Antimicrobial Resistance and Virulence-Associated Genes of Campylobacter spp. Isolated from Raw Milk,Fish,Poultry,and Red Meat

Abstract

This study was designed and conducted to evaluate the frequency, antimicrobial resistance, and presence of six virulence-associated genes among thermophilic Campylobacters isolated from raw milk, poultry (chicken, turkey, and duck), fish, cattle, and sheep meat. Out of 590 samples, which were recovered from different origins, 141 (23.9%) samples were positive for Campylobacters. Campylobacter spp. was isolated in 40.8% (106/260), 14% (28/200), and 8.7% (7/80) of poultry meat, red meat, and milk samples, respectively. Antimicrobial susceptibility test indicated a high frequency of resistance to ciprofloxacin, tetracycline, and nalidixic acid among the isolates. Furthermore, prevalence of waaC, ciaB, and pldA genes were 91.7%, 86.7%, and 80.8%, respectively; and, none of the isolates harbored both wlaN and cgtB genes, simultaneously. Moreover, there was a weak correlation between antibiotics resistance and presence of the pathogen genes. However, the existence of Campylobacter spp. isolates in food animal products, with high resistance to antibiotics and several virulence gene possessions, is alarming and increases the attention to the widespread use of antibiotics.

Introduction

Members of genus Campylobacter, a group of gram-negative, spiral-shaped bacteria, are a number of pathogens that can cause gastroenteritis and traveler's diarrhea in humans.^1,2 This group of bacteria, particularly thermophilic Campylobacter spp., is one of the most important microorganisms causing foodborne illnesses in developed and developing countries. Among these thermophilic Campylobacters, Campylobacter jejuni and C. coli are more virulent and can cause different diseases in humans.^3–5 As a zoonotic pathogen, Campylobacter spp. can be transmitted to humans through consumption and/or handling of contaminated food, mainly fresh and atmosphere-modified packed meat, raw milk, water, seafood, and vegetables.^1,2,6 Poultry products have been suggested as the most significant sources of Campylobacter spp. infections;^1,7,8 on the other hand, cattle and sheep can also carry C. jejuni and C. coli.⁹ Campylobacters can naturally colonize the gastrointestinal tracts of food animals and can contaminate the skin, meat, and meat products of these animals during slaughter and other processing stages in the slaughterhouse.¹⁰ Therefore, implementation and monitoring of control programs at the production level are necessary to avoid a high level of contamination.^1,2

It is well known that the rise of antimicrobial resistance and multidrug-resistant phenotypes in bacteria is a worldwide concern. The excessive use of antimicrobial drugs in veterinary medicine for controlling diseases or increasing the growth in food animals, and misuse of antibiotics in medicine are related to these resistances.^11,12 Furthermore, due to the use of similar antibiotics in veterinary and human medicine, the multidrug-resistant microorganisms develop and disseminate in humans after the extensive use of antibiotics.^5,13 In addition, resistance to one antimicrobial agent may provide cross-protection against another.¹³

Selective drugs for human severe campylobacteriosis are erythromycin and ciprofloxacin, which are the members of the macrolide and fluoroquinolone families, respectively. In addition, gentamicin, tetracycline, and ampicillin can be used in medicine for the treatment of systemic Campylobacter spp. infections.^14,15 Although five antibiotics (ciprofloxacin, erythromycin, gentamicin, ampicillin, and tetracycline) are used against campylobacteriosis as the most important drugs, other antibiotics like amikacin can be used as an alternative treatment or a synergist drug for the mentioned antibiotics.^2,14

Resistance to two antibiotics, belonging to a certain family, may indicate genetic characteristics of resistance, which can also affect the rest of those family members in a specific bacteria.¹³ So, a study is needed to evaluate the antibiotic resistance of the main Campylobacter spp. infection's drugs and other similar antibiotics, which can belong to the same family. The increasing number of antibiotic-resistant Campylobacter spp. isolates is a serious public health issue over the last few years.^2,16,17 Therefore, previous research need to be updated annually to obtain new data about these antimicrobial resistances.

Certain virulence-associated genes play an important role in the pathogenesis of Campylobacter spp. infections.^18,19 ciaB (Campylobacter spp.-invasive antigen B),²⁰ and pldA (a gene that encodes an outer membrane phospholipase A)²¹ are involved in the invasion and colonization of the host cells. VirB11, a plasmid-associated gene, is also associated with host cell invasion.²² Genes cgtB, wlaN, and waaC are involved in the β-1,3 galactosyltransferase production and biosynthesis of lipooligosaccharide (LOS). Presumably, these later genes are connected to the expression of ganglioside mimics in Guillain-Barre’ syndrome, an acute peripheral polyneuropathy, after C. jejuni infection.^18,23,24

In addition, along with the association between virulence and clinical infection, the virulence factors may also be associated with the antimicrobial resistance.²⁵ Furthermore, it is proven that antimicrobial-resistant Campylobacter species can cause severe diarrhea in comparison to antimicrobial-susceptible strains.²⁶ Thus, it is necessary to investigate the relationships between these two characteristics, resistance and virulence. Although, to the author's knowledge, few, if any, studies have focused on this issue.^25,27 Hence, the occurrences of six virulence-associated genes were studied in this research; then, the association between the virulence factor of the pathogen and antimicrobial resistance was evaluated through statistical analysis.

The microbiological safety of food is an important issue for consumers and industry. In addition, thermophilic Campylobacters, especially C. jejuni and C. coli, play important roles in most of the human Campylobacter spp. infections. So, this study was designed to evaluate the prevalence of thermophilic Campylobacters in raw milk, poultry, fish, and red meat. Furthermore, as it was mentioned above, the level of antimicrobial resistance, virulence-associated genes, and the relationship between them were analyzed in these isolates.

Materials and Methods

Study area and sample collection

A total of 590 samples were collected between July of 2014 and June of 2015 to determine the prevalence of C. jejuni and C. coli in seven different types of food. The following types of samples were used in this research: (i) chicken meat, including samples from two sites along the processing line in the slaughterhouse, after evisceration (50) and 24-hr postchilling steps (50), 30 breast package samples, and 30 samples from traditional markets; (ii) turkey meat, including breast package (40) and 30 samples from traditional markets; (iii) duck meat, including 30 samples from traditional markets; (iv) 50 samples from freshwater fish (Salmo trutta) meat obtained from a traditional fish market; (v) 200 cattle and sheep meat samples obtained from after final wash and 24-hr chilling steps in the slaughterhouse (50 samples per each animal/step); and (vi) 80 samples of milk, including 40 samples from bulk tank milk and 40 samples from filters.

The samples of the chicken, cattle, and sheep carcasses were collected during 20 visits to the main commercial poultry and/or large animal processing plants of northern Iran, located in Mazandaran province, Iran. In addition, the chicken, turkey, duck, and fish (S. trutta) meat samples were purchased from supermarkets or traditional markets located in Mazandaran and Golestan provinces, Iran. Furthermore, the raw milk samples (bulk tank milk and the filters) were collected during 20 visits to a farm located in Mazandaran province, Iran. Each milk sample (20 ml) was collected from bulk tank milk using a sterile syringe. The raw milk filters were taken aseptically from the milking lines directly after milking process and placed into sterile whirl-pack bags. Approximately, 25 g of meat samples (with skin except for cattle and sheep) were collected from the breast or thigh of the carcass by using sterile forceps and scalpel. Each sample was tightly sealed in the sterile plastic wrap and carried to the microbiology laboratory in special ice-filled container within 4 hr of sampling.

Isolation and identification of thermophilic Campylobacter

Isolation of Campylobacter species was done according to the EN/ISO 10272-1 (2006) standard methodology²⁸ employing slight modification.⁶ Briefly, the meat (25 g) and the filter milk samples were homogenized for 2 min in a stomacher with 225 ml buffered peptone water (Difco) in the sterile plastic bags. Then, 10 ml of the homogenate solution was added to 90 ml of Preston's enrichment broth base (HiMedia Laboratories; M899) supplemented with Campylobacter selective supplement IV (HiMedia Laboratories; FD042) and 5% (v/v) defibrinated sheep blood. In addition, each milk sample (20 ml) was added to 80 ml of the same Preston's enrichment broth. Subsequently, all enrichment broths were incubated for 4 h at 37°C followed by 44 h at 42°C in a jar under a microaerophilic atmosphere (Anaerocult C; 5% O₂, 10% CO₂, and 85% N₂).

Thereafter, 100 μl of each enriched sample was streaked onto the Columbia Blood Agar (HiMedia Laboratories), supplemented with the same antibiotics and sheep blood amount. Each plate was incubated at 42°C for 48 hr under the same condition. The suspected colonies with small, gray, drop-like, and shiny properties were picked from each plate and cultured on chocolate agar plates with 5% sheep blood for further investigation. The Campylobacter spp. isolates were confirmed by genus-specific polymerase chain reaction (PCR) assay as developed by Linton et al.²⁹

DNA extraction and PCR analysis

Bacterial DNA was extracted from fresh Campylobacter spp. isolates using the phenol–chloroform technique as previously described by Khoshbakht et al.⁸ Spectrophotometry was used at 260 and 280 nm to determine the purity and concentration of the DNA (Nanodrop 1000; Thermo Scientific). Genus and multiplex species-specific PCR reactions were performed for identification of the genus of Campylobacter, C. jejuni, and C. coli species, using primers targeted on 16SrRNA, mapA, and ceuE genes, respectively,^29–31 which are shown in Table 1. After the confirmation of isolates, the PCR assay was done to detect the six virulence factors using the primers listed in Table 1.

Table 1.

Nucleotide Sequences Used as Primers in the Polymerase Chain Reactions for Identification of Campylobacter Genus, Species, and Their Virulence Genes

Target gene	Sequence (5′ to 3′)	Annealing temperature (°C)	Product size (bp)	Reference
16SrRNA	F: ATCTAATGGCTTAACCATTAAAC	59	857	²⁹
	R: GGACGGTAACTAGTTTAGTATT
mapA	F: CTATTTTATTTTTGAGTGCTTGTG	52	589	³¹
	R: GCTTTATTTGCCATTTGTTTTATTA
ceuE	F: AATTGAAAATTGCTCCAACTATG	52	462	³⁰
	R: TGATTTTATTATTTGTAGCAGCG
pldA	F: AAGCTTATGCGTTTTT	45	913	¹⁸
	R: TATAAGGCTTTCTTCA
ciaB	F: CAGAAGGAGAAATTTGTGAGC	58	355	⁴⁴
	R: ATATCCCATTCTAATGCCACC
cgtB	F: TTAAGAGCAAGATATGAAGGTG	56	562	²⁴
	R: GCACATAGAGAACGCTACAA
wlaN	F: TGCTGGGTATACAAAGGTTGTG	56	330	⁴⁷
	R: AATTTTGGATATGGGTGGGG
waaC	F: TAATGAAAATAGCAATTGTTCGT	42	1,029	⁴⁸
	R: GATACAAAAATCACTTTTATCGA
VirB11	F: TCTTGTGAGTTGCCTTACCCCTTTT	53	494	¹⁸
	R: CCTGCGTGTCCTGTGTTATTTACCC

F, forward; R, reverse.

The PCR amplifications were performed in a final volume of 25 μl. Each PCR reaction mixture consisted of 2 μl of the DNA template, 2.5 μl 10 × PCR buffer (75 mM Tris-HCl, pH 9.0, 2 mM MgCl₂, 50 mM KCl, and 20 mM [NH₄]₂SO₄), 1 μl dNTPs (50 mM), 1 μl (1 U) Ampli Taq DNA polymerase, and 1 μl (25 pmol) from the forward and reverse primers, which are shown in Table 1. All materials were purchased from CinnaGen. The final volume of each reaction mixture was increased to 25 μl using distilled deionized water. The thermal cycler (MJ mini; BioRad) was adjusted under the following conditions: the initial denaturation step at 94°C for 5 min, followed by 35 amplification cycles of the denaturation step at 94°C for 1 min, the annealing step as shown in Table 1 for 1 min, and the extension step at 72°C for 1 min. The final extension step was carried out at 72°C for 10 min.

The amplified products were separated using electrophoresis in 1.5% agarose gel stained with ethidium bromide (0.5 μg/ml; CinnaGen). The DNA bands were photographed using an ultraviolet transilluminator (BTS-20), and the 100-bp DNA ladder (CinnaGen) was used as a molecular size marker. The C. jejuni RTCC 1097 and C. coli RTCC 1113 strains were included as PCR-positive controls. The sterile PCR water was used as a negative control.

Antimicrobial susceptibility testing

The Campylobacter spp. isolates were examined for antimicrobial susceptibility by employing the Kirby–Bauer disk diffusion method. The inhibition zone was determined with calipers and interpreted according to the Clinical and Laboratory Standards Institute (CLSI). In the cases when CLSI recommendations were not available for Campylobacters, the CLSI guidelines for Enterobacteriaceae were followed.³² Ten antibiotic discs (Paramedical) were used in this research. The discs and their concentrations consisted of ciprofloxacin (5 μg), enrofloxacin (5 μg), ampicillin (10 μg), erythromycin (15 μg), gentamicin (10 μg), streptomycin (25 μg), tetracycline (30 μg), nalidixic acid (30 μg), amikacin (30 μg), and amoxicillin (20 μg). Each overnight culture of Campylobacter spp. isolate was suspended in sterile normal saline and adjusted to a turbidity of 0.5 McFarland standard. Each suspension was inoculated with a sterile swab on the entire surface of a 150 mm diameter Mueller-Hinton agar plate (Oxoid Ltd.) supplemented with 5% sheep blood. The agar surface of each plate was allowed to dry for 3 min. The antimicrobial discs were aseptically applied on the plates. After incubation at 42°C for 48 hr under the microaerophilic atmosphere, the inhibition zones were measured. Staphylococcus aureus ATCC 12600, Escherichia coli RTCC 1161, and C. jejuni RTCC 1097 were used as quality control strains.

Statistical analysis

The results were analyzed using the SPSS software, version 16.1 (SPSS, Inc.). The Pearson chi-square and Fisher's exact two-tailed tests were used to assess the following items: the association between the different isolation rates of two Campylobacter species and type of food samples, the proportions of isolates resistant to different antimicrobial agents, and the prevalence of the virulence factors in isolates with various origins. p Value was lower than 0.05 indicating the significant statistic. The logistic regression analysis was also used to study the effect of an antibiotic resistance on another antibiotic resistance and/or the effect of the existence of a virulence gene on other genes. The relationships between antibiotic resistance and virulence genes were also analyzed using the Cramer's V method.

Results

Distribution of Campylobacter spp.

Overall, 141 (23.9%) Campylobacter spp. were isolated from 590 samples. All types of food origins revealed Campylobacter spp. contamination, except for the fish samples. The isolates of Campylobacter spp. were detected in 40.8% (106/260) of the poultry meat, which was statistically higher than the isolation rate of Campylobacter spp. in the red meat (14%) and milk (8.7%) samples (p < 0.001). A summary of the Campylobacter spp. prevalence is shown in Table 2. Overall, among 141 isolates of Campylobacter spp., the detection rate of C. jejuni (56%) was higher than C. coli (29.1%), with regard to PCR analysis. In addition, 14.9% of the isolates were other species. Although the isolation rate of C. coli was higher than the isolation rate of C. jejuni in the sheep and turkey samples, the C. jejuni was significantly detected more than the C. coli (p = 0.001) in others.

Table 2.

Prevalence of Campylobacter Species in the Various Food Samples

Biological origin	Source/number of samples	Campylobacter species (%)	Campylobacter jejuni (%)	Campylobacter coli (%)	Other Campylobacter species (%)
Chicken	After evisceration/50	31 (62)	19 (61.3)	7 (22.5)	5 (16.2)
	24 hr after chilling/50	12 (24)	6 (50)	3 (25)	3 (25)
	Breast package/30	12 (40)	8 (66.6)	1 (8.4)	3 (25)
	Traditional market/30	21 (70)	12 (57.1)	5 (23.9)	4 (19)
	Total sample of chicken/160	76 (47.5)	45 (59.2)	16 (21.1)	15 (19.7)
Turkey	Breast package/40	9 (22.5)	4 (44.4)	4 (44.4)	1 (11.2)
	Traditional market/30	11 (36.6)	5 (45.4)	6 (54.6)	0 (0)
	Total sample of turkey/70	20 (28.6)	9 (45)	10 (50)	1 (5)
Duck	Traditional market/30	10 (33.3)	7 (70)	2 (20)	1 (10)
Fish	Traditional market/30	0 (0)	—	—	—
Cattle	After final wash/50	8 (16)	4 (50)	3 (37.5)	1 (12.5)
	After 24-hr chilling at 4°C/50	3 (6)	2 (66.6)	0 (0)	1 (33.4)
	Total sample of cattle/100	11 (11)	6 (54.6)	3 (27.3)	2 (18.1)
Sheep	After final wash/50	11 (22)	5 (45.4)	6 (54.6)	0 (0)
	After 24-hr chilling at 4°C/50	6 (12)	2 (33.3)	2 (33.3)	2 (33.3)
	Total sample of sheep/100	17 (17)	7 (41.2)	8 (47.1)	2 (11.7)
Milk	Bulk tank/40	2 (5)	2 (100)	0 (0)	0 (0)
	Filter/40	5 (12.5)	3 (60)	2 (40)	0 (0)
	Total sample of raw milk/80	7 (8.8)	5 (71.4)	2 (28.6)	0 (0)
Total	Total samples/590	141 (23.9)	79 (56)	41 (29.1)	21 (14.9)

In the chicken samples, those which were obtained from the traditional market had the highest prevalence of Campylobacter spp. (70%), followed by the after evisceration step in the slaughterhouse (62%), the breast package (40%), and the 24-hr after chilling step in the slaughterhouse (24%) samples. Furthermore, in the turkey samples, the isolation rate of the Campylobacter spp. was higher in the traditional market samples (36.6%) than in the breast package samples (22.5%). Among the red meat samples, the contamination of meat with Campylobacter spp. in the samples of after 24-hr chilling at 4°C step was lower than the samples of after final wash step obtained from the slaughterhouse. Pearson chi-square test highlighted the efficacy of the chilling step in decreasing the rate of Campylobacter spp. infection in all the slaughterhouse samples (p < 0.001). In addition, the samples that originated from the traditional market had more Campylobacter spp. contamination.

Antimicrobial susceptibility testing

C. jejuni and C. coli isolates were only tested through the Kirby–Bauer disk diffusion assay and all of these isolates (79 C. jejuni and 41 C. coli) were resistant to one or more than one antimicrobial agent. The result of the antimicrobial resistance of the isolates is summarized in Table 3. Overall, five isolates (4.2%) were resistant to only one of the antimicrobial agents, and 17 isolates (14.2%) showed resistance to two antimicrobial agents. Multidrug-resistant (MDR) isolates, which were defined as a resistance to three or more than three drugs, were found in 98 Campylobacter spp. isolates (81.6%). On the other hand, the occurrence of MDR isolates in C. coli isolates (90.2%) was generally more than C. jejuni isolates (77.2%). Resistance to ciprofloxacin was the most common of all (82.5%), followed by tetracycline (79.2%) and nalidixic acid (75.8%). The lowest antimicrobial resistance (2.5%) was observed for gentamicin.

Table 3.

Percentage of Campylobacter spp. Isolates Resistant to Various Antimicrobial Agents

			Prevalence of resistance to antimicrobial agents (%)
Species	Biological origin	No. of isolates	Ciprofloxacin	Enrofloxacin	Ampicillin	Erythromycin	Gentamicin	Streptomycin	Tetracycline	Nalidixic acid	Amikacin	Amoxicillin
C. jejuni	Chicken	45	35 (77.8)	14 (31.1)	12 (26.7)	3 (6.7)	1 (2.2)	6 (13.3)	34 (75.5)	33 (73.3)	2 (4.4)	15 (33.3)
	Turkey	9	8 (88.9)	4 (44.4)	4 (44.4)	0 (0)	0 (0)	0 (0)	7 (77.8)	6 (66.7)	0 (0)	3 (33.3)
	Duck	7	6 (85.7)	3 (42.8)	2 (28.5)	1 (14.2)	0 (0)	1 (14.2)	5 (71.4)	5 (71.4)	1 (14.2)	3 (42.8)
	Cattle	6	5 (83.3)	3 (50)	3 (50)	0 (0)	0 (0)	0 (0)	4 (66.7)	6 (100)	0 (0)	1 (16.7)
	Sheep	7	6 (85.7)	3 (42.8)	2 (28.6)	1 (14.3)	0 (0)	5 (71.4)	6 (85.7)	6 (85.7)	1 (14.3)	1 (14.3)
	Milk	5	3 (60)	1 (20)	3 (60)	0 (0)	0 (0)	3 (60)	3 (60)	3 (60)	0 (0)	2 (40)
	Total	79	63 (79.7)	28 (35.4)	26 (32.9)	5 (6.3)	1 (1.3)	15 (19)	59 (74.7)	59 (74.7)	4 (5.1)	40 (33.3)
C. coli	Chicken	16	13 (81.2)	5 (31.2)	7 (43.7)	1 (6.2)	1 (6.2)	3 (18.7)	14 (87.5)	13 (81.2)	2 (12.5)	7 (43.7)
	Turkey	10	10 (100)	4 (40)	4 (40)	0 (0)	0 (0)	2 (20)	9 (90)	7 (70)	0 (0)	3 (30)
	Duck	2	2 (100)	1 (50)	1 (50)	0 (0)	1 (50)	1 (50)	2 (100)	2 (100)	0 (0)	1 (50)
	Cattle	3	3 (100)	2 (66.7)	1 (33.3)	0 (0)	0 (0)	0 (0)	2 (66.7)	2 (66.7)	0 (0)	1 (33.3)
	Sheep	8	6 (75)	3 (37.5)	4 (50)	1 (12.5)	0 (0)	7 (87.5)	8 (100)	6 (75)	0 (0)	3 (37.5)
	Milk	2	2 (100)	1 (50)	0 (0)	0 (0)	0 (0)	2 (100)	1 (50)	1 (50)	1 (50)	0 (0)
	Total	41	36 (87.8)	16 (39)	17 (41.5)	2 (4.9)	2 (4.9)	15 (36.6)	36 (87.9)	32 (78)	3 (7.3)	15 (36.6)
Total		120	99 (82.5)	44 (36.7)	43 (35.8)	7 (5.8)	3 (2.5)	30 (25)	95 (76.2)	91 (75.8)	7 (5.8)	40 (33.3)

A separate evaluation of the differences in resistance to an antibiotic in different isolation sources revealed no statistically significant difference (p > 0.05) except for the isolates obtained from sheep. Resistance to streptomycin in these sheep isolates was significantly higher than resistance to streptomycin in other isolates (p < 0.001). There was no significant difference in the rate of antimicrobial resistance between C. coli and C. jejuni isolates (p > 0.05). The logistic regression showed a statistical correlation between resistances to some antibiotics. Increase in resistance to amoxicillin, tetracycline, streptomycin, and gentamicin lead to an increase in resistance to ampicillin (p = 0.0001), nalidixic acid (p = 0.007), amikacin (p = 0.024), and amikacin (p = 0.036), respectively.

Detection of the virulence genes

The prevalence of the six putative virulence genes in two thermophilic Campylobacter species is shown in Table 4. Among 120 Campylobacter spp. isolates, including 79 C. jejuni and 41 C. coli, the prevalence of waaC, ciaB, and pldA genes was 91.7%, 86.7%, and 80.8%, respectively. In addition, lower rates of occurrence were found for cgtB (45%) and wlaN (26.7%) markers. The plasmid-associated virulence marker, virB11 gene, was not detected in isolates. waaC was the most prevalent gene in C. jejuni (100%) followed by ciaB gene (91.1%), whereas in C. coli, the most prevalent gene was ciaB gene (78%) followed by waaC gene (75.6%). The occurrence of wlaN and cgtB genes, involved in LOS synthesis, varied in two thermophilic Campylobacter isolates. wlaN and cgtB genes were not observed in the same isolate, simultaneously. The logistic regression showed that the presence of the pldA gene can decrease the presence of the cgtB gene (p = 0.034).

Table 4.

Prevalence of the Virulence-Associated Genes in the Campylobacter spp. Isolates

			Prevalence of virulence genes (%)
Species	Biological origin	No. of isolates (%)	virB11	pldA	ciaB	cgtB	wlaN	waaC
C. jejuni	Chicken	45	0 (0)	44 (97.8)	45 (100)	16 (35.6)	14 (31.1)	45 (100)
	Turkey	9	0 (0)	7 (77.8)	7 (77.8)	5 (55.6)	2 (22.2)	9 (100)
	Duck	7	0 (0)	7 (100)	7 (100)	2 (28.6)	3 (42.8)	7 (100)
	Cattle	6	0 (0)	3 (50)	4 (66.7)	5 (83.3)	1 (16.7)	6 (100)
	Sheep	7	0 (0)	5 (71.4)	5 (71.4)	6 (85.7)	1 (14.3)	7 (100)
	Milk	5	0 (0)	2 (40)	4 (80)	3 (60)	0 (0)	5 (100)
	Total	79	0 (0)	68 (86.1)	72 (91.1)	35 (44.3)	21 (26.6)	79 (100)
C. coli	Chicken	16	0 (0)	14 (87.5)	14 (87.5)	6 (37.5)	6 (37.5)	12 (75)
	Turkey	10	0 (0)	9 (90)	9 (90)	3 (30)	1 (10)	8 (80)
	Duck	2	0 (0)	1 (50)	2 (100)	1 (50)	1 (50)	1 (50)
	Cattle	3	0 (0)	1 (33.3)	2 (66.7)	2 (66.7)	1 (33.3)	3 (100)
	Sheep	8	0 (0)	3 (37.5)	4 (50)	6 (75)	2 (25)	6 (75)
	Milk	2	0 (0)	1 (50)	1 (50)	1 (50)	1 (50)	1 (50)
	Total	41	0 (0)	29 (70.7)	32 (78)	19 (46.3)	11 (26.8)	31 (75.6)
Total		120	0 (0)	97 (80.8)	104 (86.7)	54 (45)	32 (26.7)	110 (91.7)

No strong correlation was observed between resistance to antibiotics and the presence of the virulence genes surveyed in this research, using the Cramer's V analysis. Only, weak relationships were observed between the tetracycline and pldA gene (0.18), streptomycin and pldA gene (0.2), ampicillin and cgtB gene (0.19), and enrofloxacin and wlaN gene (0.17).

Discussion

The results of this study indicated that the poultry meat, especially the chicken meat, is the main source of Campylobacter species followed by red meat and raw milk samples. In general, these results were consistent with the findings of previous studies on poultry meat, red meat, and raw milk. Panzenhagen et al. isolated Campylobacter spp. in 45% of the poultry carcasses in Brazil.³³ In addition, Kashoma et al. showed the contamination of Campylobacter spp. in 9.5% of beef carcasses in Tanzania.¹⁵ Furthermore, a low rate of contamination (2.91%) was also reported in milk samples.³⁴ However, many studies suggested that there are variations in the Campylobacter spp. contamination rates among countries. Economou et al. isolated Campylobacter spp. in 29% of chicken meat samples in Greece,³⁵ whereas Wei et al. observed a high frequency of Campylobacter spp. contamination (80.1%) in South Korea.⁵ Jamali et al., and Zendehbad et al. suggested that these differences could be due to the variations in geographical and seasonal factors, type and number of the samples, isolation methods, transport conditions, and different sanitary conditions on farms and slaughterhouses^36,37; therefore, finding a direct correlation among various studies might be difficult. No Campylobacter spp. contamination was detected in the fish samples in this study. This result might be due to the temperature of the water that is not favorable for thermophilic Campylobacters.

The results showed that the poultry meat obtained from the traditional markets frequently was much contaminated with Campylobacters than the meat package samples. It should also be noted that poultry meat in the traditional market can become more contaminated during the manual slaughter of poultry–more commonly during the evisceration stage–as the carcasses of the poultry are polluted with intestinal microorganisms. In addition, the water, which is used in these types of markets, is almost unhygienic water and Campylobacters can easily be circulated in this environment and spread on the surface of carcasses.^10,38 Using the chlorinated water, increasing health condition, and decreasing the temperature (freezing and chilling) can significantly reduce carcass contamination. These factors are more observed in the large-scale slaughterhouse.^38,39

In addition, as it was expected, the C. jejuni was the predominant species in this research and this was consistent with several studies.^33,37,39 However, an increased occurrence of the C. coli was observed in the sheep isolates in this research. This difference could be due to different husbandry systems. Most sheep herds are grazing in the pasture and this type of husbandry system increases exposure to multiple sources of contamination.⁴⁰ In this case, the environmental sources like natural water ponds can be polluted with swine and boar wastes and slurries. C. coli is one of the most common Campylobacter species that was found in these animals,⁴⁰ hence, it can be concluded that pasture grazing increases the C. coli contamination in sheep. Further ecosystem studies are required to determine the reason for this result.

These results revealed a high frequency of Campylobacter spp. resistance to ciprofloxacin, tetracycline, and nalidixic acid. These high levels of resistances have also been reported in other studies, especially over the last few years.^1,33,36,37 Because of an extensive use of these antibiotics for treatment, control and prevention of diseases at the farm, the selection, and development of antimicrobial-resistant Campylobacters can occur.^5,36 Furthermore, some studies have suggested that the mutation in gyrA, a gene that encodes the DNA gyrase subunit A, is a reason for fluoroquinolones and nalidixic acid resistance. The widespread use of these antibiotics can also increase the rate of gyrA mutation in the Campylobacters.⁴¹

Campylobacter spp. can produce beta-lactamases by bla_OXA-61, bla_OXA-184, and bla_OXA-193. In addition, they can use two major efflux systems, known as the CmeABC and CmeDEF efflux pump, so they can be resistant to penicillin, amoxicillin, and ampicillin.^15,42,43 The moderate resistance to amoxicillin and ampicillin was observed in this research, which reflects this point.

The results showed a higher rate of resistance to streptomycin in isolates obtained from sheep compared to other isolates (p < 0.001). Streptomycin in combination with penicillin (like Pen-strep) is one of the most important drug choices for treatment of pneumonia and other diseases in animals and it is widely used In Iran, especially in the sheep industry. So, the Campylobacters with the property of resistance to penicillin can also be resistant to streptomycin and, thereby, can be selected and spread in the sheep isolates.

Because these isolates can circulate throughout different food animals and finally is transferred to humans, high resistance to different groups of antibiotics in Campylobacter spp. isolates is alarming and important. In addition, these antibiotics, for example, ciprofloxacin, are considered the drugs of choice for treating human campylobacteriosis; hence, the increased resistance of such strains poses a public health problem.¹⁵ Low resistances to gentamicin, amikacin, and erythromycin were observed in this study. The low resistance to these antibiotics could be due to the fact that these antibiotics are rarely used in Iran.³⁷

This study indicated the high level of MDR in Campylobacter spp. isolates. Furthermore, the presence of MDR isolates was more detected in the C. coli isolates than the C. jejuni isolates. Other authors have also found the same finding and suggested that the C. coli strains could acquire horizontal resistance genes better than the C. jejuni isolates and/or those target genes could mutate faster in the C. coli isolates than in the C. jejuni strains.^4,36,37 However, there are a number of reasons related to the mechanism of MDR in Campylobacters. The presence of a major efflux system, as mentioned above, is responsible for resistance to a broad range of antibiotics. Destruction or inactivation of antibiotics (by enzymes encoded by chromosomal or plasmid genes) and low-level access of antimicrobial agents to their targets are the other reasons.⁴²

The results of this research showed a correlation between isolates and resistance to two antibiotics. Whenever an isolate was resistant to an antibiotic (like amoxicillin), the chance of resistance to another antibiotic from the same family (like ampicillin) was higher. It is thus evident that more antibiotic resistance mechanisms are common in a family of antibiotics. For example, if one isolate of C. jejuni can produce class D β-lactamase, it can be resistant to amoxicillin and ampicillin, simultaneously.⁴⁰ It should be mentioned that further experimental evidence is needed to support this conclusion. Decreasing and selecting a better combination of antibiotics for treatment and growth factor in the food-producing animals can be key points for controlling the important issue of antibiotic resistance in the world.¹

Concerning the safety of consumers and the importance of health control program of campylobacteriosis, it is necessary to investigate the virulence properties of Campylobacter spp. as potentially pathogenic bacteria.⁸ The high occurrence of pldA and ciaB genes was observed in this study. Similar to the results of this research, Feodoroff et al. detected the pldA and ciaB genes in 61% and 98% of isolates.⁴⁴ Moreover, Datta et al. reported a high prevalence of pldA gene (88%–100%) in isolates obtained from the broilers.⁴⁵ In an earlier study in Iran, Khoshbakht et al. detected 91.7% of positive isolates for the pldA gene in isolates from poultry feces.⁸ However, in contrast to this approach, a low frequency of pldA gene was observed in a study on sheep and cattle in Iran.⁹ In agreement with the results of other studies,^8,9,46 the plasmid-associated virulence marker, virB11 gene, was not present in any of the isolates in this research. In some other studies, this gene was identified in a very low rate of the tested isolates.^18,19 The nature of the virB11 plasmid and geographical differences may be the reason.⁸

The three LOS-associated genes, wlaN, cgtB, and waaC, were also examined in this study. The high frequency of waaC (91.7%) was found in Campylobacter isolates. In addition, a moderate prevalence of wlaN and cgtB genes was observed. wlaN and cgtB genes produce β-1, 3 galactosyltransferase and along with waaC gene are connected with the Guillain-Barre’ and Miller-Fischer syndromes.^23,24 wlaN and cgtB genes were not observed in isolates, simultaneously. Müller et al. discussed the same results.⁴⁶ They inversely demonstrated that the presence of cgtB and wlaN in the Campylobacter spp. could be due to a specific function of β-1, 3 galactosyltransferases during colonization and invasion processes. However, further in vitro and in vivo investigations are required to prove this theory and elucidate the role of virulence genes in the pathogenesis of Campylobacter spp. infections.

The results obtained from this research showed no correlation between the prevalence of the virulence genes and the Campylobacter species. In addition, using the Cramer's V analysis, no strong correlation was observed between resistance to antibiotics and the presence of virulence genes, which was similar to the results of other studies. Ghunaim et al. detected some interactions between ciaB gene and the expression of antimicrobial resistance to ciprofloxacin and erythromycin.²⁵ However, they also observed no significant correlation between them. Anyway, further genetic investigations are needed to prove the relationship between virulence factors and resistance to antimicrobial agents.

In conclusion, the results indicated that the apparently healthy food animals, and especially poultry, are potential sources for human campylobacteriosis. In addition, the results showed that the Campylobacter spp. contamination in the fish products is rare. However, the majority of the Campylobacter spp. isolates obtained in this study were MDR and had putative virulence genes. These data are alarming and raise public health concern, and increase the attention to the widespread use of antibiotics. Hence, to decrease contamination of meat, it is necessary to apply good hygienic standards and food safety assurance programs in the entire slaughtering process and milk bulk centers. Also, effective criteria should be implemented to reduce using antibiotics in the veterinary industry.

Footnotes

Acknowledgments

This work was supported by Golestan University of Medical Sciences, Gorgan, Iran, and Faculty of Veterinary Medicine, Amol University of Special Modern Technologies, Amol, Iran.

Disclosure Statement

No competing financial interests exist.

References

Fraqueza

M.J.

, Ribeiro

S.A.

, Pereira

S.C.

, Fernandes

M.H.

, Fernandes

M.J.

, and Barreto

A.S.

. 2016. Genetic and antibiotic resistance profiles of thermophilic Campylobacter spp. isolated from quails (Coturnix coturnix japonica) in a Portuguese slaughterhouse. Food Control, 59:337–344.

World Health Organization (WHO). 2013. The global view of campylobacteriosis: report of an expert consultation. Utrecht, Netherlands, 9–11 July 2012. Available at www.who.int/iris/bitstream/10665/80751/1/9789241564601_eng

Boughattas

, and Salehi

. 2014. Molecular approaches for detection and identification of foodborne pathogens. J. Food Qual. Hazards Control, 1:1–6.

EFSA (European Food Safety Authority), and ECDC (European Centre for Disease Prevention and Control). 2014. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2012. EFSA J., 12:312.

Wei

, Cha

, Yoon

, Kang

, Roh

, Seo

, Lee

, and Jang

. 2016. Prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail chicken and duck meat in South Korea. Food Control, 62:63–68.

Zhong

, Wu

, Zhang

, and Shen

. 2016. Prevalence, genetic diversity and antimicrobial susceptibility of Campylobacter jejuni isolated from retail food in China. Food Control, 62:10–15.

EFSA. 2010. Analysis of the baseline survey on the prevalence of Campylobacter in broiler batches and of Campylobacter and Salmonella on broiler carcasses in the EU, 2008. Part A: Campylobacter and Salmonella prevalence estimates. EFSA J., 8:1503.

Khoshbakht

, Tabatabaei

, Hosseinzadeh

, Shekarforoush

S.S.

, and Shirzad Aski

. 2013. Distribution of nine virulence-associated genes in Campylobacter jejuni and C. coli isolated from broiler feces in Shiraz, Southern Iran. Foodborne Pathog. Dis., 10:764–770.

Khoshbakht

, Tabatabaei

, Shirzad Aski

, and Hosseinzadeh

. 2014. Occurrence of virulence genes and strain diversity of thermophilic Campylobacters isolated from cattle and sheep faecal samples. Iran. J. Vet. Res., 15:138–144.

10.

Maktabi

, Pourmehdi

, Zarei

, and Moalemian

. 2015. Occurrence and antibiotic resistance of Listeria monocytogenes in retail minced beef distributed in Ahvaz, South-West of Iran. J. Food Qual. Hazards Control, 2:101–106.

11.

Abdollahpour

, Zendehbad

, Alipour

, and Khayatzadeh

. 2015. Wild-bird feces as a source of Campylobacter jejuni infection in children's playgrounds in Iran. Food Control, 50:378–381.

12.

Chen

, Naren

G.W.

, Wu

C.M.

, Wang

, Dai

, Xia

L.N.

, Luo

P.J.

, Zhang

, and Shen

J.Z.

. 2010. Prevalence and antimicrobial resistance of Campylobacter isolates in broilers from China. Vet. Microbiol., 144:133–139.

13.

Mavri

, Ribič

, and Možina

S.S.

. 2016. The biocide and antibiotic resistance in Campylobacter jejuni and Campylobacter coli. In Nedović

, et al. (ed.), Emerging and traditional technologies for safe, healthy and quality food, food engineering series. Cham, Switzerland, Springer International Publishing, pp. 269–283.

14.

Allos

B.M.

2001. Campylobacter jejuni infections: update on emerging issues and trends. Clin. Infect. Dis., 32:1201–1206.

15.

Kashoma

I.P.B.

, Kassem

I.I.

, John

, Kessy

, Gebreyes

, Kazwala

R.R.

, and Rajashekara

. 2015. Prevalence and antimicrobial resistance of Campylobacter isolated from dressed beef carcasses and raw milk in Tanzania. Microb. Drug Resist., 22:40–52.

16.

Agunos

, Leger

, Avery

B.P.

, Parmley

E.J.

, Deckert

, Carson

C.A.

, and Dutil

. 2013. Ciprofloxacin-resistant Campylobacter spp. in retail chicken, Western Canada. Emerg. Infect. Dis., 19:1121–1124.

17.

Nobile

C.G.A.

, Costantino

, Bianco

, Pileggi

, and Pavia

. 2013. Prevalence and pattern of antibiotic resistance of Campylobacter spp. in poultry meat in Southern Italy. Food Control, 32:715–718.

18.

Datta

, Niwa

, and Itoh

. 2003. Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. J. Med. Microbiol., 52:345–348.

19.

Bang

D.D.

, Scheutz

, Ahrens

, Pedersen

, Blom

, and Madsen

. 2001. Prevalence of cytolethal distending toxin (cdt) genes and CDT production in Campylobacter spp. isolated from Danish broilers. J. Med. Microbiol., 50:1087–1094.

20.

Konkel

M.E.

, Kim

B.J.

, Rivera-Amil

, and Garvis

S.G.

. 1999. Identification of proteins required for the internalization of Campylobacter jejuni into cultured mammalian cells. Adv. Exp. Med. Biol., 473:215–224.

21.

Ziprin

R.L.

, Young

C.R.

, Byrd

J.A.

, Stanker

L.H.

, Hume

M.E.

, Gray

S.A.

, Kim

B.J.

, and Konkel

M.E.

. 2001. Role of Campylobacter jejuni potential virulence genes in cecal colonization. Avian Dis., 45:549–557.

22.

Bacon

D.J.

, Alm

R.A.

, Burr

D.H.

, Hu

, Kopecko

D.J.

, Ewing

C.P.

, Trust

T.J.

, and Guerry

. 2000. Involvement of a plasmid in virulence of Campylobacter jejuni 81–176. Infect. Immun., 68:4384–4390.

23.

Gilbert

, Brisson

J.R.

, Karwaski

M.F.

, Michniewicz

, Cunningham

A.M.

, Wu

, Young

N.M.

, and Wakarchuk

W.W.

. 2000. Biosynthesis of ganglioside mimics in Campylobacter jejuni OH4384. Identification of the glycosyltransferase genes, enzymatic synthesis of model compounds, and characterization of nanomole amounts by 600-mhz (1)h and (13)c NMR analysis. J. Biol. Chem., 275:3896–3906.

24.

Linton

, Gilbert

, Hitchen

P.G.

, Dell

, Morris

H.R.

, Wakarchuk

W.W.

, Gregson

N.A.

, and Wren

B.W.

. 2000. Phase variation of a beta-1,3 galactosyltransferase involved in generation of the ganglioside GM1-like lipo-oligosaccharide of Campylobacter jejuni. Mol. Microbiol., 37:501–514.

25.

Ghunaim

, Behnke

J.M.

, Aigha

, Sharma

, Doiphode

S.H.

, Deshmukh

, and Abu-Madi

M.M.

. 2015. Analysis of resistance to antimicrobials and presence of virulence/stress response genes in Campylobacter isolates from patients with severe diarrhoea. PLoS One, 10:e0119268.

26.

Helms

, Simonses

, Olson

, Mølbak

. 2005. Adverse health effects associated with antimicrobial drug resistance in Campylobacter species: a registry-based cohort study. J. Infect. Dis., 191:1050–1055.

27.

Lapierre

, Gatica

M.D.L.A.

, Riquelme

, Vergara

, Yañez

J.M.

, San Martín

, Sáenz

, Vidal

, Martínez

M.C.

, Araya

, and Flores

. 2016. Characterization of antimicrobial susceptibility and its association with virulence genes related to adherence, invasion, and cytotoxicity in Campylobacter jejuni and Campylobacter coli isolates from animals, meat, and humans. Microb. Drug Resist., 22:432–444.

28.

EN/ISO 10272-1. 2006. Microbiology of food and animal feeding stuffs–horizontal method for detection and enumeration of Campylobacter spp.—Part 1: detection method International organization for standardization. Geneve, Switzerland.

29.

Linton

, Lawson

, Owen

, and Stanley

. 1997. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol., 35:2568–2572.

30.

Gonzalez

, Grant

K.A.

, Richardson

P.T.

, Park

S.F.

, and Collins

M.D.

. 1997. Specific identification of the enteropathogens Campylobacter jejuni and Campylobacter coli by using a PCR test based on the ceuE gene encoding a putative virulence determinant. J. Clin. Microbiol., 35:759–763.

31.

Stucki

, Frey

, Nicolet

, and Burnens

A.P.

. 1995. Identification of Campylobacter jejuni on the basis of a species-specific gene that encodes a membrane protein. J. Clin. Microbiol., 33:855–859.

32.

Clinical and Laboratory Standards Institute (CLSI). 2013. CLSI document VET01-A4–Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals; approved standard. 4th ed., Vol. 33, pp. 80. Wayne, PA.

33.

Panzenhagen

P.H.N.

, Aguiar

W.S.

, Frasao

B.S.

, Pereira

V.L.A.

, Abreu

D.L.C.

, Rodrigues

D.P.

, do Nascimentoa

E.R.

, and de Aquinoa

M.H.C.

. 2016. Prevalence and fluoroquinolones resistance of Campylobacter and Salmonella isolates from poultry carcasses in Rio de Janeiro, Brazil. Food Control, 61:243–247.

34.

Modi

, Brahmbhatt

M.N.

, Chatur

Y.A.

, and Nayak

J.B.

. 2015. Prevalence of Campylobacter species in milk and milk products, their virulence gene profile and antibiogram. Vet. World, 8:1–8.

35.

Economou

, Zisides

, Gousia

, Petsios

, Sakkas

, Soultos

, and Papadopoulou

. 2015. Prevalence and antimicrobial profile of Campylobacter isolates from free-range and conventional farming chicken meat during a 6-year survey. Food Control, 56:161–168.

36.

Jamali

, Ghaderpour

, Radmehr

, Wei

K.S.C.

, Ching

C.L.

, and Ismail

, 2015. Prevalence and antimicrobial resistance of Campylobacter species isolates in ducks and geese. Food Control, 50:328–330.

37.

Zendehbad

, Arian

A.A.

, and Alipour

. 2013. Identification and antimicrobial resistance of Campylobacter species isolated from poultry meat in Khorasan province, Iran. Food Control, 32:724–727.

38.

Carvalho

A.F.

, da Silva

D.M.

, Azevedo

S.S.

, Piatti

R.M.

, Genovez

M.E.

, and Scarcelli

. 2013. Detection of CDT toxin genes in Campylobacter spp. strains isolated from broiler carcasses and vegetables in São Paulo, Brazil. Braz. J. Microbiol., 44:693–699.

39.

Huang

, Zong

, Zhao

, Zhu

, and Jiao

. 2016. Quantitative surveys of Salmonella and Campylobacter on retail raw chicken in Yangzhou, China. Food Control, 59:68–73.

40.

Oporto

, Esteban

J.I.

, Aduriz

, Juste

R.A.

, and Hurtado

. 2007. Prevalence and strain diversity of thermophilic Campylobacters in cattle, sheep and swine farms. J. Appl. Microbiol., 103:977–984.

41.

Jesse

T.W.

, Englen

M.D.

, Pittenger-Alley

L.G.

, and Fedorka-Cray

P.J.

. 2006. Two distinct mutations in gyrA lead to ciprofloxacin and nalidixic acid resistance in Campylobacter coli and Campylobacter jejuni isolated from chickens and beef cattle. J. Appl. Microbiol., 100:682–688.

42.

Alfredson

2005. Characterisation of the B-lactamase gene from Campylobacter jejuni. PhD thesis. Available at www.120.secure.griffith.edu.au/rch/file/29902e76-dd9e-74fd-45ef-d19eb9a4b86b/1/01Front.pdf (Australia: Institute for Glycomics, Griffith University, Online).

43.

Martinez

A.D.L.

, and Lin

. 2006. Effect of an efflux pump inhibitor on the function of the multidrug efflux pump CmeABC and antimicrobial resistance in Campylobacter. Foodborne Pathog. Dis., 3:393–402.

44.

Feodoroff

, Ellstrom

, Hyytiainen

, Sarna

, Hanninen

M.L.

, and Rautelin

. 2010. Campylobacter jejuni isolates in Finnish patients differ according to the origin of infection. Gut Pathog., 2:22–32.

45.

Datta

, Niwa

, and Itoh

. 2009. Age-dependent variation of virulence-associated genes retained in Campylobacter jejuni isolated from chickens in a poultry farm. J. Vet. Med. Sci., 71:1247–1249.

46.

Müller

, Schulze

, Müller

, and Hänel

. 2006. PCR detection of virulence-associated genes in Campylobacter jejuni strains with differential ability to invade Caco-2 cells and to colonize the chick gut. Vet. Microbiol., 113:123–129.

47.

Wassenaar

T.M.

, Wagenaar

J.A.

, Rigter

, Fearnley

, Newell

D.G.

, and Duim

. 2002. Homonucleotide stretches in chromosomal DNA of Campylobacter jejuni display high frequency polymorphism as detected by direct PCR analysis. FEMS Microbiol. Lett., 212:77–85.

48.

Godschalk

P.C.

, van Belkum

, van den Braak

, van Netten

, Ang

C.W.

, Jacobs

B.C.

, Gilbert

, and Endtz

H.P.

. 2007. PCR-restriction fragment length polymorphism analysis of Campylobacter jejuni genes involved in lipooligosaccharide biosynthesis identifies putative molecular markers for Guillain-Barré syndrome. J. Clin. Microbiol., 45:2316–2320.