Incidence and Genetic Bases of Nitrofurantoin Resistance in Clinical Isolates of Two Successful Multidrug-Resistant Clones of Salmonella enterica Serovar Typhimurium: Pandemic “DT 104” and pUO-StVR2

Abstract

In this study, the incidence and genetic bases of nitrofurantoin resistance were established for clinical isolates of two successful clones of Salmonella enterica serovar Typhimurium, the pandemic “DT 104” and the pUO-StVR2 clone. A total of 61 “DT 104” and 40 pUO-StVR2 isolates recovered from clinical samples during 2008–2014 and assigned to different phage types, were tested for nitrofurantoin susceptibility. As previously shown for older isolates, all newly tested pUO-StVR2 isolates were highly resistant to nitrofurantoin (minimal inhibitory concentration [MIC] of 128 μg/ml), while 42.6%, 24.6%, and 32.8% of the “DT 104” isolates were susceptible, showed intermediate resistance or were highly resistant, with MICs of 8, 64, and 128 μg/ml, respectively. The genetic bases of nitrofurantoin resistance were established by PCR amplification and sequencing of the nfsA and nfsB genes encoding oxygen-insensitive nitroreductases. pUO-StVR2 isolates shared identical alterations in both nfsA (IS1 inserted into the coding region) and nfsB (in frame duplication of two codons). “DT 104” isolates with intermediate or high resistance had a missense mutation affecting the start codon of nfsA, while a single resistant isolate carried an additional frameshift mutation affecting nfsB. Complementation studies, performed with wild-type nfsA and nfsB, cloned independently and together into low and high copy-number vectors, confirmed NfsA and NfsB as responsible for nitrofurantoin toxicity. The same alterations persisted along time in isolates of each clone belonging to different phage types. Accordingly, changes leading to nitrofurantoin resistance have probably occurred before phage type diversification.

Introduction

Nitrofurans are a class of synthetic chemotherapeutic agents consisting of an aromatic or heterocyclic backbone with one or more nitro groups.¹ Nitrofurantoin and nitrofurazone are clinically useful against a wide spectrum of Gram-positive and Gram-negative bacteria, including many strains of common urinary tract pathogens.² Nitrofurans have also been employed in veterinary medicine and as food additives for growth promotion of livestock, but the latter application was banned in the European Union since mid 1995, due to concerns about the presence in food products of residues with carcinogenic properties.^3,4

The specific mechanism of action of nitrofurans remains unknown, although studies in Escherichia coli revealed that they have to be reduced to show antimicrobial activity. Two types of nitroreductase activities, oxygen-insensitive (type I) and oxygen-sensitive (type II), were detected in E. coli.^1,5 Type I enzymes, encoded by the chromosomal nfsA and nfsB genes, reduce the nitro moiety of nitrofurans yielding biologically inactive end products. This process occurs through a sequence of intermediates, including nitroso and hydroxylamine states, which are assumed to be responsible for toxicity.^6,7 Requirement of nitrofuran reduction by type I enzymes for antimicrobial activity is supported by in vitro isolation and characterization of E. coli-resistant mutants, in which a stepwise increase in resistance was correlated with a decrease in the reductive capability associated with sequential inactivation of the nfsA and nfsB nitroreductase genes.^8–11

Non-typhoidal serovars of Salmonella enterica represent one of the major causes of worldwide foodborne disease, which mainly results from consumption of contaminated products of animal origin.¹² Occasionally, particularly in young children, the elderly and immunocompromised persons, they can cause invasive and focal extra intestinal infections, including urinary tract infections. Although S. enterica is naturally susceptible to nitrofurans,¹³ decreased susceptibility or resistance was observed in isolates from human and non-human sources, mainly belonging to serovars Enteritidis and Typhimurium.^14–16 It has been proposed that the use of nitrofurans in food-producing animals could have contributed to the emergence and persistence of successful variants of both serovars, such as Salmonella Enteritidis phage type (PT) 4 and two multidrug-resistant clones of Salmonella Typhimurium, the pandemic definitive phage type (DT) 104 and a clone carrying a resistance derivative of the virulence plasmid pSLT, termed pUO-StVR2, which is widespread in Spain and Portugal and has also been detected in other European countries.^14,16–19 Both clones are characteristically resistant to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracyclines, but the responsible genes, and their location, are different. In DT 104 the resistance phenotype is associated with bla_PSE-1, floR, aadA2, sul1, and tet(G) genes, located on a chromosomal region known as Salmonella Genomic island 1.²⁰ The same resistance pattern has been associated with other Salmonella Typhimurium phage types, consistent with mobilization of the island by IncA/C plasmids and/or changes in phage susceptibility.^21,22 In the case of the pUO-StVR2 clone, the resistance phenotype is conferred by bla_OXA-1, catA1, aadA1, sul1, and tet(B) genes carried by the plasmid.²³ Moreover, according to disk diffusion assays, most Spanish “DT 104” isolates tested so far were either susceptible or showed intermediate resistance to nitrofurantoin while all pUO-StVR2 isolates were fully resistant.¹⁶

Like in E. coli, studies with Salmonella Enteritidis PT4 revealed that nitrofuran reductase activity was inversely co-related to the minimal inhibitory concentration (MIC) of furazolidone.²⁴ Information on the genetic bases of nitrofurantoin resistance are lacking for both Salmonella Enteritidis and Salmonella Typhimurium, which are the most common serovars of S. enterica. In this study, we broaden our knowledge on the incidence of nitrofurantoin resistance in the Salmonella Typhimurium “DT 104” and pUO-StVR2 clones by analyzing clinical isolates from the 2008 to 2014 period, and established the genetic bases of the observed resistances.

Materials and Methods

Bacterial isolates and assignment to the definitive phage type (DT) 104 and pUO-StVR2 clones

A total of 101 Salmonella Typhimurium isolates belonging to the pandemic “DT 104” (61) and pUO-StVR2 clones (40) and assigned to different phage types, were used in this study (Table 1). They comprised all isolates of each clone recovered along the 2008–2014 period from clinical samples (feces, urine, or blood) at different hospitals of Asturias and recorded at the Laboratory of Public Health (LSP) of this region. The serotype and phage type of the isolates were determined at the “Centro Nacional de Microbiología,” Madrid, Spain. Allocation to one of the clones was accomplished as reported.¹⁹ The oldest “DT 104” (LSP 14/92) and pUO-StVR2 (LSP 31/93) isolates available in our laboratory, and one isolate used as representative of the pUO-StVR2 clone in previous studies (LSP 146/02), were included for comparison.^19,23 Salmonella Typhimurium ATCC 14028 was used as susceptible control.²⁵

Table 1.

Susceptibility to Nitrofurantoin and Minimal Inhibitory Concentrations of “DT 104” and pUO-StVR2 Isolates with Different Phage Types

Isolate^a (N)	Origin (N)	Phage type (N)	Susceptibility^b (N)	MIC^c μg/ml (n)
“DT 104” clone
LSP 14/92	Feces	DT 104	S	8
2008–2014 (60)	Feces (58)	DT 104 (8), DT 302 (6), DT 310 (2), DT 82, DT 104 L, DT 138, DT 274, DT 311, RDNC, NT	S (23)	8 (10)
		DT 302 (6), DT 104 (3), DT 104 L (2), DT 310 (2), DT 12, DT 138	I (15)	64 (15)
		DT 302 (8), DT 104 (5), DT 104 L (3), DT 12, DT 310, DT 311, RDNC	R (20)	128 (20)
	Urine	DT 302	S	8
	Blood	DT 302	S	8
pUO-StVR2 clone
LSP 31/93	Feces	DT 104b	R	128
LSP 146/02	Feces	RDNC	R	128
2008–2014 (38)	Feces (33)	DT 104 (22), DT 120 (2), DT 302 (2), DT 311 (3), RDNC (2), DT 281, NT	R (33)	128 (7)
	Blood (5)	DT 104 (4), DT 311	R (5)	128 (5)
ATCC 14028	unk	unk	S	8

N, total number of isolates when more than one; n, number of isolates tested when more than one.

The two clones and the control strain tested are highlighted in bold.

Isolates are termed with LSP, followed by a serial number and the last two digits of the year of isolation.

Results according to the disk diffusion method. S, susceptibility; I, intermediate resistance; R, resistance.

MICs were determined by broth dilution with concentrations ranging from 4 to 512 μg/ml. Results were interpreted according to CLSI criteria.²⁶

DT, definitive phage type; MIC, minimal inhibitory concentration; NT, non-typeable; LSP, Laboratory of Public Health; RDNC, reacts but does not conform; unk, unknown.

Determination of nitrofurantoin susceptibility

Susceptibility to nitrofurantoin was determined by the disk diffusion assay on Mueller–Hinton agar using commercially available disks with 300 μg of the antimicrobial (Oxoid). Breakpoints were scored following the interpretative criteria of the CLSI.²⁶ MICs were also determined for most isolates (Table 1), using a broth dilution method with concentrations ranging from 4 to 512 μg/ml. Results were also interpreted according to CLSI criteria.²⁶

Amplification and sequencing of the nfsA and nfsB genes

The nfsA and nfsB genes of all isolates were amplified by PCR. Primers (Table 2) were designed according to the corresponding genes of Salmonella Typhimurium ATCC 14028, for which the whole genome sequence is available (Acc. No. CP001363.1). Aliquots of each isolate (2–5 μl) grown overnight in Luria-Bertani broth at 37°C and boiled for 5 min were used as the source of the template DNA. Amplification conditions consisted of a hot start step of 94°C for 5 min, followed by 30 cycles of 94°C for 30 sec (denaturation), 60°C (nfsA), or 58°C (nfsB) for 30 sec (annealing), and 72°C for 2 min (elongation), finishing with a final extension step of 72°C for 10 min. Fragments amplified from 24 isolates selected on the bases of nitrofurantoin resistance phenotypes, year of isolation and phage type (Table 3), were purified using the StrataPrep PCR Purification Kit (Agilent Technologies), and sequenced at Macrogen Europe. Sequences were analyzed by BLASTN and BLASTX.²⁷ Nucleotide and protein alignments were performed with ClustalW with default parameters.²⁸

Table 2.

Oligonucleotides Used in the Present Study

Primer	Sequence 5′-3′	Target	T (°C)	Amplicon size (bp)
nfsA-F	CTGGCGCTTGCTCTGCTATC	nfsA	60	964
nfsA-R	GCCCGCGTATCATACACTGG
nfsB-F	ATCACCGTCTCGCTACTCAAC	nfsB	58	921
nfsB-R	CGCGCCATTGATCATTGAGG
KpnInfsApWKS130-F	CGGGGTACCCTGGCGCTTGCTCTGCTATC	nfsA	60	964
XbaInfsApWKS130-R	TGCTCTAGAGCCCGCGTATCATACACTGG
EcoRInfsBpWKS130-F	CCGGAATTCATCACCGTCTCGCTACTCAAC	nfsB	58	921
XbaInfsBpWKS130-R	GCTCTAGACGCGCCATTGATCATTGAGG
XbaInfsApUK1921-F	TGCTCTAGACTGGCGCTTGCTCTGCTATC	nfsA	60	964
KpnInfsApUK1921-R	CGGGGTACCGCCCGCGTATCATACACTGG
XbaInfsBpUK1921-F	TGCTCTAGATCACCGTCTCGCTACTCAAC	nfsB	58	921
EcoRInfsBpUK1921-R	GCGAATTCCGCGCCATTGATCATTGAGG

Primers nfsA-F/nfsA-R and nfsB-F/nfsB-R were used for PCR amplification of the nfsA and nfsB genes, respectively. The remaining primers were designed for cloning of nfsA and nfsB into the pWKS130 and pUK1921 vectors. These primers incorporate recognition sites for restriction enzymes toward the 5′-end (underlined in the sequences). The restriction enzyme, name of the gene to be cloned and name of the vector are indicated in the designation of each primer.

F, forward; R, reverse.

Table 3.

Inactivating Mutations and Complementation Studies in Nitrofurantoin-Resistant Mutants of the “DT 104” and pUO-StVR2 Clones

			Inactivating mutations
Isolate (origin) ^a	Phage type	MIC (μg/ml)	nfsA (723 bp)/NfsA (240 αα)	nfsB (654 bp)/NfsB (217αα)
ATCC 14028	unk	8	wt	wt
+ vector		8
+ vector::nfsA		8
+ vector::nfsB		8
+ vector::nfsA+B		8
“DT 104” clone
Susceptible
LSP 14/92 (F)	DT 104	8	wt	wt
+ vector		8
+ vector::nfsA		8
+ vector::nfsB		8
+ vector::nfsA+B		8
Intermediate
LSP 77/08 (F)	DT 104	64	start ATG^1–3→ATA/Met¹→Ile	wt
+ vector		64
+ vector::nfsA		8
+ vector::nfsB		8
+ vector::nfsA+B		8
LSP 97/11 (F)	DT 104	64	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 86/12 (F)	DT 104	64	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 185/10 (F)	DT 302	64	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 179/09 (F)	DT 310	64	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 169/08 (F)	DT 138	64	start ATG^1–3→ATA/Met¹→Ile	wt
Resistant
LSP 176/08 (F)	DT 104	128	start ATG^1–3→ATA/Met¹→Ile	wt
+ vector		128
+ vector::nfsA		8
+ vector::nfsB		8
+ vector::nfsA+B		8
LSP 135/11 (F)	DT 104	128	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 178/11 (F)	DT 104	128	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 198/11 (F)	DT 104	128	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 173/08 (F)	DT 311	128	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 53/13 (F)	DT 302	128	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 235/14 (F)	DT 12	128	start ATG^1–3→ATA/Met¹→Ile	wt
LSP 47/12 (F)	DT 104	128	start ATG^1–3→ATA/Met¹→Ile	Ins C after nt 602/frame-shift after Ala²⁰¹
+ vector		128
+ vector::nfsA		32
+ vector::nfsB		32
+ vector::nfsA+B		8
pUO-StVR2 clone
Resistant
LSP 31/93 (F)	DT 104b	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹
LSP 146/02 (F)	RDNC	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹
+ vector		128
+ vector::nfsA		32
+ vector::nfsB		32
+ vector::nfsA+B		16
LSP 41/09 (B)	DT 104	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹
LSP 175/11 (F)	DT 104	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹
LSP 122/13 (F)	DT 120	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹
LSP 223/10 (F)	DT 281	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹
LSP 207/08 (F)	DT 302	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹
LSP 171/08 (B)	DT 311	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹
LSP 240/10 (F)	DT 311	128	Ins IS1 (768 bp) after nt 421	Ins ATGGAT after nt 268/Dupl Met⁹⁰ Asp⁹¹

The two clones and the control strain tested are highlighted in bold.

Isolates are termed with LSP, followed by a serial number and the last two digits of the year of isolation. They were collected from feces (F) or blood (B).

wt, wild type; Ins, insertion; Dupl, duplication.

Cloning and complementation studies

The entire nfsA and nfsB genes of Salmonella Typhimurium ATCC 14028, including the promoter regions, were cloned independently and together into low (pWKS130) and high (pUK1921) copy number vectors.^29,30 Both vectors contain a kanamycin resistance gene as selectable marker, and allow blue/white colony screening for detection of inserted DNA. To facilitate cloning, recognition sites for appropriate restriction enzymes were incorporated toward the 5′-ends of the forward and reverse primers (Table 2). PCR fragments, digested with the suitable enzymes, were ligated into the corresponding sites of the vector, and transformed into competent cells of E. coli DH5α (Invitrogen).³¹ Plasmids carrying each of the two genes were recovered from colonies selected in the presence of kanamycin (50 μg/ml) with XGal (20 μg/ml) and IPTG (200 μg/ml). After sequencing of the inserted genes to prove the absence of PCR-induced mutations, nfsA was recovered from pUK1921::nfsA by double digestion with PstI and SacI and then cloned into pWKS130::nfsB cut with the same enzymes. Similarly, the nfsB gene was released from pWKS130::nfsB by XbaI plus PstI digestion, and inserted into pUK1921::nfsA cut with the same enzymes. Low and high copy number vectors carrying each of the two genes or both together were introduced into representative “DT 104” and pUO-StVR2 isolates (Table 3). In each case, 10 independent transformants were tested for nitrofurantoin susceptibility as indicated above. The same isolates transformed with the empty vectors were included as controls.

Results

Nitrofurantoin susceptibility

Sixty-one isolates of the pandemic Salmonella Typhimurium “DT 104” clone, 40 isolates of the Salmonella Typhimurium pUO-StVR2 clone, and the control strain ATCC 14028 were first tested for nitrofurantoin susceptibility by the disk diffusion method. Consistent with previous results, all isolates of the pUO-StVR2 clone, including LSP 31/93, LSP 146/02, and those recovered along the 2008–2014 period, were highly resistant to nitrofurantoin, whereas 26 (42.6%; including LSP 14/92), 15 (24.6%), and 20 (32.8%) of the “DT 104” isolates were susceptible, showed intermediate resistance or were fully resistant, respectively. The ATCC 14028 control strain was susceptible, as expected (Table 1). MIC values were then determined for the control strain and for most other isolates. Regardless of the year of recovery, clinical sample and phage type, the MIC for susceptible “DT 104” isolates was 8 μg/ml, coinciding with that obtained for ATCC 14028, while the MICs for “DT 104” isolates with intermediate or full resistance were 64 and 128 μg/ml, respectively. The MIC of 128 μg/ml was also obtained for all pUO-StVR2 isolates tested (Table 1).

Genetic bases of the intermediate and high resistance to nitrofurantoin

The nfsA and nfsB genes were amplified from ATCC 14028 and from all “DT 104” and pUO-StVR2 isolates. The nfsA and nfsB fragments obtained from ATCC 14028 were consistent with the expected sizes of 964 and 921 bp, respectively. Similarly sized fragments were obtained for the two genes of all “DT 104” isolates and for the nfsB gene of all pUO-StVR2 isolates. The nfsA amplicons generated from LSP 31/93, LSP 146/02, and all pUO-StVR2 isolates recovered during the 2008–2014 period were considerably larger, of ∼1,400 bp (not shown).

The nucleotide sequences of nfsA and nfsB amplicons obtained from selected isolates were determined (Table 3 and Fig. 1). Starting with “DT 104” (Fig. 1A), the sequences of the nfsA and nfsB amplicons from the susceptible LSP 14/92 isolate were identical to those of the control ATCC 14028. Six “DT 104” isolates tested with intermediate resistance to nitrofurantoin had a single missense mutation affecting the start codon of the nfsA gene (ATG^1–3→ATA; Met¹→Ile), and contained a wild-type nfsB gene. The nfsA gene of eight “DT 104” highly-resistant isolates tested carried the same ATG→ATA mutation, but only one of them contained an additional change in the nfsB gene (insertion of C after nucleotide 602) leading to a frame-shift in the coding region. The other seven isolates did not have any change within the nfsB coding region, 73 bp upstream of the start codon that contain the −10 and −35 sequences of the promoter, or 194 bp downstream of the stop codon.

FIG. 1.

Schematic representation of the wild-type nfsA and nfsB genes of Salmonella enterica serovar Typhimurium, indicating the alterations found in the genes of “DT 104” (A) and pUO-StVR2 isolates (B) with different MICs for nitrofurantoin. The genetic context of the genes is based on accession number CP001363.1. MIC, minimal inhibitory concentration.

With regard to pUO-StVR2 (Table 3 and Fig. 1B), a copy of IS1 was detected in the nine nfsA amplicons of 1,400 bp tested. The insertion sequence was integrated between the 421/422 bp of the coding sequence, thereby disrupting the gene and also changing its frame. The IS1 copy has the expected size (768 bp) and structure, with two partially overlapping orfs (insB and insA) delineated by 23 bp imperfect inverted repeats (20 out of the 23 are identical). The IS1 element is flanked by direct repeats of the 9 bp CTGTTACCG sequence, originally present at the site of insertion within the target DNA. Although the size of the nfsB amplicons obtained from pUO-StVR2 isolates did not differ from that of the ATCC 14028 amplicon, sequence analysis revealed an in frame duplication of six base pairs (ATGGAT) at positions 268–273, and therefore of the two amino acids (Met and Asp) they encode (Fig. 1B).

Restoration of nitrofurantoin susceptibility by the wild-type nfsA and nfsB genes

To prove that the observed alterations were indeed responsible for the intermediate and high resistance phenotypes, the wild-type nfsA and nfsB genes were inserted, independently and together, into low and high copy number vectors. The recombinant plasmids were introduced into representative isolates of the “DT 104” and pUO-StVR2 clones, and the obtained transformants were tested for nitrofurantoin susceptibility (Table 3).

Irrespective of the copy number of the vector, the MIC of the pUO-StVR2 isolates decreased from 128 to 32 μg/ml after transformation with either nfsA or nfsB, and to 16 μg/ml when both wild-type genes were introduced together (Table 3). A similar result was obtained for the resistant “DT 104” isolate with alterations in both nfsA and nfsB. Thus, NfsA and NfsB decreased the MIC of the isolate from 128 to 32 μg/ml, while a further reduction to 8 μg/ml was achieved by NfsA plus NfsB. Interestingly, susceptibility of “DT 104” isolates showing intermediate (64 μg/ml MIC) or high resistance (128 μg/ml MIC) associated with an altered nfsA and a wild-type nfsB, was fully restored after complementation with NfsA, NfsB, or both, reaching MIC values of 8 μg/ml in all cases (Table 3).

Discussion

In the present study, the incidence and genetic bases of nitrofurantoin resistance were established for recent isolates of the pandemic “DT 104” and pUO-StVR2 clones of Salmonella Typhimurium, and the obtained results compared with those corresponding to older isolates. In both clones, decreased susceptibility or high level resistance persisted over time, although the use of nitrofurans as growth promoters in food-producing animals has been banned in the European Union since the first half of the 1990s,^3,4 and they are mainly applied to control urinary tract infections in human medicine. Although it has decreased in the last decade, illegal use of nitrofurans is still being detected in the EU.³² This fact, together with the stability of the chromosomal changes leading to nitrofurantoin resistance, could account for the temporal persistence of the two clones.

In E. coli, a stepwise increase in resistance to nitrofurans was correlated with sequential inactivation of the nfsA and nfsB type I nitroreductase genes.^8–10 Normally, a first step mutation occurs in the nfsA gene and a second step mutation affects nfsB, while alterations in both genes are generally required to achieve full resistance.^10,11 In agreement with this, (1) nfsA and nfsB were both intact in the susceptible “DT 104” isolate tested and in the ATCC 14028 control strain; (2) a single mutation was observed in the nfsA gene of “DT 104” isolates with intermediate resistance; and (3) both nfsA and nfsB were altered in the highly resistant isolates of the pUO-StVR2 clone. However, only nfsA was affected in most of the fully resistant “DT 104” isolates analyzed so far. Exceptional mutants displaying high level resistance to nitrofurantoin despite having a wild-type nfsB gene have already been reported in E. coli.^10,11

All partially and fully resistant isolates of the “DT 104” clone tested so far carried the same mutation shifting the start ATG codon of the nfsA gene to ATA, despite they were recovered along several years and belonged to different phage types. ATA can act as a highly unusual functional start codon both in Salmonella Typhimurium and E. coli, but the efficiency of translation is seriously impaired.^33–35 The ATG to ATA mutation is also present in the genome of a DT 104 isolate of bovine origin that has been fully sequenced,³⁶ and in several unpublished genomes of Salmonella Typhimurium deposited in data bases for which additional information is not available. In the same way, independently of phage type and time of recovery, all pUO-StVR2 isolates tested carried identical alterations in both nfsA (with IS1 inserted at the same position into the coding region) and nfsB (with an in frame duplication of the ATGGAT sequence). Comparisons of the two genes with sequences deposited in databases, revealed a single isolate of Salmonella Typhimurium DT 12 containing identical alterations. This isolate, which genome sequence is accessible, was recovered in Japan and carries part of the pUO-StVR2 DNA inserted into the chromosome.³⁷ In all, results obtained for both “DT 104” and pUO-StVR2 isolates strongly suggest that mutations leading to nitrofurantoin resistance had occurred before phage type diversification. Consistent with this, changes in phage susceptibility of DT 104 into DT 12 and DT 120 have previously been noticed.²² As an alternative explanation, the existence of hot spots in the nfsA and/or nfsB genes of the two clones appears unlikely, considering the great number of different mutations identified in the equivalent genes of E. coli.^10,11,38

Upon introduction of plasmids carrying one or both genes into “DT 104” and pUO-StVR2 mutants, an increase in susceptibility was always observed, confirming that NfsA and NfsB activities were indeed responsible for nitrofurantoin toxicity. Specifically, (1) in highly resistant isolates of the two clones with altered nfsA and nfsB genes, transformation with either of the two wild-type genes resulted in intermediate resistance, but the two wild-type genes were required to achieve full susceptibility; (2) in intermediate or highly resistant “DT 104” isolates with altered nfsA and wild-type nfsB, full susceptibility was restored by NfsA or NfsB in a single step, as well as by NfsA plus NfsB. In these mutants, additional mechanisms conferring resistance to nitrofurantoin, like a nitroreductase activity other than NfsA and NfsB and/or an increased tolerance to toxic intermediates may be involved. However, further investigation will be required to clarify this point; (3) the same results were obtained with the wild-type genes cloned into low or high copy-number vectors; and iv) the lowest MIC values observed for “DT 104” and pUO-StVR2 isolates were 8 and 16 μg/ml, respectively. These results support that there is a limit for bacterial susceptibility to nitrofurantoin, which may be imposed by transport of the compound into the cells, as previously suggested for E. coli.¹⁰

In conclusion, the genetic bases of nitrofurantoin resistance were established for two of the most successful clones of Salmonella Typhimurium. Before this study, information in S. enterica was only available for an emergent strain of Salmonella Infantis, in which a nonsense mutation in the nfsA gene was responsible for nitrofurantoin resistance.³⁹

Footnotes

Acknowledgments

This work has been supported by project FIS PI11-00808 (“Fondo de Investigación Sanitaria, Instituto de Salud Carlos III, Ministerio de Economía y Competitividad, Spain”) co-funded by European Regional Development Fund of the European Union: a way to making Europe. I. Montero was the recipient of predoctoral grant from the “Fundación para el Fomento en Asturias de la Investigación Científica Aplicada y la Tecnología” (FICYT BP09-069).

Disclosure Statement

All authors disclose no commercial associations that might create a conflict of interest in connection with this study.

References

McCalla

D.R.

1979. Nitrofurans. In Hahn

F.E.

(ed.), Antibiotics, vol. 1, 1st edition. Springer-Verlag, New York, pp. 176–213.

Guay

D.R.

2001. An update on the role of nitrofurans in the management of urinary tract infections. Drugs, 61:353–364.

European Commission. Regulation 2901 / 93 / EEC of the Council of 18 October 1993 on amending Annexes I, II, II I and IV to Regulation (EEC) No. 2377 / 90 laying down a Community procedure for the establishment of maximum residue limits of veterinary medicinal products in food stuffs of animal origin. Official J., 1993; No. L 264/1.

European Commission. Regulation 1442 / 95 /EC of the Commission of 26 June on amending Annexes I, II, III and IV of Council Regulation (EEC) No. 2377 / 90 laying down a Community procedure for the establishment of maximum residue limits of veterinary medicinal products in foodstuffs of animal origin. Official J., 1995; No. L 143/26.

Peterson

F.J.

, Mason

R.P.

, Hovsepian

, and Holtzman

J.L.

. 1979. Oxygen-sensitive and -insensitive nitroreduction by Escherichia coli and rat hepatic microsomes. J. Biol. Chem., 254:4009–4014.

McCalla

D.R.

, Olive

, Tu

, and Fan

M.L.

. 1975. Nitrofurazone-reducing enzymes in E. coli and their role in drug activation in vivo. Can. J. Microbiol., 21:1484–1491.

, and McCalla

D.R.

. 1975. Effect of activated nitrofurans on DNA. Biochim. Biophys. Acta, 402:142–149.

McCalla

D.R.

, Reuvers

, and Kaiser

. 1970. Mode of action of nitrofurazone. J. Bacteriol., 104:1126–1134.

Breeze

A.S.

, and Obaseiki-Ebor

E.E.

. 1983. Nitrofuran reductase activity in nitrofurantoin-resistant strains of Escherichia coli K12: some with chromosomally determined resistance and others carrying R-plasmids. J. Antimicrob. Chemother., 12:543–547.

10.

Whiteway

, Koziarz

, Veall

, Sandhu

, Kumar

, Hoecher

, and Lambert

I.B.

. 1998. Oxygen-insensitive nitroreductases: analysis of the roles of nfsA and nfsB in development of resistance to 5-nitrofuran derivatives in Escherichia coli. J. Bacteriol., 180:5529–5539.

11.

Sandegren

, Lindqvist

, Kahlmeter

, and Andersson

D.I.

. 2008. Nitrofurantoin resistance mechanism and fitness cost in Escherichia coli. J. Antimicrob. Chemother., 62:495–503.

12.

[EFSA] European Food Safety Authority. 2014. The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2012. EFSA J., 12:3547.

13.

Stock

, and Wiedemann

. 2000. Natural antibiotic susceptibility of Salmonella enterica strains. Int. J. Antimicrob. Agents, 16:211–217.

14.

Rampling

, Upson

, and Brown

D.F.

. 1990. Nitrofurantoin resistance in isolates of Salmonella enteritidis phage type 4 from poultry and humans. J. Antimicrob. Chemother., 25:285–290.

15.

Antunes

, Machado

, and Peixe

. 2006. Illegal use of nitrofurans in food animals: contribution to human salmonellosis? Clin. Microbiol. Infect., 12:1047–1049.

16.

Herrero

, Mendoza

M.C.

, Threlfall

E.J.

, and Rodicio

M.R.

. 2009. Detection of Salmonella enterica serovar Typhimurium with pUO-StVR2-like virulence-resistance hybrid plasmids in the United Kingdom. Eur. J. Clin. Microbiol. Infect. Dis., 28:1087–1093.

17.

Antunes

, Machado

, Sousa

J.C.

, and Peixe

. 2004. Dissemination amongst humans and food products of animal origin of a Salmonella typhimurium clone expressing an integron-borne OXA-30 beta-lactamase. J. Antimicrob. Chemother., 54:429–434.

18.

Herrero

, Rodicio

M.R.

, González-Hevia

M.A.

, and Mendoza

M.C.

. 2006. Molecular epidemiology of emergent multidrug-resistant Salmonella enterica serotype Typhimurium strains carrying the virulence resistance plasmid pUO-StVR2. J. Antimicrob. Chemother., 57:39–45.

19.

Herrero

, Rodicio

M.R.

, Echeita

M.A.

, and Mendoza

M.C.

. 2008. Salmonella enterica serotype Typhimurium carrying hybrid virulence-resistance plasmids (pUO-StVR): a new multidrug-resistant group endemic in Spain. Int. J. Med. Microbiol., 298:253–261.

20.

Threlfall

E.J.

, Frost

J.A.

, Ward

L.R.

, and Rowe

. 1994. Epidemic in cattle and humans of Salmonella typhimurium DT 104 with chromosomally integrated multiple drug resistance. Vet. Rec., 134:577.

21.

Douard

, Praud

, Cloeckaert

, and Doublet

. 2010. The Salmonella genomic island 1 is specifically mobilized in trans by the IncA/C multidrug resistance plasmid family. PLoS One, 5:e15302.

22.

Lawson

A.J.

, Dassama

M.U.

, Ward

L.R.

, and Threlfall

E.J.

. 2002. Multiply resistant (MR) Salmonella enterica serotype Typhimurium DT 12 and DT 120: a case of MR DT 104 in disguise? Emerg. Infect. Dis., 8:434–436.

23.

Herrero

, Mendoza

M.C.

, Rodicio

, and Rodicio

M.R.

. 2008. Characterization of pUO-StVR2, a virulence-resistance plasmid evolved from the pSLT virulence plasmid of Salmonella enterica serovar Typhimurium. Antimicrob. Agents Chemother., 52:4514–4517.

24.

Brown

D.F.

, Upson

, Brenwald

N.P.

, and Rampling

. 1991. Mechanism of nitrofuran resistance in Salmonella enteritidis phage type 4 and interpretation of nitrofuran susceptibility tests. J. Antimicrob. Chemother., 27:23–28.

25.

Wray

, and Sojka

W.J.

. 1978. Experimental Salmonella typhimurium infection in calves. Res. Vet. Sci., 25:2517–2529.

26.

[CLSI] Clinical and Laboratory Standards Institute. 2015. Performance Standards for Antimicrobial Susceptibility Testing: twenty-fifth Informational Supplement M100-S25. CLSI, Wayne, PA.

27.

Altschul

S.F.

, Madden

T.L.

, Schäffer

A.A.

, Zhang

, Miller

, and Lipman

D.J.

. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res., 25:3389–3402.

28.

Thompson

J.D.

, Higgins

D.G.

and Gibson

T.J.

. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22:4673–4680.

29.

Wang

R.F.

, and Kusher

S.R.

. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene, 100:195–199.

30.

Heinisch

JJ.

1993. PFK2, ISP42, ERG2 and RAD14 are located on the right arm of chromosome XIII. Yeast, 9:1103–1105.

31.

Taylor

R.G.

, Walker

D.C.

, and McInnes

R.R.

. 1993. E. coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing. Nucleic Acids Res., 21:1677–1678.

32.

EFSA CONTAM Panel (EFSA Panel on Contaminants in the Food Chain). 2015. Scientific Opinion on nitrofurans and their metabolites in food. EFSA J., 13:4140.

33.

Johnston

M.H.

, and Roth

J.R.

. 1981. DNA sequence changes of mutations altering attenuation control of the histidine operon of Salmonella typhimurium. J. Mol. Biol., 145:735–756.

34.

Köpke

A.K.

, and Legatt

P.A.

. 1991. Initiation of translation at an AUA codon for an archaebacterial protein gene expressed in E. coli. Nucleic Acids Res., 19:5139–5172.

35.

Carter

M.Q.

, Louie

J.W.

, Fagerquist

C.K.

, Sultan

, Miller

W.G.

, and Mandrell

R.E.

. 2012. Evolutionary silence of the acid chaperone protein HdeB in enterohemorrhagic Escherichia coli O157:H7. Appl. Environ. Microbiol., 78:1004–1014.

36.

Mather

A.E.

, Reid

S.W.

, Maskell

D.J.

, Parkhill

, Fookes

M.C.

, Harris

S.R.

, Brown

D.J.

, Coia

J.E.

, Mulvey

M.R.

, Gilmour

M.W.

, Petrovska

, de Pinna

, Kuroda

, Akiba

, Izumiya

, Connor

T.R.

, Suchard

M.A.

, Lemey

, Mellor

D.J.

, Haydon

D.T.

, and Thomson

N.R.

. 2013. Distinguishable epidemics of multidrug-resistant Salmonella Typhimurium DT 104 in different hosts. Science, 341:1514–1517.

37.

Izumiya

, Sekizuka

, Nakaya

, Taguchi

, Oguchi

, Ichikawa

, Nishiko

, Yamazaki

, Fujita

, Watanabe

, Ohnishi

, and Kuroda

. 2011. Whole-genome analysis of Salmonella enterica serovar Typhimurium T000240 reveals the acquisition of a genomic island involved in multidrug resistance via IS1 derivatives on the chromosome. Antimicrob. Agents Chemother., 55:623–630.

38.

Martínez-Puchol

, Gomes

, Pons

M.J.

, Ruiz-Roldán

, Torrents de la Peña

, Ochoa

T.J.

, and Ruiz

. 2015. Development and analysis of furazolidone-resistant Escherichia coli mutants. APMIS, 123:676–681.

39.

Aviv

, Tsyba

, Steck

, Salmon-Divon

, Cornelius

, Rahav

, Grassl

G.A.

, and Gal-Mor

. 2014. A unique megaplasmid contributes to stress tolerance and pathogenicity of an emergent Salmonella enterica serovar Infantis strain. Environ. Microbiol., 16:977–994.