Tigecycline Susceptibility and Molecular Resistance Mechanisms Among Clinical Klebsiella pneumoniae Strains Isolated During Non-Tigecycline Treatment

Abstract

Tigecycline is one of the few therapeutic options that are available for treating serious clinical infections. However, tigecycline nonsusceptible Enterobacteriaceae has emerged recently in China. In this study, a total of 28 clinical Klebsiella pneumoniae isolates that were not previously exposed to tigecycline were collected and confirmed for tigecycline minimum inhibitory concentrations (MICs) using standard broth microdilution tests. To elucidate the mechanisms underlying molecular resistance to tigecycline, the expression levels of efflux pumps AcrAB and OqxAB and their regulators RamA, MarA, RarA, and SoxS were determined by quantitative polymerase chain reaction. The expression levels of the genes acrB, ramA, marA, and soxS were statistically different in different MIC groups (p < 0.05). Sequence analysis of the acrR and ramR genes revealed several nonsynonymous mutations in the nine resistance isolates. The values of MIC in these isolated strains with ramR mutations were significantly higher than those without ramR mutation (p = 0.029). Moreover, mutations in the ramR gene led to the overexpression of RamA. These results indicated that the mutation of the ramR gene through the upregulated expression of RamA contributed to tigecycline resistance and that several of the newly identified types of mutations in ramR and acrR were not previously reported in K. pneumoniae clinical isolates.

Introduction

Tigecycline, a glycylcycline with expanded broad-spectrum antibiotic activity, was approved by the US Food and Drug Administration (FDA) in 2005.¹ It acts as a protein synthesis inhibitor in bacteria by binding to the 30S subunit of ribosomes and interfering with the A site of the 16S rRNA.^2,3 It is the preferred treatment for complicated skin and skin structure infections and serious intra-abdominal infections. However, tigecycline nonsusceptibility was recently reported in various species, such as Acinetobacter baumannii, Escherichia coli, Salmonella enterica, Enterobacter cloacae, Enterobacter aerogenes, and Klebsiella pneumoniae, and most of these isolates were encountered during tigecycline therapy.^4–9

The mechanisms underlying tigecycline resistance are not well understood. Previous studies demonstrated that the reduced susceptibility observed in Enterobacter spp. may be due to the overexpression of resistance-nodulation-division (RND) family multidrug efflux pumps, such as AcrAB-TolC.^7,10 OqxAB and KpgABC, which are recently identified efflux pump systems in K. pneumoniae, may represent supplementary nonsusceptibility mechanisms for RND-type efflux pump.^11,12

The expression of AcrAB-TolC efflux pump is activated by several AraC-type transcriptional regulators, such as RamA, MarA, RarA, and SoxS, which interact with the promoter in the operon region, thereby conferring low-level resistance to a variety of antibiotics and disinfectants.^10,13–15 In addition, AcrAB expression is regulated by its local repressor AcrR, and mutations in these genes may participate in tigecycline resistance. ramR, marR, and soxR code for the local transcriptional repressors RamA, MarA, and SoxS, respectively. Mutations in these genes can lead to excessive transcriptional activation, resulting in the upregulation of the efflux pump in Enterobacteriaceae.^16–18

In this study, we collected clinical K. pneumoniae strains isolated in patients who had not previously been exposed to tigecycline and identified their tigecycline susceptibility profiles. The purpose of this study was to investigate whether similar or other molecular resistance mechanisms existed in these strains.

Material and Methods

Bacterial strains and growth conditions

From January 2012 to January 2014, 582 nonduplicate K. pneumoniae isolates from various clinically infected samples that had not previously been exposed to tigecycline were collected at Dalian Medical University Affiliated Hospitals (First Affiliated Hospital of Dalian Medical University, Second Affiliated Hospital of Dalian Medical University, and Dalian Municipal Central Hospital Affiliated of Dalian Medical University). All isolates were identified using the VITEK-2 antibiotic susceptibility testing system (BioMerieux). E. coli ATCC 25922 and K. pneumoniae ATCC 13883 were used as reference strains. The propagation of all strains was carried out in the Luria-Bertani (LB) medium at 37°C.

Tigecycline susceptibility test

Susceptibility of the isolates was determined using the Kirby–Bauer method (tigecycline [TGC], Oxoid; breakpoint for TGC: disk diffusion zone diameters ≥19 mm susceptible, 15–18 mm intermediate, and ≤14 mm resistant) and minimum inhibitory concentrations (MICs) of tigecycline (Sigma-Aldrich). The MIC of tigecycline was analyzed using the standard broth microdilution method in accordance with the Clinical and Laboratory Standards Institute (CLSI) guidelines (MIC ≤2.0 μg/mL is susceptible, 4.0 μg/mL is intermediate, and ≥8 μg/mL is resistant).¹⁹ E. coli ATCC 25922 was used as the control strain.

Quantitative real-time polymerase chain reaction

Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to determine the expression levels of the efflux pumps AcrAB and OqxAB and their transcriptional regulators RamA, MarA, RarA, and SoxS. The primers used for real-time PCR are listed in Table 1. First, total bacterial RNA was extracted using the Total RNA Isolation Purification Extraction Kit (Sangon). The yield and quality of RNA were determined using a NanoDrop 2000C (Thermo). cDNA was synthesized using the PrimeScript RT Reagent Kit (TaKaRa). Then, real-time PCR was performed using the SYBR^® Premix Ex Taq™ II Kit (TaKaRa) on the Stratagene Mx3005P qPCR System (Agilent Technologies), with 40 cycles of 5 s at 95°C and 34 s at 60°C. The experiments were carried out in triplicate.

Table 1.

Primers Used for Real-Time PCR Studies and PCR Amplification

Primer	Product	Sequence (5′-3′)	Purpose	Product length (bp)	Annealing temperature (°C)
rrsE-qPCR-F	rrs-E	TTGACGTTACCCGCAGAAGAA	qRT-PCR	71	60
rrsE-qPCR-R		GCTTGCACCCTCCGTATTACC
acrA-qPCR-F	acrA	GTCCGGCACGCTGGA	qRT-PCR	69	60
acrA-qPCR-R		ATAGCGCGTAGCGTGATTGA
acrB-qPCR-F	acrB	AGCTTAACGCCTCGATCAT	qRT-PCR	158	60
acrB-qPCR-R		AAACTTCGCCACTACGTCATA
oqxA-qPCR-F	oqx-A	GCGTCTCGGGATACATTGAT	qRT-PCR	482	60
oqxA-qPCR-R		GGCGAGGTTTTGATAGTGGA
oqxB-qPCR-F	oqx-B	CGAAGAAAGACCTCCCTACCC	qRT-PCR	240	60
oqxB-qPCR-R		CGCCGCCAATGAGATACA
ramA-qPCR-F	ramA	GCATCAACCGCTGCGTATT	qRT-PCR	66	60
ramA-qPCR-R		CGTTGCAGATGCCATTTCG
rarA-qPCR-F	rarA	AACAGAGCGGCTGATACTCC	qRT-PCR	102	60
rarA-qPCR-R		ATTGCCCTCGGCTTTGAC
marA-qPCR-F	marA	TAATGACGCCATCACTATCCA	qRT-PCR	159	60
marA-qPCR-R		ATGTACTGGCCGAGGGAATG
soxS-qPCR-F	soxS	TAGTCGCCAGAAAGTCAGGAT	qRT-PCR	189	60
soxS-qPCR-R		AGAAGGTTTGCTGCGAGACG
ramR-F	ramR	AGTGTTTCCGGCGTCATTAG	Mutation detection	701	55
ramR-R		AGTCGTCAAGACGATTTTCAATTTT
acrR-F	acrR	ACGTAACCTCTGTAAAGTCAT	Mutation detection	678	55
acrR-R		TTAAGCTGACAAGCTCTCCG
rpsJ-F	rpsJ	AGTAACGCGGTTTGCTTC	Mutation detection	602	55
rpsJ-R		ACAGCCGGTTCGATATGA

bp, base pair; qPCR, quantitative reversion transcription polymerase chain reaction.

The expression of each target gene was normalized to that of a housekeeping gene (16S rRNA, rrsE). The expression levels of AcrAB, OqxAB, RamA, MarA, RarA, and SoxS were determined and found to be onefold greater than that of K. pneumoniae ATCC 13883 (expression = 1), which served as the reference strain of tigecycline-susceptible strains (MIC = 0.5 μg/mL). Data were analyzed using the Agilent MxPro software based on the 2^−ΔΔCt method.

Efflux inhibitory experiment of PAβN

Fresh cation-adjusted Mueller-Hinton Broth (MHB, <12 h old) both with and without 50 μM Phe-Arg-β-Naphthylamide (PAβN, Sigma-Aldrich) was prepared and inoculated with 0.5 McFarland. The effect of efflux inhibitor PAβN on the activity of the efflux pump was determined by MIC assays using the broth microdilution method.²⁰ The MIC values were established by conducting the experiments in triplicate. A significant inhibition effect on the efflux pump was observed because the MIC values decreased fourfold or greater in the presence of PAβN.

Identification of mutations in acrR, ramR, and rpsJ

PCR and sequence analyses were performed to identify the mutations in the acrR, ramR, and rpsJ codons of the S10 ribosomal protein gene. The gene fragments of acrR, ramR, and rpsJ in clinical K. pneumoniae were amplified and compared with the reference sequence of K. pneumoniae subsp. pneumoniae MGH 78578 (CP000647). The primers designed for PCR are listed in Table 1.

Statistical analysis

The relationship between the tigecycline MICs and gene expression levels was analyzed using the SPSS 13.0 Statistics software. The gene expression levels of different MIC groups were described using the mean and standard deviation (SD). According to the normality test, the expression levels of RamA appeared to be a normal distribution, so an analysis of variance (ANOVA) was performed. Because the expression levels of AcrA, AcrB, OqxA, OqxB, RarA, MarA, and SosX showed non-normal distributions, the Kruskal–Wallis test was adopted as the post-hoc test. The relationship between mutations of the local repressor genes ramR, acrR, and tigecycline MICs was analyzed by Student's t-test. A p-value less than 0.05 was considered statistically significant.

Results

Tigecycline susceptibility

Of the 582 K. pneumoniae isolates that were not exposed to tigecycline during the study period, only 20 isolates were not susceptible to tigecycline (nonsusceptibility rate is 3.44%). Eight ordinary clinical strains that were susceptible to tigecycline were designated as the negative control. Therefore, in total, 28 clinical K. pneumoniae isolates were examined in this study. Among these isolates, the range of tigecycline MICs was 0.50–32 μg/mL, with a MIC₅₀ of 8 μg/mL and a MIC₉₀ of 16 μg/mL. The tigecycline susceptibility profiles of the 28 clinical K. pneumoniae isolates are presented in Table 2.

Table 2.

MICs of Tigecycline in the Absence or Presence of PAβN and Mutations of Local Repressor Genes ramR and acrR in 28 Clinical Klebsiella pneumoniae Isolates

		MIC (μg/mL) ^a		Mutations of local repressor genes
Numbers of stains	K-B (cm)	TGC	TGC+PAβN	ramR	acrR
K634	16	4	2	ND	ND
K638	14	16	2	ND	G121Stop
K680	17	8	8	ND	G121V+E122K+M123Stop
K746	16	8	8	ND	G121V+E122K+M123Stop
K784	12.5	16	16	ND	ND
K803	15	8	8	E175D+I177T+A178D+A193S	G121V+E122K+M123Stop
K805	18	16	2	ND	ND
K839	16	4	4	ND	ND
K860	13	32	32	H103Q+Q122Stop	G121V+E122K+M123Stop
K886	14	8	8	ND	ND
K898	16	8	8	E190Stop	ND
K977	12	16	8	A sequence of “TGATGCGCTCGC” deletion	ND
K981	12	8	4	A sequence of “TGATGCGCTCGC” deletion	ND
K1087	18	8	8	ND	ND
K1107	18	8	8	ND	ND
K1186	14	16	4	L156V+F181Stop	ND
K1208	0	16	4	ND	ND
K1352	16.5	8	8	ND	ND
K1411	13	16	16	ND	ND
K1531	12	16	16	ND	ND
K309872	22	2	2	ND	ND
K1550	20	2	2	ND	ND
K1147	19	2	2	ND	ND
K619	21	2	2	ND	ND
K311388	21	1	1	ND	ND
K1438	21	2	2	ND	ND
K812	22	1	1	ND	ND
K1440	21	0.5	0.5	ND	ND

MIC: Determined by the broth microdilution method. ATCC25922: quality control strain, TGC+PAβN: tigecycline with PAβN.

K-B, Kirby–Bauer; MIC, minimum inhibitory concentration; ND, not detected.

Gene expression and relationship with tigecycline MICs

Target gene expression analysis was performed for 28 clinical K. pneumoniae isolates and compared with K. pneumoniae ATCC 13883 (tigecycline susceptible). Real-time PCR analysis showed a uniformly high gene expression of acrB (1.48 to 257.21 fold) and ramA (1.30 to 212.48 fold) of the RamA/AcrAB pathway in seven isolates (K860, K898, K1087, K1186, K1352, K1411, K1531), whereas eight isolates (K634, K746, K803, K898, K1087, K1186, K1411, K1531) exhibited simultaneous overexpression of the genes oqxB (1.74 to 16.36 fold) and rarA (1.36 to 4.04 fold). Among them, K1186 and K1531 showed upregulation of the oqxA gene (2.30 fold, 15.18 fold). In addition, the marA and soxS genes were differentially expressed among the 28 clinical strains (Figs. 1 and 2).

FIG. 1.

Relative fold gene expressions of efflux pumps AcrAB and OqxAB in 28 clinical Klebsiella pneumoniae isolates. (A) Overexpression of AcrA in K1208 (2.12-fold) and K1531 strains (1.35-fold). (B) Overexpression of AcrB in 13 strains (1.38 to 257.21 fold). (C) Overexpression of OqxA in four strains (2.30 to 24.37 fold). (D) Overexpression of OqxB in 14 strains (1.22 to 131.22 fold).

FIG. 2.

Relative fold gene expressions of transcriptional regulators RamA, RarA, MarA, and SoxS in 28 clinical K. pneumoniae isolates. (A) Upregulation of ramA gene in 11 strains (1.30 to 212.48 fold). (B) Upregulation of rarA in nine strains (1.36 to 4.04 fold). (C) Upregulation of marA in 16 strains (1.21 to 750.37 fold). (D) Upregulation of soxS in 10 strains (1.23 to 128.25 fold). Of the 28 isolates, 7 isolates (K860, K898, K1087, K1186, K1352, K1411, K1531) overexpressed acrB (257.21 fold, 3.01 fold, 2.15 fold, 1.76 fold, 1.48 fold, 4.85 fold, 6.01 fold, respectively) and ramA (212.48 fold, 2.72 fold, 1.30 fold, 2.85 fold, 4.91 fold, 6.60 fold, 8.73 fold, respectively) genes. Uniformly high expression of oqxB (5.53 fold, 3.01 fold, 2.22 fold, 10.13 fold, 1.99 fold, 1.74 fold, 16.36 fold, 11.03 fold, respectively) and rarA genes (1.37 fold, 3.27 fold, 1.37 fold, 4.04 fold, 3.74 fold, 1.36 fold, 1.93 fold, 3.92 fold, respectively) in 8 isolates (K634, K746, K803, K898, K1087, K1186, K1411, K1531).

The gene expression levels of different MIC groups are presented in Table 3. According to the ANOVA results, there was a statistically significant association between ramA expression and tigecycline MICs (p = 0.033). The Kruskal–Wallis test indicated that the expression of the acrB, marA, and soxS genes was statistically significantly different in different MIC groups (p = 0.005, p = 0.016, and p = 0.023, respectively). However, the levels of acrB, marA, soxS, and ramA gene expression were not significantly different between tigecycline-resistant isolates (MIC ≥4 μg/mL) and tigecycline-susceptible isolates (MIC <4 μg/mL, p > 0.05, data not shown).

Table 3.

Relationships Between Gene Expression Levels and Tigecycline MICs in 28 Clinical K. pneumoniae Isolates

	Relative expression level ( \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document} $${\overline {x}}$$ \end{document} ± SD) ^a
Gene	MIC <4 μg/mL	MIC = 4 μg/mL	MIC = 8 μg/mL	MIC = 16 μg/mL	MIC = 32 μg/mL	p^b
acrA	2.14 ± 3.86	0.22 ± 0.03	0.32 ± 0.34	0.55 ± 0.77	0.11 ± 0.04	0.755
acrB	0.18 ± 0.37	1.26 ± 0.56	1.51 ± 1.07	2.35 ± 2.02	257.21 ± 4.48	0.005^c
oqxA	2.25 ± 4.07	0.04 ± 0.03	0.17 ± 0.26	40.98 ± 107.93	24.37 ± 6.11	0.074
oqxB	2.71 ± 3.77	3.66 ± 2.64	2.46 ± 3.00	4.41 ± 5.92	131.22 ± 16.68	0.257
ramA	1.17 ± 2.41	0.70 ± 0.11	3.32 ± 3.65	3.54 ± 3.54	212.48 ± 69.10	0.033^c
rarA	1.88 ± 2.23	1.19 ± 0.26	3.63 ± 2.14	1.76 ± 1.49	0.17 ± 0.03	0.173
marA	1.19 ± 3.16	1.58 ± 0.44	1.92 ± 1.46	4.28 ± 3.88	750.37 ± 90.88	0.016^c
soxS	0.29 ± 0.58	1.58 ± 1.01	1.26 ± 1.09	2.21 ± 2.98	128.25 ± 11.30	0.023^c

Relative expression compared with ATCC13883 (expression = 1), results are means of 3 runs ± SDs. MIC of tigecycline.

Expression levels of ramA appear to be a normal distribution, expression levels of acrA, acrB, oqxA, oqxB, rarA, marA, and sosX appear to be non-normal distribution.

p < 0.05.

SD, standard deviation.

Efflux pump inhibition assay

The tigecycline MIC values of 28 clinical K. pneumoniae isolates both with and without the efflux pump inhibitor (EPI) PAβN are presented in Table 2. Exposure to tigecycline with PAβN showed a fourfold reduction in MIC in four isolates (K638, K805, K1186, K1208), a twofold reduction in three strains (K634, K977, K981), and no change was observed in the eight tigecycline-sensitive isolates.

Mutations of ramR, acrR, and rpsJ and the relationship with tigecycline MICs

The amplified acrR, ramR, and rpsJ sequences in 28 clinical K. pneumoniae isolates were compared with the reference sequence of K. pneumoniae subsp. pneumoniae MGH 78578 (GenBank Accession No. CP000647).

Mutations in the acrR and ramR genes were observed in nine of the nonsusceptible isolates (Table 2). Mutations in the ramR gene were observed in six isolates. Two isolates (K977, K981) harbored the sequence deletion “TGATGCGCTCGC,” which led to a frameshift mutation in the ramR gene. K803 harbored four substitutions, which led to amino acid exchange in the coding regions of ramR (E175D, I177T, A178D, and A193S [protein]). The synthesis of RamR protein was prematurely terminated by a stop codon in the other three strains (K898, K860, K1186). The overexpression of ramA could have been due to the mutations of ramR in these strains. The range of tigecycline MICs among strains with ramR mutation was 8–32 μg/mL, with an MIC₅₀ of 12 μg/mL and an MIC₉₀ of 32 μg/mL. The MIC values in these strains with ramR mutation were significantly higher than those of other strains without ramR mutation (p = 0.029) (Table 4).

Table 4.

Relationships Between Mutations of Local Repressor Genes ramR, acrR, and Tigecycline MICs in 28 Clinical K. pneumoniae Isolates

	MICs ( \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document} $${\overline {x}}$$ \end{document} ± SD, μg/mL) ^a
Repressor gene	Mutation	Non-mutation	t	p
ramR	14.67 ± 9.35	7.48 ± 5.95	2.316	0.029^b
acrR	14.40 ± 10.43	7.85 ± 6.08	1.916	0.066
ramR or acrR	13.33 ± 8.00	6.97 ± 6.08	2.335	0.028^b

MIC of tigecycline.

p < 0.05.

Moreover, mutations in the acrR gene were observed in five resistant isolates (K638, K680, K746, K803, K860). Four isolates (K680, K746, K803, K860) harbored point mutations and a premature stop codon (G121V+E122K+M123Stop), which led to amino acid exchanges in the coding region of acrR. One isolate (K638) harbored a point mutation leading to a premature stop codon, which resulted in a predicted truncated AcrR. The MIC value in these isolates harboring the mutant acrR gene was higher than that in nonmutant isolates, but the difference was not significant (p = 0.066).

The tigecycline MICs of the two resistance strains (K803 and K860) with mutations both in ramR and acrR were 32 and 8 μg/mL, respectively. However, no mutation was detected in the rpsJ gene that codes for ribosomal protein S10.

Discussion

K. pneumoniae is an important pathogen that causes nosocomial infections, urinary tract infections, pneumonia, bacteremia, and liver abscess.²¹ On exposure to several antibiotics, these strains rapidly acquire resistance through different molecular mechanisms. Recently, tigecycline has been reserved for use in situations when alternative treatments are not suitable.³ As reported previously, susceptible strains of K. pneumoniae with decreasing susceptibility to tigecycline are commonly isolated during tigecycline therapy.^12,22–24 Cross-resistance to tigecycline could be indirectly attributed to the use of other antibiotics, which are transported by the same chromosomally encoded efflux pumps in clinical isolates of K. pneumoniae.²⁵ However, the pathway and molecular-resistant mechanisms underlying cross-resistance are not yet clear.

In this study, we identified the susceptibility profile of tigecycline in 28 clinical K. pneumoniae isolates that had not previously been exposed to tigecycline in China. Based on CLSI guidelines, 20 isolates were not susceptible to tigecycline, and these were determined to be multidrug resistant (data not shown). RND-type efflux pump and transcriptional activators have been linked to the nonsusceptibility of tigecycline in a variety of Enterobacteriaceae. However, our real-time PCR results demonstrated that the differences in the expression of AcrAB, OqxAB, and RamA, RarA, SoxS, RarA between tigecycline-resistant and tigecycline-susceptible isolates were not significant, suggesting that the resistance might be due to efflux pumps other than AcrAB/RamA and OqxAB/RarA, such as KpgABC.

EPIs have been used to reduce resistance patterns due to efflux pump activation.²⁶ To evaluate the role of efflux pumps in tigecycline resistance of K. pneumoniae, we used a pump inhibition assay. We found that PAβN significantly restored tigecycline susceptibility in four strains. However, no significant reduction of tigecycline MICs was observed in the other 24 isolates, suggesting that PAβN was not effective. One possible explanation is that EPIs have different specificities, which interfere with efflux pump activity through different modes of action.²⁷ Our finding also indicated that mechanisms other than active efflux systems contribute to tigecycline resistance in clinical K. pneumoniae isolates.

The current study hypothesized that the use of other antibiotics might cause molecular-resistant mechanisms attributed to RND-type or other transporters that mediate a decrease in tigecycline activity. Studies by Hentschke et al. reported that mutations in the ramR gene led to the overexpression of RamA, causing a reduced susceptibility to tigecycline in K. pneumoniae and S. enterica.^16,28 In K. pneumoniae, the ramR gene is located upstream of the ramA gene, in a head-to-head arrangement; because ramR is a negative regulator of ramA, mutations in ramR result in the overexpression of ramA. The entire genome sequence for five K. pneumoniae strains belonging to the sequence type 512 (ST512) was determined, and it was found that a mutation or insertion of mobile elements in the ramR gene occurred in the tigecycline-resistant strain.¹⁸

Sheng et al. recently underscored the key role of RamA in tigecycline non-susceptible isolates by identifying several mutations in the acrR gene that led to amino acid substitutions in the AcrR protein.²⁴ Sequencing of ramR and acrR among the 28 clinical K. pneumoniae isolates revealed that frameshift deletions of fragment TGATGCGCTCGC spanning positions 254 to 265 in ramR gene (located in strains K977, K981), E175→D, I177→T, A178→D, and A193→S, were harbored in the ramR gene (located in strain K803), G121→V, E122→K of coding region of acrR gene or harbored premature stop codon associated with producing an amino acid substitution in AcrR protein.

Based on the real-time PCR result, K860, K898, and K1186 caused the overexpression of acrB by upregulating ramA. Moreover, strain K860 harbored missense and nonsense mutations in acrR, which led to the efflux pump AcrB-mediated resistance to tigecycline. To the best of our knowledge, this report is the first to identify these mutations in ramR and acrR in tigecycline resistance. Further experiments are ongoing to determine whether all of the mutation types reported here are detrimental to RamR or AcrR function.

Nonetheless, the above resistant regulatory pathways failed to explain clearly in three strains (K784, K805, K1107) of the tigecycline-nonsusceptible clinical samples, where the MICs of K805 and K1107 strains were significantly inhibited by PAβN and exhibited a low-level expression of efflux pump genes that was similar to other mechanisms contributing to the development of tigecycline resistance. Therefore, further studies need to elucidate the mechanisms underlying tigecycline resistance in these isolates, including determining the expression level of the efflux pump KpgABC. In addition, we need to identify other possible regulatory mechanisms of tigecycline resistance through transcriptome sequencing.

In conclusion, we identified a key role of RamA, through mutations of ramR and acrR, in strains that were not susceptible to tigecycline. Moreover, several types of mutations in ramR and acrR were identified, which were not reported previously, thus revealing possible molecular mechanisms that contribute to the development of tigecycline nonsusceptibility.

Footnotes

Acknowledgments

This work was supported by grant No. 81401697 from the National Natural Science Foundation of China, Grant no. 2015 M571314 from the China Postdoctoral Science Foundation, and Grant no.201501159 from the Doctoral Scientific Research Foundation of Liaoning Province.

Disclosure Statement

No competing financial interests exist.

References

Doan

T.L.

, Fung

H.B.

, Mehta

, and Riska

P.F.

2006. Tigecycline: a glycylcycline antimicrobial agent. Clin. Ther., 28:1079–1106.

Olson

M.W.

, Ruzin

, Feyfant

, Rush

T.S.

3rd. , O'Connell

, and Bradford

P.A.

2006. Functional, biophysical, and structural bases for antibacterial activity of tigecycline. Antimicrob. Agents Chemother., 50:2156–2166.

Pankey

G.A.

2005. Tigecycline. J. Antimicrob. Chemother., 56:470–480.

Deng

, Zhu

M.H.

, Li

J.J.

, Bi

, Sheng

Z.K.

, Hu

F.S.

, Zhang

J.J.

, Chen

, Xue

X.W.

, Sheng

J.F.

, and Li

L.J.

2014. Molecular epidemiology and mechanisms of tigecycline resistance in clinical isolates of Acinetobacter baumannii from a Chinese university hospital. Antimicrob. Agents Chemother., 58:297–303.

Linkevicius

, Sandegren

, and Andersson

D.I.

2013. Mechanisms and fitness costs of tigecycline resistance in Escherichia coli. J. Antimicrob. Chemother., 68:2809–2819.

Akiyama

, Presedo

, and Khan

A.A.

2013. The tetA gene decreases tigecycline sensitivity of Salmonella enterica isolates. Int. J. Antimicrob. Agents., 42:133–140.

Veleba

, De Majumdar

, Hornsey

, Woodford

, and Schneiders

2013. Genetic characterization of tigecycline resistance in clinical isolates of Enterobacter cloacae and Enterobacter aerogenes. J. Antimicrob. Chemother., 68:1011–1018.

Spanu

, De Angelis

, Cipriani

, Pedruzzi

, D'Inzeo

, Cataldo

M.A.

, Sganga

, and Tacconelli

2012. In vivo emergence of tigecycline resistance in multidrug-resistant Klebsiella pneumoniae and Escherichia coli. Antimicrob. Agents Chemother., 56:4516–4518.

Hua

, Chen

, Li

, Feng

, Ruan

, and Yu

2014. Complete genome sequence of Klebsiella pneumoniae sequence type 17, a multidrug-resistant strain isolated during tigecycline treatment. Genome Announc., 2:e01337–e14.

10.

Ruzin

, Visalli

M.A.

, Keeney

, and Bradford

P.A.

2005. Influence of transcriptional activator RamA on expression of multidrug efflux pump AcrAB and tigecycline susceptibility in Klebsiella pneumoniae. Antimicrob. Agents Chemother., 49:1017–1022.

11.

Perez

, Rudin

S.D.

, Marshall

S.H.

, Coakley

, Chen

, Kreiswirth

B.N.

, Rather

P.N.

, Hujer

A.M.

, Toltzis

, van Duin

, Paterson

D.L.

, and Bonomo

R.A.

2013. OqxAB, a quinolone and olaquindox efflux pump, is widely distributed among multidrug-resistant Klebsiella pneumoniae isolates of human origin. Antimicrob. Agents Chemother., 57:4602–4603.

12.

Nielsen

L.E.

, Snesrud

E.C.

, Onmus-Leone

, Kwak

Y.I.

, Aviles

, Steele

E.D.

, Sutter

D.E.

, Waterman

P.E.

, and Lesho

E.P.

2014. IS5 element integration, a novel mechanism for rapid in vivo emergence of tigecycline nonsusceptibility in Klebsiella pneumoniae. Antimicrob. Agents Chemother., 58:6151–6156.

13.

Veleba

, and Schneiders

2012. Tigecycline resistance can occur independently of the ramA gene in Klebsiella pneumoniae. Antimicrob. Agents Chemother., 56:4466–4467.

14.

Bratu

, Landman

, George

, Salvani

, and Quale

2009. Correlation of the expression of acrB and the regulatory genes marA, soxS and ramA with antimicrobial resistance in clinical isolates of Klebsiella pneumoniae endemic to New York City. J. Antimicrob. Chemother., 64:278–283.

15.

Veleba

, Higgins

P.G.

, Gonzalez

, Seifert

, and Schneiders

2012. Characterization of RarA, a novel AraC family multidrug resistance regulator in Klebsiella pneumoniae. J. Antimicrob. Chemother., 56:4450–4458.

16.

Hentschke

, Wolters

, Sobottka

, Rohde

, and Aepfelbacher

2010. ramR mutations in clinical isolates of Klebsiella pneumoniae with reduced susceptibility to tigecycline. Antimicrob. Agents Chemother., 54:2720–2723.

17.

, Alberti

, Lynch

, Nikaido

, and Hearst

J.E.

1996. The local repressor AcrR plays a modulating role in the regulation of acrAB genes of Escherichia by global stress signals. Mol. Microbiol., 19:101–112.

18.

Villa

, Feudi

, Fortini

, Garcia-Fernandez

, and Carattoli

2014. Genomics of KPC-producing Klebsiella pneumoniae sequence type 512 clone highlights the role of RamR and ribosomal S10 protein mutations in conferring tigecycline resistance. Antimicrob. Agents Chemother., 58:1707–1712.

19.

Clinical and Laboratory Standards Institute (CLSI). 2012. Performance Standards for Antimicrobial Susceptebility Testing: Twenty-Second Informational Supplement, M100-S22, Wayne, PA.

20.

Lin

, and Martinez

2006. Effect of efflux pump inhibitors on bile resistance and in vivo colonization of Campylobacter jejuni. J. Antimicrob. Chemother., 58:966–972.

21.

Podschun

, and Ullmann

1998. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin. Microbiol. Rev., 11:589–603.

22.

, Fu

, Chen

, Ruan

, Hua

, Zhou

, and Yu

2015. Tigecycline susceptibility and the role of efflux pumps in tigecycline resistance in KPC-producing Klebsiella pneumoniae. PLoS One., 10:e0119064.

23.

Lin

Y.T.

, Wang

F.D.

, Chan

Y.J.

, Fu

Y.C.

, and Fung

C.P.

2014. Clinical and microbiological characteristics of tigecycline non-susceptible Klebsiella pneumoniae bacteremia in Taiwan. BMC Infect. Dis., 14:1.

24.

Sheng

Z.K.

, Hu

, Wang

, Guo

, Chen

, Xu

, Zhu

, and Wang

2014. Mechanisms of tigecycline resistance among Klebsiella pneumoniae clinical isolates. Antimicrob. Agents Chemother., 58:6982–6985.

25.

Zhong

, Xu

, Chen

, Zhou

, Hu

, and Cheng

2014. First emergence of acrAB and oqxAB mediated tigecycline resistance in clinical isolates of Klebsiella pneumoniae pre-dating the use of tigecycline in a Chinese hospital. PLoS One., 9:e115185.

26.

Hasdemir

U.O.

, Chevalier

, Nordmann

, and Pages

J.M.

2004. Detection and prevalence of active drug efflux mechanism in various multidrug-resistant Klebsiella pneumoniae strains from Turkey. J. Clin. Microbiol., 42:2701–2706.

27.

Kern

W.V.

, Steinke

, Schumacher

, Schuster

, von Baum

, and Bohnert

J.A.

2006. Effect of 1-(1-naphthylmethyl)-piperazine, a novel putative efflux pump inhibitor, on antimicrobial drug susceptibility in clinical isolates of Escherichia coli. J. Antimicrob. Chemother., 57:339–343.

28.

Hentschke

, Christner

, Sobottka

, Aepfelbacher

, and Rohde

2010. Combined ramR mutation and presence of a Tn1721-associated tet(A) variant in a clinical isolate of Salmonella enterica serovar Hadar resistant to tigecycline. Antimicrob. Agents Chemother., 54:1319–1322.