Presence of β-Lactamase Encoding Genes in Burkholderia cepacia Complex Isolated from Soil

Abstract

Burkholderia cepacia complex has emerged as an important opportunistic bacteria group for immunocompromised patients, and it has a high level of intrinsic resistance for different antibiotic classes. Hydrolysis of β-lactam antibiotics by β-lactamases is the most common resistance mechanism in Gram-negative bacteria, and the presence of such enzymes complicates the selection of appropriate therapy. This study aimed at investigating the antimicrobial resistance profile and the presence of β-lactamase encoding genes in B. cepacia complex isolated from Brazilian soils. High-level ceftazidime resistance and several β-lactamase encoding genes were found, including the first report of bla_KPC genes in bacteria isolated from soil.

Introduction

The Burkholderia cepacia complex is classified as a group of Gram-negative and glucose nonfermentative bacteria widely found in the environment.¹ This group consists of 20 species, with a high level of genetic similarity between them, making it difficult to identify the specific species. Besides that, they have a high level of intrinsic resistance to most antibiotics, including polymyxins, quinolones, aminoglycosides, and β-lactams.^1–3 Some B. cepacia complex strains have biotechnological potential and are used for bioremediation; however, they also emerged as an important opportunistic bacteria group for the immunocompromised, especially in patients with cystic fibrosis (CF) and chronic granulomatous disease (CGD), as it is difficult to treat infections caused by these bacteria due to their intrinsic resistance.⁴

In patients with CF, Pseudomonas aeruginosa is the most commonly isolated pathogen; however, Stenotrophomonas maltophilia, Staphylococcus aureus, and B. cepacia complex are also reported.^5–7 In CF patients, respiratory infections by the B. cepacia complex are associated with increased morbidity and mortality, resulting in a reduced lifetime expectancy of about 5 years, and the worst scenario is the cepacia syndrome, a necrotizing pneumonia that can lead the patient to death within one week. Outbreaks caused by B. cepacia, Burkholderia cenocepacia, Burkholderia multivorans, and Burkholderia dolosa in CF patients demonstrate the high transmission capacity of these pathogens.¹ B. cenocepacia and B. multivorans are the most commonly isolated pathogens in CF patients.^8,9

Infections caused by B. cepacia complex can be associated with a rapid decline in the clinical condition of the patient, causing a high mortality rate and biofilm formation in the lung, which contributes to the antimicrobial susceptibility reduction, treatment failure, and persistent infection.^6,7 Patients with chronic infection are difficult to treat, requiring the use of combinations of two or three bactericidal antibiotics, including the combination of β-lactams antibiotics such as meropenem and ceftazidime. Hydrolysis of these antibiotics by β-lactamase is the most common mechanism of resistance in Gram-negative bacteria, and the presence of these enzymes makes the selection of appropriate therapy even more difficult.^10,11 This study aimed at investigating the antimicrobial resistance profile and the presence of β-lactamase encoding genes in Burkholderia cepacia complex isolated from Brazilian soils.

Materials and Methods

Obtaining and characterization of isolates

The bacterial isolation was performed according to the methodology described by Martins et al.¹² with some modifications. One gram of each soil sample was added in 5 ml of medium liquid Luria-Bertani (LB) (Oxoid, United Kingdom), and this tube was incubated at 37°C for up to 24 hours under stirring at 130 rpm. Then, a volume of 200 μl was seeded on MacConkey Agar plates (Oxoid) and incubated at 37°C for 18–24 hours. Posteriorly, the isolates were seeded in Triple Sugar Iron Agar (TSI) (Oxoid) for their differentiation based on the carbohydrate fermentation, hydrogen sulfate, and gas production. After confirming the purity of the cultures, the isolates were transferred to liquid LB broth with 15% glycerol and kept at −80°C. The reactivation of the isolates was carried out in LB broth with incubation at 37°C for 24 hours for subsequent experiments.

Molecular characterization of isolates

PCR was performed for amplification of the recA gene by using specific primers for B. cepacia complex (BCR1 and BCR2).¹³ The amplicons were visualized on 1.0% agarose gel and purified by using the Illustra™ PCR DNA and Gel Band Purification Kit (GE Healthcare). The recA gene was used for the sequencing with BCR1-4 and BCR2-3 primers¹³ and the BigDye Terminator Cycle Sequencing Kit on an ABI 3500xL Genetic Analyzer (Applied Biosystems). The sequences were analyzed by using ChromasPro version 1.7.6 software (Technelysium Pty. Ltd) and aligned by using Clustal Omega EMBL-EMI Multiple Sequence Alignment (www.ebi.ac.uk/Tools/msa/clustalo/) with sequences available in GenBank using the BLAST algorithm (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Antimicrobial susceptibility testing

The antimicrobial susceptibility testing was performed by the disk diffusion method by using commercial disks (Oxoid Ltd.) of levofloxacin (5 μg), trimethoprim-sulfamethoxazole (1.25/23.75 μg), meropenem (10 μg), and minocycline (30 μg). The Minimum Inhibitory Concentration (MIC) test was performed by using a range from 1 to 256 μg/ml of ceftazidime and meropenem (Sigma–Aldrich, St. Louis), according to CLSI.¹⁴ The P. aeruginosa strain ATCC^® 27853 was used as a control for antimicrobial susceptibility tests.

Detection of β-lactamase encoding genes by PCR

PCR was performed to investigate the main β-lactamase encoding genes of clinical importance described in Table 1.^15–20 For each PCR performed, the following were used: 14.75 μl of sterile deionized water, 2.5 μl of the PCR buffer minus Mg-10 × buffer, 1.75 μl MgCl₂ (25 mM), 0.5 μl of a solution containing 10 mM of each deoxynucleotide (dATP, dCTP, dGTP, and dTTP), 1 μl of each primer (25 pmol), 1 μl (1.25 U) of JumpStart™ Taq DNA polymerase (Sigma-Aldrich), and 100 ng of genomic DNA to a final volume of 25 μl. The amplicons were visualized on 1.0% agarose gel, purified, and sequenced for confirmation.

Table 1.

Primers Used in the Study

Genes (bla) and β-lactamase(s) targeted	Primer name	Sequence (5′-3′)	Annealing temperature (°C)	Amplicon size (bp)	Reference
GES-1 to 9 and 11	MultiGES_for	AGTCGGCTAGACCGGAAAG	57	399	Dallenne et al.¹⁵
GES-1 to 9 and 11	MultiGES_rev	TTTGTCCGTGCTCAGGAT	57	399	Dallenne et al.¹⁵
VEB-1 to 6	MultiVEB_for	CATTTCCCGATGCAAAGCGT	60	648	Dallenne et al.¹⁵
VEB-1 to 6	MultiVEB_rev	CGAAGTTTCTTTGGACTCTG	60	648	Dallenne et al.¹⁵
PER-1 and 3	MultiPER_for	GCTCCGATAATGAAAGCGT	60	520	Dallenne et al.¹⁵
PER-1 and 3	MultiPER_rev	TTCGGCTTGACTCGGCTGA	60	520	Dallenne et al.¹⁵
BEL-1 and 2	Pre-BEL-A	AGACGTAAGCCTATAATCTC	50	852	Poirel et al.
BEL-1 and 2	Pre-BEL-B	GCGAATTGTTAGACGTATG	50	852	Poirel et al.
SHV including 1	MultiTSO-S_for	AGCCGCTTGAGCAAATTAAAC	60	713	Dallenne et al.¹⁵
SHV including 1	MultiTSO-S_rev	ATCCCGCAGATAAATCACCAC	60	713	Dallenne et al.¹⁵
OXA-1-like including 1, 4, and 30	MultiTSO-O_for	GGCACCAGATTCAACTTTCAAG	60	564	Dallenne et al.¹⁵
OXA-1-like including 1, 4, and 30	MultiTSO-O-rev	GACCCCAAGTTTCCTGTAAGTG	60	564	Dallenne et al.¹⁵
CTX-M group 1 including 1, 3, and 15	MultiCTXMGp1_for	TTAGGAARTGTGCCGCTGYA	60	688	Dallenne et al.¹⁵
CTX-M group 1 including 1, 3, and 15	MultiCTXMGp1-2_rev	CGATATCGTTGGTGGTRCCAT	60	688	Dallenne et al.¹⁵
CTX-M group 2 including 2	MultiCTXMGp2_for	CGTTAACGGCACGATGAC	60	404	Dallenne et al.¹⁵
CTX-M group 2 including 2	MultiCTXMGp1-2_rev	CGATATCGTTGGTGGTRCCAT	60	404	Dallenne et al.¹⁵
CTX-M group 8 including 8, 25, 26, 39, 40, and 41	CTX-Mg8/25_for	AACRCRCAGACGCTCTAC	60	326	Dallenne et al.¹⁵
CTX-M group 8 including 8, 25, 26, 39, 40, and 41	CTX-Mg8/25_rev	TCGAGCCGGAASGTGTYAT	60	326	Dallenne et al.¹⁵
CTX-M group 9 including 9 and 14	MultiCTXMGp9_for	TCAAGCCTGCCGATCTGGT	60	561	Dallenne et al. ¹⁵
CTX-M group 9 including 9 and 14	MultiCTXMGp9_rev	TGATTCTCGCCGCTGAAG	60	561	Dallenne et al. ¹⁵
OXA-48-like	MultiOXA-48-for	GCTTGATCGCCCTCGATT	57	281	Dallenne et al.¹⁵
OXA-48-like	MultiOXA-48_rev	GATTTGCTCCGTGGCCGAAA	57	281	Dallenne et al.¹⁵
KPC-1 to 5	MultiKPC_for	CATTCAAGGGCTTTCTTGCTGC	55	538	Dallenne et al.¹⁵
KPC-1 to 5	MultiKPC_rev	ACGACGGCATAGTCATTTGC	55	538	Dallenne et al.¹⁵
MOX-1 and 2, CMY-1, 8 to 11 and 19	MultiCaseMOX_for	GCAACAACGACAATCCATCCT	60	895	Dallenne et al.¹⁵
MOX-1 and 2, CMY-1, 8 to 11 and 19	MultiCaseMOX_rev	GGGATAGGCGTAACTCTCCCAA	60	895	Dallenne et al.¹⁵
VIM including 1	VIM2004A	GTTTGGTCGCATATCGCAAC	58	382	Pitout et al.¹⁷
VIM including 1	VIM2004B	AATGCGCAGCACCAGGATAG	58	382	Pitout et al.¹⁷
IMP including 1	IMP-A	GAAGGCGTTTATGTTCATAC	54	587	Pitout et al.¹⁷
IMP including 1	IMP-B	GTACGTTTCAAGAGTGATGC	54	587	Pitout et al.¹⁷
SPM-1	SPM F	GAGAGCCCTGCTTGGATTCAT	59	811	Clímaco et al.¹⁸
SPM-1	SPM R	CAGTCTCATTTCGCCAACGG	59	811	Clímaco et al.¹⁸
SIM-1	SIM-F	TACAAGGGATTCGGCATC	52	570	Ellington et al.¹⁹
SIM-1	SIM-R	TAATGGGGCCTGTTCCCATGTG	52	570	Ellington et al.¹⁹
GIM-1	GIM-F	TCGACACACCTTGGTCTGAA	52	477	Ellington et al.¹⁹
GIM-1	GIM-R	AACTTCCAACTTTGCCATGC	52	477	Ellington et al.¹⁹
NDM	NDM-F1	GCAGCTTGTCGGCCATGCGGGC	60	782	Peirano et al.²⁰
NDM	NDM-R1	GGTCGCGAAGCTGAGCACCGCAT	60	782	Peirano et al.²⁰

Y = T or C; R = A or G.

Results

In this work, 35 soil samples from five Brazilian regions were used and 24 bacteria belonging to the B. cepacia complex were obtained. These isolates were analyzed according to the resistance profile and presence of different β-lactamase encoding genes that are found in different bacterial genera.

Among the 24 isolates belonging to the B. cepacia complex, 17 were identified as B. cenocepacia, three as B. cepacia, and two as B. lata and B. ambifaria. The majority of these isolates (21) were isolated from the Southeast region, and three of them were isolated from the Central-West region of Brazil. Soil samples from maize crop were the majority (7), followed by sugarcane (5), coffee (4), soy (3), eucalyptus (2), cotton (1), sorghum (1), and pasture (1) (Table 2). The genetic sequences for the recA gene from B. cepacia complex were deposited in GenBank (www.ncbi.nlm.nih.gov/Genbank) with accession numbers MF168593-MF168616.

Table 2.

Classification of Isolates According to Species and Isolation Source

Species	Isolate	Culture	City	State
Burkholderia lata	S403	Eucalyptus	Formosa	Goiás
B. cenocepacia	S404	Maize	São Francisco de Sales	Minas Gerais
B. cenocepacia	S405	Soy	Santa Juliana	Minas Gerais
B. cenocepacia	S406	Coffee	São José	São Paulo
B. cenocepacia	S407	Sugarcane	São Carlos	São Paulo
B. cenocepacia	S408	Coffee	Cajuru	São Paulo
B. cenocepacia	S409	Eucalyptus	Altinópolis	São Paulo
B. cenocepacia	S410	Soy	Centralina	Minas Gerais
B. cenocepacia	S411	Sugarcane	Nuporanga	São Paulo
B. cenocepacia	S412	Maize	Cássia dos Coqueiros	São Paulo
B. cenocepacia	S413	Cotton	Chapadão do Sul	Mato Grosso do Sul
B. cenocepacia	S414	Sorghum	Ribeirão Preto	São Paulo
B. lata	S415	Soy	Ribeirão Preto	São Paulo
B. cepacia	S416	Maize	Casa Branca	São Paulo
B. cepacia	S417	Maize	Casa Branca	São Paulo
B. cenocepacia	S418	Sugarcane	Tambaú	São Paulo
B. cepacia	S419	Maize	Casa Branca	São Paulo
B. cenocepacia	S420	Pasture	Edeia	Goiás
B. ambifaria	S421	Coffee	Altinópolis	São Paulo
B. cenocepacia	S422	Sugarcane	Tambaú	São Paulo
B. ambifaria	S423	Coffee	Altinópolis	São Paulo
B. cenocepacia	S424	Maize	Cássia dos Coqueiros	São Paulo
B. cenocepacia	S425	Sugarcane	São Carlos	São Paulo
B. cenocepacia	S426	Maize	Casa Branca	São Paulo

The antimicrobial susceptibility testing was carried out with these isolates, and four different antimicrobials were tested by the diffusion disk test. The results showed that eight isolates were susceptible for all tested antimicrobials (S403, S407, S408, S418, S419, S421, S423, and S425). Sixteen isolates were not susceptible (resistant or intermediate) to ceftazidime, five to trimethoprim-sulfamethoxazole, and two to meropenem and to minocycline. The MIC test was done with the nonsusceptible isolates to β-lactams antibiotics, which showed a high level of resistance. As recommended by CLSI, the resistant breakpoints for ceftazidime and meropenem are ≥32 μg/ml and ≥16 μg/ml, respectively. For ceftazidime, 13 isolates showed MIC ≥32, being that 10 of these isolates presented MIC ≥128 μg/ml. Two isolates presented intermediary resistance (MIC 16 μg/ml), and just one isolate was susceptible. For meropenem, isolates showed MIC 1 and 4 μg/ml (Table 3).

Table 3.

Resistance Profile and Genes Found in Isolates of Burkholderia cepacia Complex

	Resistance profile
Strain	Diffusion disk	MIC (μg/ml)		Genes found
S404	CAZ	CAZ	64	bla _SHV
S405	CAZ	CAZ	16	bla_GES and bla_OXA-1-like
S406	CAZ, SUT	CAZ	16	bla_SHV, bla_GES, bla_CTX-M-Gp1, bla_OXA-1-like
S409	CAZ	CAZ	128	bla_SHV, bla_GES, bla_OXA-1-like
S410	CAZ, SUT	CAZ	>256	bla _SHV
S411	CAZ	CAZ	64	bla _SHV, bla _GES
S412	CAZ	CAZ	32	Not found
S413	CAZ	CAZ	>256	bla _SHV
S414	CAZ, SUT	CAZ	>256	bla _SHV
S415	CAZ	CAZ	128	bla_SHV, bla_CTX-M-Gp1, bla_KPC
S416	CAZ, MIN	CAZ	>256	bla_SHV, bla_GES, bla_OXA-1-like
S417	CAZ	CAZ	>256	bla_SHV, bla_OXA-1-like, bla_KPC
S420	CAZ	CAZ	>256	bla _SHV
S422	CAZ, MPM, SUT, MIN	CAZ	8	bla _SHV
S422	CAZ, MPM, SUT, MIN	MPM	4	bla _SHV
S424	CAZ, SUT	CAZ	>256	bla _SHV
S426	CAZ, MPM	CAZ	128	bla_SHV, bla_KPC, bla_VIM
S426	CAZ, MPM	MPM	1	bla_SHV, bla_KPC, bla_VIM

CAZ, ceftazidime; MPM, meropenem; SUT, trimethoprim-sulfamethoxazole; MIN, minocycline.

A total of 19 β-lactamase encoding genes were screened. Among the eight isolates susceptible, no gene was found. Analyzing the 16 nonsusceptible isolates to at least one β-lactam antibiotic, bla_SHV gene was found in 14 of them. bla_GES and bla_OXA-1-like were found in five isolates, bla_KPC was found in three isolates, bla_CTX-M-Gp1 was found in two isolates, and bla_VIM was found only in one isolate. The isolate S406 presented four genes, bla_SHV, bla_GES, bla_CTX-M-Gp1, and bla_OXA-1-like, and five isolates (S409, S415, S416, S417, and S426) presented three genes. Metallo-β-lactamase (bla_VIM) was detected in only one isolate (S426), which also presented bla_KPC gene, and no gene was found in the isolate S412 (Table 3). The access numbers for the found β-lactamase encoding gene sequences were deposited in GenBank (www.ncbi.nlm.nih.gov/Genbank) with accession numbers KY630482-KY630487.

Discussion

The results found here, regarding the resistance profile for ceftazidime, are different from those found by Leitão et al.,³ which showed that 96% of the clinical isolates of B. cepacia complex were susceptible to this antimicrobial by the disk diffusion test. In studies carried out by Nzula et al.,²¹ the authors showed that most of the clinical and environmental isolates of B. cepacia complex were susceptible to ceftazidime. Other studies compared the susceptibility with antibiotics in B. cepacia complex isolates from CF and non-CF patients. Isolates from CF patients showed a lower susceptibility to different antibiotics, including β-lactams, such as meropenem and ceftazidime.^22,23

The treatment of infections caused by B. cepacia complex is quite limited. Among the antibiotics recommended by the CLSI for susceptibility testing, ceftazidime, meropenem, minocycline, and trimethoprim-sulfamethoxazole were used. All analyzed isolates showed a nonsusceptibility to these antibiotics, in a range between 8% and 66%, showing a high level of resistance, mainly to ceftazidime (66%), which is used alone or in combination with other antibiotics for the treatment of patients infected by this complex.

The resistance of B. cepacia complex for different classes of antibiotics can occur through different mechanisms, such as alteration in the membrane permeability, efflux pumps, changes in drug targets, and β-lactamase production.²⁴ Resistance to β-lactam antibiotics is related to inducible chromosomal β-lactamases.^25,26 Studies have reported that resistance to β-lactams may also occur through decreased access to drugs, leading to the hypothesis that synergistic mechanisms confer this resistance.^27–29

The genome of the Burkholderia cenocepacia J2315, a strain obtained from patients with CF, showed that this bacterium possesses at least four chromosomal β-lactamases, belonging to classes A, C, and D.³⁰ These β-lactamases may confer resistance to different β-lactam antibiotics, and in the studies of Tribuddharat et al.,³¹ the authors have shown that mutations in bla_penA (Class A) confer resistance to ceftazidime and clavulanic acid in Burkholderia mallei. This mechanism could be associated with the resistance profile from the isolate S412, since β-lactamase encoding genes researched were not found.

Several studies report mutations in chromosomal β-lactamases in the B. cepacia complex isolates conferring resistance to β-lactam antibiotics. In this work, β-lactamase encoding genes usually found in clinical and environmental Gram-negative bacteria were investigated. However, there are no reports of these in isolates of the B. cepacia complex, probably due to the presence of inducible chromosomal β-lactamases.

The β-lactamase encoding genes found (bla_SHV, bla_GES, bla_OXA-1-like, bla_CTX-M-Gp1, bla_KPC, and bla_VIM) are classified as groups 2 and 3, according to Bush and Jadoby.³² These genes together hydrolyze all β-lactam antibiotics and are described as genes of clinical importance. Several studies show the research of β-lactamase genes in soil samples and in soil isolates. Studies by Graham et al.³³ showed variations of the concentrations of these genes in soils collected between 1923 and 2010. The genes underwent significant variations, mainly between the periods that they were reported in the clinical environment.

In 2015, Ben et al.³⁴ demonstrated the presence of bla_CTX-M-Gp1, bla_SHV, and bla_OXA-1 genes in isolates of the Enterobacteriaceae family isolated from a farm environment. The bla_VIM gene was described in large quantities in Gram-positive and -negative bacteria isolated from the soil.^12,35 To date, there is no report of the bla_KPC gene in soils in the world, but there are reports of this gene in source water, drinking water, and wastewater.^35–37 Thus, this is the first report of the bla_KPC gene in bacteria isolated from soil.

The β-lactamase encoding genes are described in different mobile genetic elements and the study of the B. cenocepacia J2315 genome showed the presence of several of these elements and genomic islands, which were acquired by horizontal gene transfer.^30,32 Therefore, even though the exact importance of the β-lactamase encoding genes to the β-lactam resistance in B. cepacia complex is not known, these bacteria can harbor these genes, which could be transferred to other bacteria, thus turning them resistant.

Conclusion

Although it is not possible to state that resistance to ceftazidime and meropenem in the analyzed isolates is conferred by the found β-lactamase encoding genes, the results showed that these genes are distributed in the soil and that the bacteria belonging to the B. cepacia complex have a high capacity of acquisition of these genes, which usually are acquired by mobile genetic elements through horizontal transfer. Therefore, if B. cepacia complex with this resistance profile was carried to the hospital environment, being associated for any infection, the treatment options would be restricted, since the main β-lactams indicated are ceftazidime and meropenem.

Footnotes

Acknowledgment

The authors thank J.D.D. Pitout (University of Calgary, Calgary, AB, Canada) for kindly providing the β-lactamase control strains used in this study.

This work was supported by São Paulo Research Foundation—FAPESP [grant number 2015/18990-2].

Disclosure Statement

No competing financial interests exist.

References

Sousa

S.A.

, Ramos

C.G.

, and Leitão

J.H.

2010. Burkholderia cepacia Complex: Emerging Multihost Pathogens Equipped with a Wide Range of Virulence Factors and Determinants. Int. J. Microbiol., 2011. pii: 607575.

Chiarini

, Bevivino

, Dalmastri

, Tabacchioni

, and Visca

2006. Burkholderia cepacia complex species: health hazards and biotechnological potential. Trends Microbiol., 14:277–286.

Leitão

J.H.

, Sousa

S.A.

, Cunha

M.V.

, Salgado

M.J.

, Melo-Cristino

, Barreto

M.C.

, and Sá-Correia

2008. Variation of the antimicrobial susceptibility profiles of Burkholderia cepacia complex clonal isolates obtained from chronically infected cystic fibrosis patients: a five-year survey in the major Portuguese treatment center. Eur. J. Clin. Microbiol. Infect. Dis., 27:1101–1111.

Uehlinger

, Schwager

, Bernier

S.P.

, Riedel

, Nguyen

D.T.

, Sokol

P.A.

, and Eberl

2009. Identification of specific and universal virulence factors in Burkholderia cenocepacia strains by using multiple infection hosts. Infect. Immun., 77:4102–4110.

Gales

A.C.

, Menezes

L.C.

, Silbert

, and Sader

H.S.

2003. Dissemination in distinct Brazilian regions of an epidemic carbapenem-resistant Pseudomonas aeruginosa producing SPM Metallo-β-lactamase. J. Antimicrob. Chemother., 52:699–702.

Mahenthiralingam

, Urban

T.A.

, and Goldberg

2005. The multifarious, multireplicon Burkholderia cepacia complex. Nat. Rev. Microbiol., 3:144–156.

Avgeri

S.G.

, Matthaiou

D.K.

, Dimopoulos

, Grammatikos

A.P.

, and Falagas

M.E.

2009. Therapeutic options for Burkholderia cepacia infections beyond co-trimoxazole: a systematic review of the clinical evidence. Int. J. Antimicrob. Agents., 33:394–404.

Drevinek

, and Mahenthiralingam

2010. Burkholderia cenocepacia in cystic fibrosis: epidemiology and molecular mechanisms of virulence. Clin. Microbiol. Infect., 16:821–830.

Mahenthiralingam

, and Vandamme

2005. Taxonomy and pathogenesis of the Burkholderia cepacia complex. Chron. Respir. Dis., 2:209–217.

10.

George

A.M.

, Jones

P.M.

, and Middleton

P.G.

2009. Cystic fibrosis infections: treatment strategies and prospects. FEMS Microbiol. Lett., 300:153–164.

11.

Power

R.F.

, Linnane

, Martin

, Power

, Harnett

, Casserly

, O'Connell

N.H.

, and Dunne

C.P.

2016. The first reported case of Burkholderia contaminans in patients with cystic fibrosis in Ireland: from the Sargasso Sea to Irish Children. BMC Pulm. Med., 22; 16:57.

12.

Martins

V.V.

, Pitondo-Silva

, Manço Lde

, Falcão

J.P.

, Freitas Sdos

, da Silveira

W.D.

, and Stehling

E.G.

2014. Pathogenic potential and genetic diversity of environmental and clinical isolates of Pseudomonas aeruginosa. APMIS., 122:92–100.

13.

Mahenthiralingam

, Bischof

, Byrne

S.K.

, Radomski

, Davies

J.E.

, Av-Gay

, and Vandamme

2000. DNA-Based diagnostic approaches for identification of Burkholderia cepacia complex, Burkholderia vietnamiensis, Burkholderia multivorans, Burkholderia stabilis, and Burkholderia cepacia genomovars I and III. J. Clin. Microbiol., 38:3165–3173.

14.

CLSI. 2015. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Fifth Informational Supplement. CLSI document M100-S25. Clinical and Laboratory Standards Institute, Wayne, PA.

15.

Dallenne

, Costa

, Decré

, Favier

, and Arlet

2010. Development of a set of multiplex PCR assays for the detection of genes enconding importante Beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother., 65:490–495.

16.

Poirel

, Docquier

J.D.

, De Luca

, Verlinde

, Ide

, Rossolini

G.M.

, and Nordmann

2010. BEL-2, an extended-spectrum Beta-lactamase with increased activity toward expanded-spectrum cephalosporins in Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 54:533–535.

17.

Pitout

J.D.

, Gregson

D.B.

, Poirel

, McClure

J.A.

, Le

, and Church

D.L.

2005. Detection of Pseudomonas aeruginosa producing Metallo-beta-lactamases in a large centralized laboratory. J. Clin. Microbiol., 43:3129–3135.

18.

Clímaco

E.C.

, Oliveira

M.L.

, Pitondo-Silva

, Oliveira

M.G.

, Medeiros

, Lincopan

, and da Costa Darini

A.L.

2013. Clonal complexes 104, 109 and 113 playing a major role in the dissemination of OXA-carbapenemase-producing Acinetobacter baumannii in Southeast Brazil. Infect. Genet. Evol., 19:127–133.

19.

Ellington

M.J.

, Kistler

, Livemore

D.M.

, and Woodford

2007. Multiplex PCR for rapid detection of genes encoding acquired Metallo-β-lactamases. J. Antimicrob. Chemother., 59:321–322.

20.

Peirano

, Ahamed-Bentley

, Woodford

, and Pitout

J.D.

2011. New Delhi Metallo-β-lactamase from traveler returning to Canada. Emer. Infect. Dis., 17:240–242.

21.

Nzula

, Vandamme

, and Govan

J.R.

2002. Influence of taxonomic status on the in vitro antimicrobial susceptibility of the Burkholderia cepacia complex. J. Antimicrob. Chemother., 50:265–269.

22.

Kurlandsky

L.E.

, and Fader

R.C.

2000. In vitro activity of minocycline against respiratory pathogens from patients with cystic fibrosis. Pediatr. Pulmonol., 29:210–212.

23.

Spangler

S.K.

, Visalli

M.A.

, Jacobs

M.R.

, and Appelbaum

P.C.

1996. Susceptibilities of non-Pseudomonas aeruginosa gram-negative nonfermentative rods to ciprofloxacin, ofloxacin, levofloxacin, D-ofloxacin, sparfloxacin, ceftazidime, piperacillin, piperacillin-tazobactam, trimethoprim-sulfamethoxazole, and imipenem. Antimicrob. Agents Chemother., 40:772–775.

24.

Rhodes

K.A.

, and Schweizer

H.P.

2016. Antibiotic resistance in Burkholderia species. Drug. Resist. Updat., 28:82–90.

25.

Prince

, Wood

M.S.

, Cacalano

G.S.

, and Chin

N.X.

1988. Isolation and characterization of a penicillinase from Pseudomonas cepacia 249. Antimicrob. Agents. Chemother., 32:838–843.

26.

Trépanier

, Prince

, and Huletsky

1997. Characterization of the PenA and PenR genes of Burkholderia cepacia 249 which encode the chromosomal class A penicillinase and its LysR-type transcriptionnal regulator. Antimicrob. Agents Chemother., 41:2399–2405.

27.

Poirel

, Rodriguez-Martinez

J.M.

, Plésiat

, and Nordmann

2009. Naturally Occurring Class A ß-Lactamases from the Burkholderia cepacia Complex. Antimicrob. Agents Chemother., 53:876–882.

28.

Aronoff

S.C.

1988. Outer membrane permeability in Pseudomonas cepacia: diminished porin content in a β-lactam resistant mutant and in resistant cystic fibrosis isolates. Antimicrob. Agents Chemother. 321636–321639.

29.

Parr

T.R.

, Moore

R.A.

, Moore

L.V.

, and R. Hancock

E.W.

1987. Role of porins in intrinsic antibiotic resistance of Pseudomonas cepacia. Antimicrob. Agents Chemother. 31121–31123.

30.

Holden

M.T.

, Seth-Smith

H.M.

, Crossman

L.C.

, Sebaihia

, Bentley

S.D.

, Cerdeño-Tárraga

A.M.

, Thomson

N.R.

, Bason

, Quail

M.A.

, Sharp

, Cherevach

, Churcher

, Goodhead

, Hauser

, Holroyd

, Mungall

, Scott

, Walker

, White

, Rose

, Iversen

, Mil-Homens

, Rocha

E.P.

, Fialho

A.M.

, Baldwin

, Dowson

, Barrell

B.G.

, Govan

J.R.

, Vandamme

, Hart

C.A.

, Mahenthiralingam

, and Parkhill

2009. The genome of Burkholderia cenocepacia J2315, an epidemic pathogen of cystic fibrosis patients. J. Bacteriol., 191:261–277.

31.

Tribuddharat

, Moore

R.A.

, Baker

, and Woods

D.E.

2003. Burkholderia pseudomallei class a Beta-lactamase mutations that confer selective resistance against ceftazidime or clavulanic acid inhibition. Antimicrob. Agents Chemother., 47:2082–2087.

32.

Bush

, and Jacoby

G.A.

2010. Updated functional classification of β-lactamases. Antimicrob. Agents Chemother., 54:969–976.

33.

Graham

D.W.

, Knapp

C.W.

, Christensen

B.T.

, McCluskey

, and Dolfing

2016. Appearance of β-lactam resistance genes in agricultural soils and clinical isolates over the 20th century. Sci. Rep., 6:21550.

34.

Ben

S.L.

, Jouini

, Klibi

, Dziri

, Alonso

C.A.

, Boudabous

, Ben Slama

, and Torres

2015. Detection of extended-spectrum Beta-lactamase (ESBL)-producing Enterobacteriaceae in vegetables, soil and water of the farm environment in Tunisia. Inf. J. Food Microbiol., 203:86–92.

35.

Pitondo-Silva

, Martins

V.V.

, and Stehling

E.G.

2015. First report of the bla_VIM gene in environmental isolates of Buttiauxella sp. APMSI., 123:326–329.

36.

Yang

, Mao

, Zhou

, and Luo

2016. Prevalence and Fate of Carbapenemase Genes in a Wastewater Treatment Plant in Northern China. PLoS One., 11:e0156383.

37.

Fernando

D.M.

, Tun

H.M.

, Poole

, Patidar

, Li

, Mi

, Amarawansha

G.E.

, Fernando

W.G.

, Khafipour

, Farenhorst

, and Kumar

2016. Detection of Antibiotic Resistance Genes in Source and Drinking Water Samples from a First Nations Community in Canada. Appl. Environ. Microbiol., 82:4767–4775.