Abstract
Linezolid (LZD) has arisen as an alternative treatment in diabetic foot osteitis due to staphylococci. LZD resistance selection is difficult and involved various molecular mechanisms. As a better knowledge of those mechanisms could be beneficial for pathogenic strains' screening, we simulated in vitro the spontaneous mutagenesis process that leads to LZD-resistant strains from two Staphylococcus epidermidis strains responsible for monomicrobial diabetic foot osteitis. LZD high resistance was selected for both strains, with the same timeline of mutation appearance. Mutation in L3 protein (G152D) occurred first and quickly, but did not cause phenotypically detectable resistance or fitness cost. It was later followed by different 23S rRNA mutations (G2505A, G2447T), leading this time to detectable resistance (minimum inhibitory concentration [MIC] ≥8 mg/L). This phenomenon underlies the difficulty of resistance selection in coagulase-negative staphylococci (CoNS). This study is the first description of G2505A mutation in CoNS. Various phenotypical impacts were observed depending on strain and mutation: (i) fitness cost of G2505A and G2447T mutations; (ii) loss of erythromycin resistance concomitantly with L3 mutation selection; (iii) correlation between number of mutated rrl copies and LZD resistance level for G2447T. In conclusion, the risk of selection of high-level LZD-resistant S. epidermidis strains is weak, but does exist. It could probably appear in case of long-term treatment and be favored in the case of a pre-existing mutation in L3 ribosomal protein. Thus, broad screening conditions for pathogenic strains should probably be considered.
Introduction
P
LZD resistance selection is difficult and involved various molecular mechanisms. A better knowledge of those mechanisms could be beneficial for pathogenic strains' screening. Thus, the purpose of this study was to simulate in vitro the spontaneous mutagenesis process that leads to LZD-resistant strains from S. epidermidis responsible for diabetic foot osteitis.
Materials and Methods
Bacterial strains
Two S. epidermidis clinical strains (SE2175 and SE6910) were selected for their pathogenicity. They were isolated from monomicrobial samples obtained by percutaneous bone biopsy in patients with diabetic foot osteitis not treated by LZD. 1 Moreover, they displayed two different methicillin resistance phenotypes. In vivo assessment of virulence was conducted in a Caenorhabditis elegans model. 13 Biofilm formation was studied by Ring Test (Biofilm Control).
Antimicrobial agent and MIC testing
LZD (Pfizer) solutions of 2 mg/mL were aliquoted and stored at −20°C. The LZD MIC was assessed by the Clinical and Laboratory Standards Institute-recommended agar dilution method or by E-test method (bioMérieux). 14 Susceptibility results were interpreted in accordance with EUCAST recommendations. 15
Spontaneous mutation frequency experiments
Bacterial cells from a 6-h brain–heart infusion (BHI) broth culture (bioMérieux) were harvested by centrifugation. The bacterial pellet was resuspended in 100 μL of fresh BHI (≈1010 colony-forming units/mL) and plated on Mueller-Hinton (MH) agar (bioMérieux) with LZD (4 mg/L) and without LZD and incubated 48 hr at 37°C aerobically. Spontaneous mutation frequency was determined by dividing the number of resistant colonies by the number of colonies on the plate without the antibiotic from three independent experimentations.
Development of resistance by serial passage
Mutants were selected by serial passage on an MH agar plate containing successively increasing concentrations of LZD. After 24 or 48 hr of incubation at 37°C aerobically on the plate containing LZD, the strains were transferred to fresh agar with the same dilution of LZD they had just grown on, and on agar with double the previous LZD concentration. The stability of LZD resistance was tested by serial passage (20 times) on an antibiotic-free medium from the last selected mutant.
Molecular characterization of resistance mechanism
Individual colonies from representative passages for each stepwise LZD-MIC increase or antibiotic susceptibility changes were analyzed to characterize the molecular mechanism of LZD resistance. Besides the two parental strains, six mutant strains were studied for SE2175 and five for SE6910. Bacterial DNA was isolated with easyMag (bioMérieux). Sequencing was done after amplification of the domain V region (bp 2254–2683, Escherichia coli numbering, LZD-binding site) with the primer set as previously described. 16 To detect mutations outside the LZD-binding site, we also performed sequencing from the whole 23S rDNA with new primer sets (23SepiF1 5′ CCAAGCAAAACCGAGTGAAT 3′; 23SepiR1 5′ TTCCCTCACGGTACTGGTTC 3′; 23SepiF2 5′ ACCCGGAGGAAGAGAAAGAA 3′; 23SepiR2b 5′ TGTTTAGCCCCGGTACATTT 3′; 23SepiF3 5′ GACAAACTCCGAATGCCAAT 3′; 23SepiR3 5′ CCTATTCACTGCGGCTCTTC 3′; 23SepiF4 5′ CGTTAAGGAACTCGGCAAAA 3′; 23SepiR4 5′ TCCCGGTCCTCTCGTACTAA 3′; 23SepiF5b 5′ ACAGGCTTATCTCCCCCAAG 3′; 23SepiR5 5′ CTCTAGCGGAACGTCAGTCC 3′; 23SepiF6 5′ AGGCGATGGATAACAGGTTG 3′; 23SepiR6 5′ GAGACAGTGCCCAAATCGTT 3′).
Pyrosequencing primers were used to determine the number of mutated 23S rDNA copies on a PyroMarkQ24® (Qiagen) as previously described. 17 The genes encoding PTC-associated ribosomal proteins L3 (rplC) and L4 (rplD) were amplified as previously described for S. epidermidis strains. 18 New pyrosequencing primers (L3epi F 5′ CAAGGTGCTATTAAACGTCATGG 3′; L3epiR 5′ ACAGTGTTTCCACCCATACGTC-biotin 3′; L3epiSeq 5′ CAATGGCTCACGGTT 3′) were also designed with the PyroMark assay design software to study rplC gene of S. epidermidis on PyroMark Q24.
Erythromycin resistance was analyzed by amplifying the ermC gene by PCR. 19
Determination of strain growth rate
Growth rate studies were performed for the parental strains and the mutants with difference in the molecular resistance mechanism. Growth studies were performed in triplicate by inoculating BHI broth with an overnight culture on a microplate. The optical density at 620 nm was measured every hour for 8 hr. The doubling times, Td, were calculated from the growth rates in the exponential growth phase as previously described. 20 The parental strains and mutants were compared with each other by calculating the increase percentage of the doubling time.
Study of possible LZD dependence was performed in 10 mL Mueller Hinton broth with 1 mL of 0.5 McF bacterial suspension without LZD and with 1 mL of LZD at different concentrations up to MIC for the mutants and the parental strains. Cultures were incubated at 37°C under constant shaking and the turbidity (McFarland scale) was measured every 6 hr for 24 hr. Comparison of the growth was done for each strain by dividing the turbidity value with LZD by the turbidity value without LZD at 24 hr.
Results
Bacterial strains
The two selected S. epidermidis strains were slightly virulent in C. elegans model, formed biofilm in 4 hr, but were different in resistance phenotype with a methicillin-susceptible strain (SE2175) and a multiresistant strain (SE6910) (Table 1).
In Caenorhabditis elegans model.
LT50/100: lethal time at which 50% and 100% of C. elegans died.
Ring Test® method.
Disk diffusion method: PEN, penicillin; ERY, erythromycin; LIN, lincomycin; AF, fusidic acid; KAN, kanamycin; TOB, tobramycin; GEN, gentamicin; OFX, ofloxacin; SXT, trimethoprim–sulfamethoxazole; MET, methicillin; LZD, linezolid.
Clinical and Laboratory Standards Institute-recommended agar dilution method or E-test method.
MIC, minimum inhibitory concentration.
Spontaneous mutation frequency experiments
No spontaneous mutant appeared in our experiment, which means a mutation frequency conferred decreased susceptibility to LZD less than 1.3 × 10−10 and 1.8 × 10−10 for SE2175 and SE6910, respectively.
Development of resistance by serial passage
The mutant's selection was continued until MIC stopped to increase or molecular mechanism of resistance stopped changing. The two strains became resistant (MIC >4 mg/L) after 8 and 7 passages, whereas the MICs increased up to 32 and 128 mg/L at 12 and 15 passages for SE2175 and SE6910, respectively. Evolutions of LZD MICs for the different mutants obtained are exposed in Fig. 1. Whatever the strain, no reversion to susceptibility occurred after more than 20 passages of the last mutant on LZD-free medium, showing stable resistance level.

LZD MIC's evolutions of the Staphylcoccus epidermidis strains. LZD MIC evolution is represented for each strain during serial passage in presence of LZD: SE2175 (gray squares); SE6910 (black diamonds). LZD, linezolid; MIC, minimum inhibitory concentration.
Molecular characterization of resistance mechanism
Regarding LZD resistance, mutations occurred with a similar chronology for the two strains (Table 2). First of all, a G152D mutation in protein L3 appeared at passage 4 for SE2175 and at passage 3 for SE6910. Then, different mutations in rrl copies occurred: G2505A substitution at passage 12 for SE2175 and G2447T for SE6910 at passage 9. The number of mutated rrl copies increased gradually with serial passage up to four copies for G2447T. No other mutations were detected in the 23S rDNA. No mutation was observed in rplD gene, whatever the strain.
Serial passage on Mueller-Hinton agar plate containing successively increasing concentrations of LZD.
Clinical and Laboratory Standards Institute-recommended agar dilution method or E-test method.
Sanger sequencing method after amplification by PCR.
Ratio = number of rrl mutated copies/total number of rrl copies, determined by pyrosequencing method.
WT, wild type.
Our pyrosequencing method allowed to detect rapidly the mutation G455A encoding the G152D change in L3 protein. However, it required to enter before the assay, the DNA sequence adjacent to the studied nucleotide. As a polymorphism exists among S. epidermidis strains at position 456: a T for the SE2175 strain and a C for the SE6910 strain, two different pyrosequencing assays were performed, one for each strain.
Notably, erythromycin resistance loss was correlated with the loss of ermC gene at passage 7 for SE2175.
Determination of strains' growth rates
Whatever the strain, L3 protein mutation G152D had a weak or no impact on staphylococcal growth rate. When compared with their parental strain, the increase in doubling times was 0% and 11% for SE2175 and SE6910 mutants, respectively. The following mutations in rrl caused a bigger decline in growth rate. In SE2175, the mutation G2505A in two rrl copies led to a generation time increase of 30% and in SE6910 the mutation G2447T in two rrl copies to an increase of 49% and in four copies to 69%.
To study partial LZD dependence, a comparison of the growth rates with and without LZD at different concentrations was performed for the parental strains and the mutants resistant to LZD (MIC >4 mg/L) with modification in L3 protein alone and associated with 23S rDNA mutations. For both strains, the parental and mutants' growth was slightly or totally inhibited by the presence of LZD at MIC and half-MIC (ratio <1, at 24 hr). At LZD concentrations below half MIC, growth rates were similar to the ones of the strains without LZD. For mutation G152D alone, the mutants of passage 9 for SE2175 and passage 7 for SE6910 were tested, to study mutants with an LZD MIC >4 mg/L. The ratios were 0.1 and 0.4 for strain growth with LZD at MIC and 0.6 and 0.8 at half-MIC, respectively. For mutations in rrl associated with L3 protein modifications, the last selected mutants were tested. The ratios were 0.1 and 0 for strain growth with LZD at MIC and 0.7 and 0.3 at half-MIC for SE2175 and SE6910, respectively.
Discussion
We studied the risk of LZD resistance emergence in S. epidermidis strains responsible for diabetic foot osteitis. We showed that resistance may have been selected in vitro (although it required several serial passages), and that the mutation location involved in the emergence of high-level LZD-resistant strains were unpredictable.
Whatever the strain, spontaneous mutation was not achieved corresponding to a mutation frequency lower than 10−10, which is consistent with previous studies showing spontaneous mutation lower to 10−9 for S. epidermidis 21 and to 10−10 for S. aureus.22,23 This low rate can be corroborated by the rarity with which resistant clinical isolates of staphylococci are isolated (resistance rate in the last published international surveillance program of 0.15%). 24
Our study pointed out the same timeline of mutation's appearance for both strains, first in rplC gene and secondarily in 23S rDNA. Even if our study concerns only two strains, which could be considered as a pitfall of our work, we could hypothesize that an initial selection of L3 protein mutation might favor mutation appearance in rrl copies and may be a facilitator step in LZD resistance development in S. epidermidis strains. Concordantly, this kinetic of mutation appearance has already been described in vitro in S. aureus, but this is the first time in S. epidermidis, 22 and this association between L3 and 23S rDNA mutations is frequently reported in clinical strains of CoNS. 25 On another hand, LZD-resistant strains with mutations only in 23S rDNA have been frequently described. 25 Therefore, a mutation in L3 protein does not seem to be a prerequisite for 23S rDNA mutation appearance in all strains.
The first identified mutation, together with the first increase in LZD MIC (from 1–2 or 4 mg/L), was the G152D mutation in L3 protein for both strains. This particular mutation has already been observed in vitro and in clinical strains, alone or along with different 23S rDNA mutations.22,25,26 Locke et al. have supposed that G152D situated beneath a conserved mismatch (base 2576 and 2577) reduces LZD affinity by indirect perturbation of bases 2505 and 2506. 22 We showed that the G152D mutation induced a low fitness cost that could explain for its rapid selection. Furthermore, it induced a low MIC increase, which is challenging to detect by phenotypic test. Mendes et al. have also observed amino acid alteration in L3 protein, notably at position G152, in LZD-susceptible Gram-positive clinical organisms. 25 As the L3 mutation may precede 23S rDNA mutation and may be undetected, this could generate an increased risk of resistance selection. In this context, molecular biology testing could be beneficial before LZD use to detect potential mutations in the rplC gene. To do so, we try to develop a quick and easy molecular assay. However, as a sequence polymorphism exists in S. epidermidis rplC gene at position 456, pyrosequencing method requires to perform two different analyzes in a routine process screening. Likewise, restriction fragment length polymorphism PCR using restriction enzyme, as well as real-time PCR with melting curve analysis are not effective strategies (data not shown). Consequently, Sanger sequencing of rplC seems to be a more comprehensive way in case of availability at the laboratory.
Different 23S rDNA mutations appeared secondarily for both strains leading to a similar resistance level (LZD MIC of 32 and 128 mg/L). These MICs are consistent with those reported in clinical CoNS strains and with those obtained in the two S. aureus strains selected in vitro.22,27 Two different mutations, one for each strain, appeared in 23S rDNA: G2505A and G2447T. The mutation G2505A (SE2175) has not been reported in staphylococcal clinical strains in surveillance studies over 8 years. 25 This strain only reached two mutated copies, but had an MIC of 32 mg/L. Bourgeois‐Nicolaos et al. observed the same low number of mutated copies with G2505A mutation in in vivo selected Enterococcus faecalis mutants. 16 The authors suggested that mutants with more mutated copies might not be viable, but an in vitro mutant of Mycobacterium smegmatis containing this mutation in its single 23SrDNA copy was created by Long et al. 20 A decrease in growth rate was observed in our strain following the mutation of the two rrl copies alike in E. faecalis and M. smegmatis,16,20 but although there is no additional mutations in 23S rDNA, we cannot totally exclude the possibility that other mutations adversely affecting the fitness may have been selected during passaging. The other mutation, G2447T, a well-described mutation in the clinical strains of Staphylococcus sp. and Enterococcus sp., 25 appeared in one of the S. epidermidis strains (SE6910). Alike G2505A mutations, the possibility of other mutations with fitness cost appearance outside the 23S rDNA cannot be ruled out, however, our results suggested that the accumulation of the G2447T mutations in rrl copies causes a successive decline in fitness as well as an MIC increase. In mutagenesis experiments, mutation G2447T was responsible for a decrease in the activity of PTC.28,29
The LZD dependence phenomenon was described recently in clinical S. epidermidis strains in Greece. Those strains presented a mutation profile with 23S rDNA mutations (T2504A, C2534T) and L3 mutations (G152D, D159Y). 12 Given these results, it would be reasonable to assume that G152D mutation could also favor the appearance and evolution of a dependence phenotype. However, in our study, the growth rates of the mutants with G152D alone or associated with our specific 23S rDNA mutations (G2505A or G2447T) were always similar or decreased depending on the final LZD concentration used and never increased. So according to our results, G152D mutation does not seem to favor the evolution toward the dependence at least with our mutations in 23S rDNA, which are different from the Greek strains. Recently, total LZD dependence was reported in an S. aureus clinical strain. Interestingly, this strain shows no known ribosomal mutation or cfr gene. 30
In the SE2175 strain, concomitant with L3 mutation emergence, erythromycin resistance loss was observed, due to ermC gene loss. This phenomenon has already been described during S. aureus in vitro selection 31 and in vivo. 32 Interestingly, when ermC gene was introduced again, the LZD sensitivity was not re-established. 33 The relationship between the LZD resistance and erythromycin resistance should be further studied. To verify this loss, we performed a second selection with the same strain and observed the same evolution (data not shown).
As a conclusion, LZD resistance may be selected in vitro but with difficulty. In our study, the first step toward LZD resistance, mutation in L3 protein, does not induce a resistant phenotype and requires meticulous molecular methods for its detection. Thus, broad screening conditions for pathogenic strains should probably be considered.
Footnotes
Acknowledgment
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sector. The authors thank A. Mulert for the English editing.
Disclosure Statement
No competing financial interests exist.
