfer from Shigella. Proc. Natl. Acad. Sci. U S A., 80:7556–7560.

30.

Ortega

, Oteo

, Aranzamendi-Zaldumbide

, Bartolome

R.M.

, Bou

, Cercenado

, Conejo

M.C.

, Gonzalez-Lopez

J.J.

, Marin

, Martinez-Martinez

, et al. 2012. Spanish multicenter study of the epidemiology and mechanisms of amoxicillin-clavulanate resistance in Escherichia coli. Antimicrob. Agents Chemother., 56:3576–3581.

31.

Pavez

, Neves

, Dropa

, Matte

M.H.

, Grinbaum

R.S.

, Elmor de Araujo

M.R.

, Mamizuka

E.M.

, and Lincopan

2008. Emergence of carbapenem-resistant Escherichia coli producing CMY-2-type AmpC beta-lactamase in Brazil. J. Med. Microbiol., 57:1590–1592.

32.

Peirano

, Agerso

, Aarestrup

F.M.

, dos Reis

E.M.

, and dos Prazeres Rodrigues

2006. Occurrence of integrons and antimicrobial resistance genes among Salmonella enterica from Brazil. J. Antimicrob. Chemother., 58:305–309.

33.

Peter-Getzlaff

, Polsfuss

, Poledica

, Hombach

, Giger

, Bottger

E.C.

, Zbinden

, and Bloemberg

G.V.

2011. Detection of AmpC beta-lactamase in Escherichia coli: comparison of three phenotypic confirmation assays and genetic analysis. J. Clin. Microbiol., 49:2924–2932.

34.

Ribot

E.M.

, Fair

M.A.

, Gautom

, Cameron

D.N.

, Hunter

S.B.

, Swaminathan

, and Barrett

T.J.

2006. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog. Dis., 3:59–67.

35.

Ruppe

, Bidet

, Verdet

, Arlet

, and Bingen

2006. First detection of the Ambler class C 1 AmpC beta-lactamase in Citrobacter freundii by a new, simple double-disk synergy test. J. Clin. Microbiol., 44:4204–4207.

36.

Tan

T.Y.

, Ng

L.S.

, He

, Koh

T.H.

, and Hsu

L.Y.

2009. Evaluation of screening methods to detect plasmid-mediated AmpC in Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis. Antimicrob. Agents Chemother., 53:146–149.

37.

Tenover

F.C.

, Arbeit

R.D.

, Goering

R.V.

, Mickelsen

P.A.

, Murray

B.E.

, Persing

D.H.

, and Swaminathan

1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol., 33:2233–2239.

38.

Woodford

, Reddy

, Fagan

E.J.

, Hill

R.L.

, Hopkins

K.L.

, Kaufmann

M.E.

, Kistler

, Palepou

M.F.

, Pike

, Ward

M.E.

, et al. 2007. Wide geographic spread of diverse acquired AmpC beta-lactamases among Escherichia coli and Klebsiella spp. in the UK and Ireland. J. Antimicrob. Chemother., 59:102–105.

39.

Yagi

, Wachino

, Kurokawa

, Suzuki

, Yamane

, Doi

, Shibata

, Kato

, Shibayama

, and Arakawa

2005. Practical methods using boronic acid compounds for identification of class C beta-lactamase-producing Klebsiella pneumoniae and Escherichia coli. J. Clin. Microbiol., 43:2551–2558.

40.

Yilmaz

N.O.

, Agus

, Bozcal

, Oner

, and Uzel

2013. Detection of plasmid-mediated AmpC beta-lactamase in Escherichia coli and Klebsiella pneumoniae. Indian J. Med. Microbiol., 31:53–59.