Fecal Carriage of Extended-Spectrum β-Lactamases in Healthy Humans,Poultry,and Wild Birds in León,Nicaragua—A Shared Pool of bla CTX-M Genes and Possible Interspecies Clonal Spread of Extended-Spectrum β-Lactamases-Producing Escherichia coli

Abstract

Antibiotic-resistant bacteria are a major concern in the healthcare of today, especially the increasing number of gram-negative bacteria producing β-lactamases such as extended-spectrum β-lactamases (ESBLs). However, little is known about the relationship of ESBL producers in humans and domestic and wild birds, especially in a low-income setting. Therefore, we studied the fecal carriage of ESBL-producing Escherichia coli and Klebsiella pneumoniae in healthy humans, poultry, and wild birds in the vicinity of León, Nicaragua. Three hundred fecal samples were collected during December 2012 from humans (n = 100), poultry (n = 100) and wild birds (n = 100). The samples were examined for ESBL-producing E. coli and K. pneumoniae, revealing the prevalence of 27% in humans, 13% in poultry, and 8% in wild birds. Further characterization of the ESBL-producing isolates was performed through polymerase chain reaction (PCR) (NDM, CTX-M), epidemiological typing (ERIC2-PCR), multilocus sequence typing, and sequencing. ESBL producers harbored bla_CTX-M-2, bla_CTX-M-15, bla_CTX-M-22, and bla_CTX-M-3 genotypes. The bla_CTX-M-15 constituted the absolute majority of ESBL genes among all samples. ERIC-PCR demonstrated highly related E. coli clones among humans, poultry, and wild birds. Clinically relevant E. coli clone ST648 was found in humans and poultry. There is a shared pool of bla_CTX-M genes between humans and domesticated and wild birds in Nicaragua, and the results suggest shared clones of ESBL-producing E. coli. The study adds to the notion that wild birds and poultry can pick up antibiotic-resistant bacteria of human origin and function as a melting pot of resistance. Structured surveillance programs of antimicrobial resistance and a more regulated prescription of antibiotics are warranted in Nicaragua.

Introduction

Antibiotic-resistant bacteria constitute a rapidly growing problem in modern healthcare. The developing world carries the largest burden of antibiotic-resistant bacteria,¹ but also western societies have seen a pandemic spread of antibiotic resistance resulting in increased mortality, morbidity, and longer hospital stays, as well as an increase in the cost of treatment.^2,3

A major part of the problem is Escherichia coli and Klebsiella pneumoniae carrying extended-spectrum β-lactamases (ESBLs) making them resistant to third- and fourth-generation cephalosporins.⁴ The first ESBL of the CTX-M type was reported in a clinical setting in Germany during 1989.⁵ Within a few years, it had spread widely into different bacterial populations globally.^6,7 As a result, during the last decade, bla_CTX-M has become the dominant ESBL type, more common than the bla_TEM and bla_SHV mutants in large parts of the world.^8–11 In many countries, different bla_CTX-M ESBL variants seem to be endemic in E. coli from the community, poultry, and wild birds,^8,11–13 however, there is lack of information from the Central American countries.

Few studies have been published from Nicaragua regarding resistance to third generation cephalosporins. One study performed in the town of León in 2008 regarding community-acquired urinary tract infections showed a 20% resistance rate among E. coli isolates against ceftriaxone.¹⁴ Another study of ESBL-producing E. coli in the aquatic sources of León described a predominance of the bla_CTX-M-1 and bla_CTX-M-9 ESBL type.¹⁵ To explore the detailed epidemiology of ESBLs in Nicaragua, we studied livestock and wild birds alongside healthy humans at the same time point and in the same geographic area. We studied the prevalence of the ESBL phenotype and the distribution of ESBL genes in E. coli and K. pneumoniae isolated from humans, poultry, and wild birds. To get a better understanding of the molecular epidemiology, we further characterized E. coli at phenotypic and genotypic level.

Materials and Methods

Sample collection

During December 2012, samples were collected from the vicinity of Léon, the second-largest city in Nicaragua. In total, 300 samples were collected, consisting of 100 human, 100 poultry and 100 wild bird samples. Human samples were collected from two public primary healthcare centers where feces were given by healthy persons participating in free parasite screening offered by Nicaraguan health officials. Of the human samples, 93% were from adults (18 years or older) and 7% (<18 years) from children. The poultry samples were collected from backyard farms (free-range poultry living around household areas) at the homes of people living in the vicinity of the road NIC 12, north and southbound out of León, in a radius of 15–30 km from the town center. Both freshly dropped feces and cloacal swabs were used.

The wild bird samples were collected by identifying wild bird species, scaring off the birds, and then sampling their freshly dropped feces at four sites: Site 1; Poneloya Wetlands (12°22′56.85″N, 87° 2′54.70″V), Site 2; City dump at el Fortin (12°24′56.16″N, 86°53′34.32″V), Site 3; Beach near Salinas Grandes (12°15′39.70″N, 86°51′56.44″V), and Site 4; Central León (12°25′48.28″N, 86°52′57.63″V). All sites are situated within a radius of 30 km from central León. Swab samples were put into 1 ml of a bacterial freeze medium (Luria broth; Becton Dickinson, Sparks, MD; phosphate-buffered saline containing 0.45% Na-citrate, 0.1% MgSO₄, 1% (NH₄)₂ SO₄, and 4.4% glycerol). After collection in the field, samples were immediately transferred in a cool box to a −80°C freezer and subsequently shipped to Sweden.

Screening for ESBL-producing E. coli

Each fecal sample was enriched in a brain-heart infusion broth (BHI broth; Becton Dickinson, Franklin Lakes, NJ) supplemented with vancomycin ([16 mg/L]; ICN Biomedicals, Inc. Aurora, OH) for 18 hr at 37°C and subsequently plated on chromID™ ESBL plates (BioMérieux, Marcy L'Etoile, France) and cultured overnight at 37°C. Putative E. coli or K. pneumoniae colonies were again plated on ESBL plates and incubated overnight for reconfirmation. Colonies were isolated and species identity confirmed by biochemical testing. ESBL production was confirmed with cefpodoxime/ cefpodoxime -clavulanic acid double disk test (MAST Diagnostics, Bootle, United Kingdom) according to a previously described method.¹²

Isolation of DNA

Two to four bacterial colonies were mixed in 200 μl of double-distilled water followed by heating on a heat block for 10 min at 100°C and centrifugation for 10 min at 13,000 rpm. The supernatant was then removed and stored in −20°C for further use.

Screening and characterization of CTX-M and NDM genes in E. coli

All ESBL-producing E. coli and K. pneumoniae isolates were screened for the presence of bla_CTX-M-I-IV groups. Presence of bla_CTX-M groups were detected by using an earlier described polymerase chain reaction (PCR) method.¹⁶ The control strains used were K. pneumoniae U0503575 (bla_CTX-M-I), C2 (bla_CTX-M-II), C8 (bla_CTX-M-III), and C9 (bla_CTX-M-IV). To detect presence of the bla_NDM gene, the method described in¹⁷ was used and the primers NDM-F and NDM-R (Table 1) were used in this PCR assay. K. pneumoniae CCUG601 was used as a positive control. PCR-positive amplicons were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and sent for sequencing at Eurofins MWG Operon (Ebersberg, Germany).

Table 1.

Primers Used in NDM and ERIC2 PCRs

Primer name	Sequence (5′ to 3′)
NDM-F	GGTTTGGCGATCTGGTTTTC
NDM-R	CGGAATGGCTCATCACGATC
ERIC2	AAGTAAGTGACTGGGGTGAGCG

PCRs, polymerase chain reactions.

Epidemiological typing by ERIC2 PCR

All bla_CTX-M-positive E. coli isolates from humans, poultry, and wild birds were subjected to ERIC-2 PCR to determine the clonal typing indicating interspecies dissemination of ESBL producers. A previously described PCR protocol¹² using ERIC2 primer (Table 1) was used. Samples displaying at least two bands and matching at least one other sample during the gel electrophoresis were subject for analysis and assigned a cluster. In this process, if the samples displayed at least three strong bands, one weak band was allowed to differ.

Multilocus sequence typing of ESBL-producing E. coli isolates

Because poultry and human samples had higher carriage rate of ESBL producers compared to wild birds, E. coli from poultry and humans were chosen for multilocus sequence typing (MLST) analysis. In total, 12 (6 from each species) randomly selected human and poultry isolates were characterized by MLST using the seven standard housekeeping genes (adk, fumC, gyrB, icd, mdh, purA, and recA) according to the method described earlier.¹⁸ Cycling parameters were used for all housekeeping genes as follows: 30 sec at 95°C, 30 sec at 60°C, and 1.5 min at 72°C for 30 cycles. PCR products were sequenced at Eurofins MWG Operon and allele profiles and sequence types (STs) were determined by the E. coli MLST database (http://mlst.warwick.ac.uk/mlst/dbs/Ecoli/).

Results

Resistance phenotype and genotype

The prevalence of ESBL-producing E. coli/K. pneumoniae among humans, poultry, and wild birds were 27%, 13%, and 8%, respectively, based on phenotypic confirmation. More precisely, 27 samples from humans yielded 23 E. coli and 5 K. pneumoniae isolates, 13 samples from poultry yielded 13 E. coli and 1 K. pneumoniae isolates, and 8 samples from wild birds yielded 10 E. coli isolates. The bla_CTX-M group PCRs revealed 41 E. coli and 6 K. pneumoniae isolates belonging to the bla_CTX-M-I group and 4 E. coli isolates belonging to bla_CTX-M-II group. One of the E. coli isolates was negative in all bla_CTX-M group PCRs. Sequencing of bla_CTX-M-positive isolates revealed bla_CTX-M-15 (80.4%), bla_CTX-M-32 (7.8%), bla_CTX-M-2 (7.8%), and bla_CTX-M-22 (3.9%). The distribution of bla_CTX-M genotypes is presented in Table 2. Wild birds constituted the most diverse group of samples, including five different bird species and four different types of locations. The prevalence of ESBL producers differed within this group (Table 3) with the highest prevalence in Cattle Egrets sampled at the City Dump. None of the isolates harbored the carbapenemase-producing NDM gene.

Table 2.

Distribution of CTX-M Genotypes in the Three Sample Cohorts

	Humans	Poultry	Wild birds	Total n (% of all samples)
CTX-M15	20 E.c., 5 K.p.	9 E.c., 1 K.p.	6 E.c.	41 (80.4)
CTX-M32	1 E.c.	1 E.c.	2 E.c.	4 (7.8)
CTX-M2	—	3 E.c.	1 E.c.	4 (7.8)
CTX-M22	1 E.c.	—	1 E.c.	2 (3.9)

E.c., Escherichia coli; K.p., Klebsiella pneumoniae.

Table 3.

CTX-M Genotypes, ERIC-2 PCR Results, Species, and Sampling Locations of Wild Bird Samples

	CTX-M-producing isolates
	Bird species	Bacteria	CTX-M	ERIC 2 cluster
Site 1, Poneloya Wetlands
6 White Egrets and 6 Elegant Terns sampled	—	—	—	—
Site 2, city dump at El Fórtin
12 Cattle Egrets and 11 Black Vultures sampled	Cattle Egret	E. coli	CTX-M15	—
	Cattle Egret	E. coli a	CTX-M15	—
		E. coli b	CTX-M15	A
	Cattle Egret	E. coli	CTX-M15	—
	Cattle Egret	E. coli	CTX-M32	H
Site 3, Beach near Salinas Grandes
15 Black Vultures sampled	Black Vulture	E. coli	CTX-M22	—
Site 4, Central León
50 pigeons sampled	Pigeon	E. coli a	CTX-M15	—
		E. coli b	CTX-M15	—
	Pigeon	E. coli	CTX-M15	—
	Pigeon	E. coli	CTX-M32	H

Samples from two wild birds yielded two different isolates each, denoted “a” and “b.”

Epidemiological typing by ERIC-PCR and MLST

Genetic fingerprints were obtained from bla_CTX-M-positive E. coli isolates from humans, poultry, and wild birds, and 26 isolates clustered with at least one more isolate (Table 4). In total, six different clusters were identified, with a majority of the isolates (11/26) belonging to cluster C (Table 3). Cluster C and O were shared by humans and poultry, cluster A by humans, poultry, and wild birds, and cluster H by wild birds and poultry. Cluster B and G were carried by only humans and poultry, respectively.

Table 4.

ERIC-2 PCR Clusters in Relation to CTX-M Genotypes and Sample Cohorts

ERIC-2 PCR cluster	Sample cohort	CTX-M genotype
A	Human	CTX-M15
A	Human	CTX-M15
A	Cattle Egret	CTX-M15
A	Poultry	CTX-M2
H	Pigeon	CTX-M32
H	Cattle Egret	CTX-M32
H	Poultry	CTX-M32
C	Human	CTX-M15
C	Human	CTX-M15
C	Human	CTX-M15
C	Human	CTX-M15
C	Human	CTX-M15
C	Human	CTX-M15
C	Poultry	CTX-M15
C	Poultry	CTX-M15
C	Poultry	CTX-M15
C	Poultry	CTX-M15
C	Poultry	CTX-M15
O	Poultry	CTX-M15
O	Poultry	CTX-M15
O	Human	CTX-M15
G	Poultry	CTX-M15
G	Poultry	CTX-M15
B	Human	CTX-M15
B	Human	CTX-M15
B	Human	CTX-M15

Only “clusters”—that is, ERIC-2 PCR types with more than one sample—are shown.

The MLST analysis revealed 10 different E. coli STs circulating among poultry and human reservoirs: ST189, ST648 (three strains), ST2112, ST3384, ST3541, ST4576, ST4700, ST4897, ST4898, and ST4899. Of these, three were novel STs (ST4897–ST4899). E. coli ST648 was found in both in poultry and humans. Of the 12 samples randomly selected for MLST, 8 were also assigned clusters in the ERIC-PCR (Table 4). Two strains typed as ST 648 were both in the same ERIC PCR cluster, and four strains that differed in MLST were assigned different ERIC PCR clusters. Two strains with different MLSTs were assigned the same ERIC-PCR cluster—however, these strains only differed in one house keeping gene (data not shown).

Discussion

Emergence of resistance to cephalosporins is a serious challenge worldwide, as well as in the hospitals in Nicaragua.¹⁴ In our study, the prevalence of ESBL-producing isolates was high in healthy humans (27%), but in line with previous studies performed in rural low-income countries.^19,20 Also, industrialized countries such as South Korea have demonstrated a relatively high prevalence carriage of ESBL-producing Enterobacteriaceae in healthy humans.²¹ In summary, the spread of ESBL-producing Enterobacteriaceae seems to be multifactorial, but low-income countries such as Nicaragua may be more affected. Possible contributing factors seen in León include unregulated use of antibiotics, lack of hygiene in the hospital setting, inferior waste treatment, and close contact between humans and animals.

Carriage of ESBL producers in poultry in our study from Nicaragua (13%) was comparable to a previous study from China (10.7%).²² Wild birds are considered bioindicators of environmental antibiotic resistance,^11,13,23 and environmental dissemination of antibiotic resistance, more specifically ESBL, is a serious public health issue, which might have clinical implications.^7,24 Wild birds have been reported as carriers of ESBL-producing bacteria in many countries,^11–13,25 often at high carriage rates. The carriage rate of ESBL-producing bacteria among wild birds in Nicaragua, seen in our study, is in the same magnitude. Although the numbers are too small to draw any definite conclusion, it is interesting to note that the prevalence in Cattle Egrets sampled at the dump in Leon (33%, Table 4) was much higher than the average in the cohort of wild birds in our study (8%), suggesting that proximity to human activities might contribute to colonization of birds with antibiotic-resistant bacteria.^11,26,27

The bla_CTX-M is a major ESBL type that has high clinical importance. Different types of clinically relevant bla_CTX-M genotypes have been reported in humans as well as in different reservoirs, including wild birds and poultry, in many parts of the world.^28,29 Despite the low total number of ESBL producers isolated from wild birds, the biggest diversity of bla_CTX-M genotypes was found in this cohort. In our study, isolates from the bla_CTX-M-I group consisted of three different genotypes: bla_CTX-M-15, bla_CTX-M-22, and bla_CTX-M-32. Isolates from the bla_CTX-M-II group only harbored the bla_CTX-M-2 genotype. Our results are in line with previous studies where bla_CTX-M groups I and II have been found in sick children and neonates from the hospitals in Leon, Nicaragua.^30,31 The bla_CTX-M-I group was also the dominant ESBL type previously reported in well water in Leon, Nicaragua.¹⁵

The bla_CTX-M-15 is the most successful genotype that has spread globally in humans, animals, and the environment, including some developing countries in different continents.^4,12,32 Previous studies in Latin America have demonstrated a dominance of bla_CTX-M-15 in Bolivia, Peru, and Nicaragua.^15,30,33 This pattern was reflected also in our study; bla_CTX-M-15 was dominant in humans, poultry, as well as wild birds, indicating dissemination in environmental and human/clinical settings in Nicaragua.

The bla_CTX-M-22 ESBL type was found both in healthy humans and wild birds in our study. The spread of bla_CTX-M-22 among healthy and sick humans has previously been documented in France and China.^34,35 However, we did not find bla_CTX-M-22 among poultry in Nicaragua. The dissemination of bla_CTX-M-22 in a South American country seen in our study was also reflected in a study on Gulls from Chile.³⁶ In our study, the bla_CTX-M-2 genotype was found in poultry and wild birds from Nicaragua, but not in any human samples. bla_CTX-M-2 has been reported in wild birds in Chile.³⁶ It seems that the bla_CTX-M-2 genotype has started to appear in the environment of South and Central American countries. The bla_CTX-M-32 was reported for the first time from patients in the hospital of Venezuela,³⁷ and in this study, we report it not only in humans but also in other reservoirs (both poultry and wild birds) in Nicaragua. Bacteria isolated from human and domestic animal origins have the highest coselection potential and plasmids with coselection potential tend to be more conjugative.³⁸ Plasmids carrying the bla_CTX-M gene are highly mobile and believed to be responsible for the wide-scale dissemination of CTX-M ESBLs.³⁹

The MLST analysis resulted in a large variety of ST-types; 10 different E. coli ST types in 12 samples from humans and poultry. We found a clinically associated ST type; ST648, in both humans (one sample) and poultry (two samples). Interestingly, the E. coli ST648 harbored both bla_CTX-M-15 (human) and bla_CTX_-M-2 (poultry) genes. This finding indicates that ST648 might be a multipotent ST type being able to colonize different species and harbor different bla_CTX-M genotypes. The bla_CTX-M-15 E. coli ST648 has previously been reported clinically in China.⁴⁰ In addition, bla_CTX-M-15-producing E. coli ST648 has previously been reported in companion animals, livestock, and horses from several EU countries⁴¹ and also in wild migratory birds (Leucophaeus pipixcan) in Chile.³⁶ Interestingly, healthy humans also carried the poultry-associated E. coli ST189,^42,43 which indicates potential spread to humans from poultry, possibly caused by humans and poultry living close together.

Clonality analysis by ERIC-2 PCR showed that ESBL-producing E. coli isolates were genetically diverse. There were six different clusters of the same ERIC-2 PCR appearance found in at least two different samples. Interestingly, humans were sharing one cluster with poultry and wild birds, and one cluster was shared by wild birds and poultry. Humans and poultry shared another two clusters. We believe that carriage of the same clusters is indicative for E. coli exchange among different species,¹³ probably due to sharing of the local environment and close contact between poultry and humans.

Conclusion

In summary, a high prevalence of ESBL-producing Enterobacteriaceae was found in healthy humans of León, Nicaragua. Gene sequencing, epidemiological PCR, and MLST analysis indicate a common pool of genes and bacteria among humans, poultry, and wild birds. Furthermore, ESBL production seems largely to be disseminated by bacteria carrying bla_CTX-M-15 in Nicaragua. Accordingly, it seems possible that wild birds, poultry, and other animals could act as a biological reservoir and a melting pot of resistant bacteria with a possibility to reinfect the human population. No E. coli- or K. pneumoniae-producing carbapenemase was isolated.

In a Nicaraguan perspective, introduction of surveillance programs to monitor antimicrobial resistance in hospital settings, food production, and the environment are required. Furthermore, to reduce the emergence and spread of antibiotic resistance in Nicaragua, antibiotics should be handled in a proper way in veterinary and medical practice and prescription should be more strictly regulated.

Footnotes

Acknowledgments

We thank Erick Amaya of National Autonomous University of León Nicaragua (UNAN-León) for his help in collecting samples. This work was supported by Olle Engkvist Byggmästare Foundation, Emil & Ragna Börjeson Foundation, Marcus Borgström Foundation, and Åke Wibergs Foundation.

Disclosure Statement

No competing financial interests exist.

References

Hart

C.A.

, and Kariuki

1998. Antimicrobial resistance in developing countries. BMJ, 317:647–650.

Maragakis

L.L.

, Perencevich

E.N.

, and Cosgrove

S.E.

2008. Clinical and economic burden of antimicrobial resistance. Expert Rev. Anti Infect Ther., 6:751–763.

Giske

C.G.

, Monnet

D.L.

, Cars

, and Carmeli

2008. Clinical and economic impact of common multidrug-resistant gram-negative bacilli. Antimicrob. Agents Chemother., 52:813–821.

Canton

, and Coque

T.M.

2006. The CTX-M beta-lactamase pandemic. Curr. Opin. Microbiol., 9:466–475.

Bauernfeind

, Grimm

, and Schweighart

1990. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection, 18:294–298.

Bonnet

2004. Growing group of extended-spectrum beta-lactamases: the CTX-M enzymes. Antimicrob. Agents Chemother., 48:1–14.

Bradford

P.A.

2001. Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev., 14:933–951.

Livermore

D.M.

, Canton

, Gniadkowski

, Nordmann

, Rossolini

G.M.

, Arlet

, Ayala

, Coque

T.M.

, Kern-Zdanowicz

, Luzzaro

, Poirel

, and Woodford

2007. CTX-M: changing the face of ESBLs in Europe. J. Antimicrob. Chemother., 59:165–174.

Bush

2008. Extended-spectrum beta-lactamases in North America, 1987–2006. Clin. Microbiol. Infect., 14 Suppl 1:134–143.

10.

Bonnedahl

, Drobni

, Johansson

, Hernandez

, Melhus

, Stedt

, Olsen

, and Drobni

2010. Characterization, and comparison, of human clinical and black-headed gull (Larus ridibundus) extended-spectrum beta-lactamase-producing bacterial isolates from Kalmar, on the southeast coast of Sweden. J. Antimicrob. Chemother., 65:1939–1944.

11.

Hasan

, Melhus

, Sandegren

, Alam

, and Olsen

2014. The gull (Chroicocephalus brunnicephalus) as an environmental bioindicator and reservoir for antibiotic resistance on the coastlines of the Bay of Bengal. Microb. Drug Resist., 20:466–471.

12.

Hasan

, Islam

, Ahsan

, Hossain

, Rashid

, Talukder

, Ahmed

K.U.

, Olsen

, and Abul Kashem

2014. Fecal carriage of multi-drug resistant and extended spectrum beta-lactamases producing E. coli in household pigeons, Bangladesh. Vet. Microbiol., 168:221–224.

13.

Hasan

, Drobni

, Alam

, and Olsen

2012. Dissemination of NDM-1. Lancet Infect. Dis., 12:99–100.

14.

Bours

P.H.

, Polak

, Hoepelman

A.I.

, Delgado

, Jarquin

, and Matute

A.J.

2010. Increasing resistance in community-acquired urinary tract infections in Latin America, five years after the implementation of national therapeutic guidelines. Int. J. Infect. Dis., 14:e770–e774.

15.

Amaya

, Reyes

, Paniagua

, Calderon

, Rashid

M.U.

, Colque

, Kuhn

, Mollby

, Weintraub

, and Nord

C.E.

2012. Antibiotic resistance patterns of Escherichia coli isolates from different aquatic environmental sources in Leon, Nicaragua. Clin. Microbiol. Infect., 18:E347–E354.

16.

Pitout

J.D.

, Hossain

, and Hanson

N.D.

2004. Phenotypic and molecular detection of CTX-M-beta-lactamases produced by Escherichia coli and Klebsiella spp. J. Clin. Microbiol., 42:5715–5721.

17.

Nordmann

, Naas

, and Poirel

2011. Global spread of carbapenemase-producing enterobacteriaceae. Emerg. Infect. Dis., 17:1791–1798.

18.

Wirth

, Falush

, Lan

, Colles

, Mensa

, Wieler

L.H.

, Karch

, Reeves

P.R.

, Maiden

M.C.

, Ochman

, and Achtman

2006. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol. Microbiol., 60:1136–1151.

19.

Sasaki

, Hirai

, Niki

, Nakamura

, Komalamisra

, Maipanich

, Kusolsuk

, Sa-Nguankiat

, Pubampen

, and Yamamoto

2010. High prevalence of CTX-M beta-lactamase-producing Enterobacteriaceae in stool specimens obtained from healthy individuals in Thailand. J. Antimicrob. Chemother., 65:666–668.

20.

Zhang

, Zhou

, Guo

, and Chang

2015. High prevalence and risk factors of fecal carriage of CTX-M type extended-spectrum beta-lactamase-producing Enterobacteriaceae from healthy rural residents of Taian, China. Front. Microbiol., 6:239.

21.

Y.J.

, Moon

H.W.

, Hur

, Park

C.M.

, Cho

S.E.

, and Yun

Y.M.

2013. Fecal carriage of extended-spectrum beta-lactamase-producing Enterobacteriaceae in Korean community and hospital settings. Infection, 41:9–13.

22.

Gao

, Hu

, Zhang

, Ma

, Gao

, Li

, Zhao

, Miao

, and Chai

2014. Dissemination of ESBL-producing Escherichia coli of chicken origin to the nearby river water. J. Mol. Microbiol. Biotechnol., 24:279–285.

23.

Poeta

, Radhouani

, Igrejas

, Goncalves

, Carvalho

, Rodrigues

, Vinue

, Somalo

, and Torres

2008. Seagulls of the Berlengas natural reserve of Portugal as carriers of fecal Escherichia coli harboring CTX-M and TEM extended-spectrum beta-lactamases. Appl. Environ. Microbiol., 74:7439–7441.

24.

Martinez

J.L.

2008. Antibiotics and antibiotic resistance genes in natural environments. Science., 321:365–367.

25.

Bonnedahl

, Drobni

, Gauthier-Clerc

, Hernandez

, Granholm

, Kayser

, Melhus

, Kahlmeter

, Waldenstrom

, Johansson

, and Olsen

2009. Dissemination of Escherichia coli with CTX-M type ESBL between humans and yellow-legged gulls in the south of France. PLoS One., 4:e5958.

26.

Hasan

, Olsen

, Alam

, Akter

, and Melhus

2015. Dissemination of multidrug resistant ESBL-producing E. coli O25b-ST131 clone and role of House Crow (Corvus splendens) foraging on hospital waste in Bangladesh. Clin. Microbiol. Infect., 11:1000.e1–1000.e4.

27.

Gordon

D.M.

, and Cowling

2003. The distribution and genetic structure of Escherichia coli in Australian vertebrates: host and geographic effects. Microbiology, 149:3575–3586.

28.

Hawkey

P.M.

, and Jones

A.M.

2009. The changing epidemiology of resistance. J. Antimicrob. Chemother., 64 Suppl 1:i3–i10.

29.

Smet

, Martel

, Persoons

, Dewulf

, Heyndrickx

, Herman

, Haesebrouck

, and Butaye

2010. Broad-spectrum beta-lactamases among Enterobacteriaceae of animal origin: molecular aspects, mobility and impact on public health. FEMS Microbiol. Rev., 34:295–316.

30.

Amaya

, Reyes

, Vilchez

, Paniagua

, Mollby

, Nord

C.E.

, and Weintraub

2011. Antibiotic resistance patterns of intestinal Escherichia coli isolates from Nicaraguan children. J. Med. Microbiol., 60:216–222.

31.

Amaya

, Caceres

, Fang

, Ramirez

A.T.

, Palmgren

A.C.

, Nord

C.E.

, and Weintraub

2009. Extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in a neonatal intensive care unit in Leon, Nicaragua. Int. J. Antimicrob. Agents., 33:386–387.

32.

Bush

, and Fisher

J.F.

2011. Epidemiological expansion, structural studies, and clinical challenges of new beta-lactamases from gram-negative bacteria. Annu. Rev. Microbiol., 65:455–478.

33.

Pallecchi

, Bartoloni

, Fiorelli

, Mantella

, Di. Maggio

, Gamboa

, Gotuzzo

, Kronvall

, Paradisi

, and Rossolini

G.M.

. 2007. Rapid dissemination and diversity of CTX-M extended-spectrum beta-lactamase genes in commensal Escherichia coli isolates from healthy children from low-resource settings in Latin America. Antimicrob. Agents Chemother., 51:2720–2725.

34.

Blanc

, Leflon-Guibout

, Blanco

, Haenni

, Madec

J.Y.

, Rafignon

, Bruno

, Mora

, Lopez

, Dahbi

, Dunais

, Anastay

, Branger

, Moreau

, Pradier

, and Nicolas-Chanoine

M.H.

2014. Prevalence of day-care centre children (France) with faecal CTX-M-producing Escherichia coli comprising O25b:H4 and O16:H5 ST131 strains. J. Antimicrob. Chemother., 69:1231–1237.

35.

Tian

S.F.

, Chen

B.Y.

, Chu

Y.Z.

, and Wang

2008. Prevalence of rectal carriage of extended-spectrum beta-lactamase-producing Escherichia coli among elderly people in community settings in China. Can. J. Microbiol., 54:781–785.

36.

Baez

, Hernandez-Garcia

, Guamparito

, Diaz

, Olave

, Guerrero

, Canton

, Baquero

, Gahona

, Valenzuela

, Del Campo

, and Silva

2015. Molecular characterization and genetic diversity of ESBL-producing Escherichia coli colonizing the migratory Franklin's gulls (Leucophaeus pipixcan) in Antofagasta, North of Chile. Microb. Drug Resist., 21:111–116.

37.

Araque

, Millan

, Mendoza

, and Salas

2013. CTX-M-32 beta-lactamase-producing uropathogenic Escherichia coli isolated in Latin America. J. Infect. Dev. Ctries., 7:432–435.

38.

Pal

, Bengtsson-Palme

, Kristiansson

, and Larsson

D.G.

2015. Co-occurrence of resistance genes to antibiotics, biocides and metals reveals novel insights into their co-selection potential. BMC Genomics, 16:964.

39.

Canton

, Novais

, Valverde

, Machado

, Peixe

, Baquero

, and Coque

T.M.

2008. Prevalence and spread of extended-spectrum beta-lactamase-producing Enterobacteriaceae in Europe. Clin. Microbiol. Infect., 14 Suppl 1:144–153.

40.

Zong

, and Yu

2010. Escherichia coli carrying the blaCTX-M-15 gene of ST648. J. Med. Microbiol., 59:1536–1537.

41.

Ewers

, Bethe

, Stamm

, Grobbel

, Kopp

P.A.

, Guerra

, Stubbe

, Doi

, Zong

, Kola

, Schaufler

, Semmler

, Fruth

, Wieler

L.H.

, and Guenther

2014. CTX-M-15-D-ST648 Escherichia coli from companion animals and horses: another pandemic clone combining multiresistance and extraintestinal virulence? J. Antimicrob. Chemother., 69:1224–1230.

42.

Hussein

A.H.

, Ghanem

I.A.

, Eid

A.A.

, Ali

M.A.

, Sherwood

J.S.

, Li

, Nolan

L.K.

, and Logue

C.M.

2013. Molecular and phenotypic characterization of Escherichia coli isolated from broiler chicken flocks in Egypt. Avian Dis., 57:602–611.

43.

Chan

, Lo

W.U.

, Chow

K.H.

, Lai

E.L.

, Law

P.Y.

, and Ho

P.L.

2014. Clonal diversity of Escherichia coli isolates carrying plasmid-mediated fosfomycin resistance gene fosA3 from livestock and other animals. Antimicrob. Agents Chemother., 58:5638–5639.