Comparison of Clinical Isolates of Aeromonas from Singapore and Malaysia with Regard to Molecular Identification,Virulence,and Antimicrobial Profiles

Abstract

Objective:

The objective of this study was to examine the species distribution, genetic relatedness, virulence gene profiles, antimicrobial sensitivities, and resistance gene distribution of clinical Aeromonas strains from Singapore and Malaysia.

Methods:

A total of 210 Aeromonas clinical isolates were investigated: 116 from Singapore General Hospital and 94 archived clinical isolates from University of Malaya Medical Center, Malaysia. The isolates were genetically identified based on the gcat gene screening and the partial sequences of the rpoD housekeeping gene. Genetic relatedness, distribution of 15 virulence genes and 4 beta-lactamase resistance genes, and susceptibility patterns to 11 antimicrobial agents were compared.

Results:

Of the 210 Aeromonas isolates, A. dhakensis–94 (45%) was the dominant species in Singapore and Malaysia. Species composition was similar and enterobacterial repetitive intergenic consensus-PCR did not show genetic relatedness between strains from the two countries. Of the 15 virulence genes, A. dhakensis and A. hydrophila harbored the most compared with other species. Different combinations of 9 virulence genes (exu, fla, lip, eno, alt, dam, hlyA, aexU, and ascV) were present in A. dhakensis, A. hydrophila, and A. veronii from both the countries. Distribution of virulence genes was species and anatomic site related. Majority (>80%) of the strains were susceptible to all antimicrobial agents tested, except amoxicillin and cephalothin. A. dhakensis strains from Malaysia significantly harbored the cphA gene compared with A. dhakensis from Singapore. Multidrug resistance was mostly detected in strains from peritoneal fluids of dialysis patients.

Conclusion:

This study revealed A. dhakensis as the dominant species isolated in both geographic regions, and that it carried a high number of virulence genes. It also highlights the geographic-related differences of virulence gene distribution and antimicrobial resistance profiles of clinical Aeromonas strains from Singapore and Malaysia.

Introduction

Aeromonas has emerged as an important pathogen giving rise to a wide range of intestinal and extraintestinal infections with symptoms ranging from gastroenteritis, diarrhea, soft-tissue infections, and septicemia, particularly in immunocompromised patients.¹

The taxonomy of Aeromonas is in revision and expansion; the genus currently consists of 36 species. Aeromonads are not difficult to isolate, but identification to species level is challenging due to its phenotypic heterogeneity.² Molecular approaches are more useful and definitive in the identification of Aeromonas.³ The gcat gene was found to be present in practically all Aeromonas strains, and a genus-specific probe of high specificity was designed for Aeromonas detection.^4,5 Compared with the use of 16s rRNA gene, housekeeping gene rpoD provided a more definitive identification of the genus.^3,6,7

Aeromonas dhakensis (formerly known as A. aquariorum)⁸ was found to be the prevalent species among Aeromonas isolates from Malaysia as identified by molecular methods, and these strains displayed various resistance phenotypes and genotypes.^7,9 Aeromonas is known to carry numerous virulence determinants such as cell-associated factors, extracellular factors, siderophores, enterotoxins, a variety of proteases, motility factors, and type 3 secretion system (T3SS) effectors.¹

Thus far, there are no reports on the species diversity of Aeromonas from Malaysia's neighboring country, Singapore. Hence, the aim of this study was to (i) molecularly identify clinical isolates of Aeromonas from Singapore, (ii) evaluate the genetic relationship of Aeromonas isolates, (iii) investigate the possible virulence potential of Aeromonas, (iv) study the antimicrobial susceptibility patterns, (v) detect presence of resistance genes, and (vi) perform comparative analysis between isolates from Singapore and Malaysia.

Materials and Methods

Bacterial isolates

Two hundred ten clinical isolates of Aeromonas were investigated: 116 from the Singapore General Hospital and 94 previously characterized clinical isolates from University Malaya Medical Center.⁷ These were from stool, peritoneal dialysates, blood, pus, wounds, bile, tissue and body fluids, sputum, bone, lung, stents, and urine. All isolates were cultured and cryopreserved in 20% (v/v) glycerol at −80°C. Working cultures were maintained in Luria-Bertani agar and broth.

Molecular identification and phylogenetic analysis

Isolates were genetically identified using a combination of gcat gene screening and rpoD gene sequencing as described previously.⁷ Phylogenetic analysis was performed as described in our previous report¹⁰ using a partial nucleotide sequence (511 bp) of the rpoD gene (GenBank accession numbers: KY198403–KY198518 and JN686647–JN686741) and reference gene sequences as listed in Table 1.

Table 1.

Reference Gene Sequences Used in Phylogenetic Tree Construction

No.	Type strain	Accession no.
1	Aeromonas allosaccharophila CECT 4199	HQ442825
2	A. aquatica CECT 8025	HG970949
3	A. aquatilis CECT 8026	LT630716
4	A. australiensis 266	FN773335
5	A. bestiarum CECT 4227	HQ442854
6	A. bivalvium CECT 7113	HQ442817
7	A. cavernicola CECT 7862	HQ442864
8	A. caviae CECT 838	HQ442790
9	A. crassostreae CECT 8982	LT630712
10	A. dhakensis CECT 7289	HQ442798
11	A. diversa CECT 4254	HQ442805
12	A. encheleia CECT 4342	HQ442778
13	A. enterica CECT 8981	LT630711
14	A. eucrenophila CECT 4224	HQ442770
15	A. finlandiensis CECT 8028	HG970945
16	A. fluvialis 717	FJ603453
17	A. hydrophila CECT 839	HQ442791
18	A. intestinalis CECT 8980	LT630710
19	A. jandaei CECT 4228	HQ442840
20	A. lacus CECT 8024	HG970947
21	A. media CECT 4232	HQ442785
22	A. molluscorum CECT 5864	HQ442812
23	A. piscicola CECT 7443	HQ442859
24	A. popoffii CECT 5176	HQ442853
25	A. rivipollensis P2G1	HG799690
26	A. rivuli DSM 22539	FJ969433
27	A. salmonicida CECT 894	HQ442843
28	A. sanarellii A2-67	FJ807275
29	A. schubertii CECT 4240	HQ442809
30	A. simiae CIP 107798	HQ442811
31	A. sobria CECT 4245	HQ442867
32	A. taiwanensis A2-50	FJ807271
33	A. tecta CECT 7082	HQ442762
34	A. trota CECT 4255	HQ442822
35	A. veronii CECT 4257	HQ442833

Enterobacterial repetitive intergenic consensus-PCR and fingerprint analyses

Enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) which amplifies the conserved repetitive DNA regions present throughout bacterial genomeswas performed using the primers and PCR protocol as described previously.¹¹ Amplification products were electrophoresed on a 1.5% (w/v) agarose gel at 56 V for 5 hours in TBE buffer. Fingerprint profiles were analyzed using software BioNumerics version 7.5 (Applied Maths, Belgium). Similarities between the fingerprints were calculated with Dice coefficient and a dendrogram was constructed using the unweighted pair group method with average linkages.

Virulence gene screening

Detection of 15 virulence genes encoding for DNAse (exu), serine protease (ser), aerolysin/hemolysin (aer), cytotoxic enterotoxin (act), heat-labile cytotonic enterotoxin (alt), heat-stable cytotonic enterotoxin (ast), lipase (lip), flagellin (fla), elastase (ela), ADP-ribosyltransferase toxins (aexT and aexU), DNA adenine methyltransferase (dam), enolase (eno), T3SS membrane component (ascV), and hemolysin (hlyA) was carried out. Specific primers were selected and PCR was performed to screen the 15 virulence genes using previously published protocols.¹⁰ Two-tailed Fisher's exact test was used to determine the presence of combination of virulence genes.

Antimicrobial susceptibility

Susceptibilities to 11 antimicrobial agents of 7 different classes were determined by the disc diffusion method as described by CLSI guideline M45-A2¹² using Mueller-Hinton agar (Oxoid) and commercial antibiotic discs (Oxoid). The antimicrobial agents were: amoxicillin (10 μg), cefepime (30 μg), cephalothin (30 μg), cefotaxime (30 μg), chloramphenicol (30 μg), tetracycline (30 μg), amikacin (30 μg), gentamicin (10 μg), ciprofloxacin (5 μg), norfloxacin (10 μg), and meropenem (10 μg). Bacterial suspensions of 0.5 McFarland (1.5 × 10⁸ colony-forming unit/ml) were prepared in 0.85% saline solution and inoculated onto Mueller-Hinton agar plates using sterile rayon swabs. Antibiotic discs were dispensed onto the inoculated plates using a dispenser or sterile forceps. The plates were incubated at 35°C for 18 hours and inhibition zones were measured and interpreted based on the CLSI guideline M45-A2.¹² Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as quality controls.

Detection of resistance genes

All strains were investigated by PCR for genes related to beta-lactam resistance: MOX, VIM, KPC, and cphA using primers as previously published^13,14 (Table 2).

Table 2.

Primer Sequences and Condition Used for Resistance Genes Detection

Gene	Primer sequence (5′ to 3′), F/R	Amplicon size (bp)	Annealing temperature (°C)	Reference
bla_MOX	GCAACAACGACAATCCATCCT/GGGATAGGCGTAACTCTCCCAA	895	54	Dallenne et al.¹³
bla_KPC	CATTCAAGGGCTTTCTTGCTGC/ACGACGGCATAGTCATTTGC	538	55	Dallenne et al.¹³
bla_VIM	GATGGTGTTTGGTCGCATA/CGAATGCGCAGCACCAG	390	55	Dallenne et al.¹³
bla_cphA	GCTTAGAGCTCCTAAGGAGCAAGATGAAAGGTTGG/GCATAGGTACCTTATGACTGGGGTGCGGCCTTG	720	50	Wu et al.¹⁴

Results

Detection of gcat gene and rpoD gene sequencing

Based on gcat gene screening all 210 isolates belonged to the genus Aeromonas and phylogenetic analysis of the partial sequences of the rpoD gene showed distinct clustering of 165 isolates with known Aeromonas species with bootstrap values of 85–99%. Forty-five strains formed a cluster with type strains of A. veronii, A. allosaccharophila, A. finlandiensis and A. aquatilis at a bootstrapping value of 70% and were considered as “A. veronii group” in this study. Based on the phylogenetic tree, 116 strains from Singapore were identified as A. dhakensis–47, A. veronii group–33, A. caviae–22, A. hydrophila–10, A. jandaei–2, A. taiwanensis–1, and A. sanarellii–1 (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/mdr). The strains from Malaysia were: A. dhakensis–47, A. caviae–18, A. hydrophila–16, A. veronii group–12, and A. trota–1.

Aeromonas dhakensis was the dominant species in both countries and recovered mostly from stool samples (40/94, 43%) (Table 3). Based on pairwise sequence identity matrices, the intraspecies similarities for the strains were 79.6–100% for A. dhakensis, 94.8–100% for A. hydrophila, 87.0–100% for A. caviae, and 78.2–100% for A. veronii group and 94.1–99.1% for A. jandaei.

Table 3.

Source and Species Distribution of Aeromonas Strains

	A. dhakensis		A. caviae		A. hydrophila		A. veronii group		A. jandaei		A. trota		A. taiwanensis		A. sanarellii		Total
Source	S	M	S	M	S	M	S	M	S	M	S	M	S	M	S	M	S	M
Stool	13	27	5	11	1	4	14	9	0	0	0	1	0	0	0	0	33	52
Peritoneal fluid	1	5	3	4	0	4	1	0	0	0	0	0	1	0	0	0	6	13
Blood	10	0	5	1	1	2	12	1	0	0	0	0	0	0	0	0	28	4
Pus/wound	8	13	0	2	2	6	1	1	1	0	0	0	0	0	0	0	12	22
Bile	6	0	5	0	0	0	1	1	0	0	0	0	0	0	0	0	12	1
Tissue	3	0	0	0	3	0	1	0	1	0	0	0	0	0	1	0	9	0
Urine	1	1	2	0	1	0	1	0	0	0	0	0	0	0	0	0	5	1
Sputum	1	0	2	0	1	0	0	0	0	0	0	0	0	0	0	0	4	0
Others^a	4	1	0	0	1	0	2	0	0	0	0	0	0	0	0	0	7	1
Total	47	47	22	18	10	16	33	12	2	0	0	1	1	0	1	0	116	94

A. dhakensis from lung, fluid, and stent; A. hydrophila from bone; A. veronii from stent.

S, strains from Singapore; M, strains from Malaysia.

ERIC-PCR and fingerprint analyses

Among the 210 Aeromonas strains, two clusters of 100% similarity level were identified: two isolates of A. veronii group (SC109 and SC110) from Singapore and two isolates of A. hydrophila (C71 and C72) from Malaysia. The isolates within each cluster shared the identical fingerprint and was considered as the same clone (Supplementary Fig. S2). The remaining strains exhibited distinct ERIC fingerprinting patterns and no genetic similarity was observed between strains from Singapore and Malaysia.

Virulence genes

In both regions, A. hydrophila and A. dhakensis harbored more virulence genes than A. veronii group or A. caviae. The average number of virulence genes carried by A. hydrophila, A. dhakensis, A. veronii group, and A. caviae were 11, 10, 6, and 5. One A. dhakensis strain from a stool specimen of a Malaysian patient carried the full complement of all the 15 virulence genes. Two-tailed Fisher's exact test revealed statistically significant (p < 0.05) association of A. dhakensis with alt, dam, and hlyA; A. hydrophila with alt, ast, dam, and hlyA and A. veronii group with act among strains from both regions. Carriage of multiple enterotoxin genes (alt, ast and act) was seen only in A. dhakensis and A. hydrophila with the latter having a higher proportion than A. dhakensis (Table 4). These enterotoxigenic strains were mostly from pus or wound specimens (Table 5).

Table 4.

Distribution of 15 Virulence Genes in Aeromonas Species

	A. dhakensis		A. caviae		A. hydrophila		A. veronii group		A. jandaei		A. trota		A. taiwanensis		A. sanarellii		Total
	S	M	S	M	S	M	S	M	S	M	S	M	S	M	S	M	S	M
Virulence genes	47	47	22	18	10	16	33	12	2	0	0	1	1	0	1	0	116	94
exu	47^* (100)	41 (87)	22 (100)	17 (94)	10 (100)	13 (81)	33 (100)	11 (92)	2 (100)	0 (0)	0 (0)	0 (0)	1 (100)	0 (0)	1 (100)	0 (0)	116^* (100)	82 (87)
alt	44 (94)	46 (98)	3 (14)	6 (33)	9 (90)	16 (100)	2 (6)	5^* (42)	0 (0)	0 (0)	0 (0)	1 (100)	0 (0)	0 (0)	0 (0)	0 (0)	58 (50)	74^* (79)
ser	47 (100)	42 (89)	2 (9)	3 (17)	10 (100)	16 (100)	33 (100)	10 (83)	2 (100)	0 (0)	0 (0)	1 (100)	0 (0)	0 (0)	0 (0)	0 (0)	94 (81)	72 (77)
aer	44 (94)	41 (87)	4 (18)	4 (22)	5 (50)	10 (63)	33 (100)	12 (100)	2 (100)	0 (0)	0 (0)	1 (100)	0 (0)	0 (0)	1 (100)	0 (0)	89 (77)	68 (72)
act	14 (30)	18 (38)	3 (14)	1 (6)	5 (50)	9 (56)	31 (94)	12 (100)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	53 (46)	40 (43)
ast	4 (9)	4 (9)	0 (0)	0 (0)	9 (90)	16 (100)	0 (0)	1 (8)	0 (0)	0 (0)	0 (0)	1 (100)	0 (0)	0 (0)	0 (0)	0 (0)	13 (11)	22^* (23)
lip	45 (96)	47 (100)	22 (100)	18 (100)	10 (100)	16 (100)	0 (0)	4^* (33)	0 (0)	0 (0)	0 (0)	1 (100)	1 (100)	0 (0)	1 (100)	0 (0)	79 (68)	86^* (91)
fla	47^* (100)	41 (87)	18 (82)	13 (72)	10 (100)	11 (69)	31^** (94)	4 (33)	2 (100)	0 (0)	0 (0)	1 (100)	1 (100)	0 (0)	1 (100)	0 (0)	110^* (95)	70 (74)
ela	46 (98)	47 (100)	22 (100)	18 (100)	10 (100)	15 (94)	6 (18)	1 (8)	2 (100)	0 (0)	0 (0)	0 (0)	1 (100)	0 (0)	1 (100)	0 (0)	88 (76)	81 (86)
aexT	14 (30)	15 (32)	0 (0)	0 (0)	5 (50)	4 (25)	15 (45)	4 (33)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	34 (29)	23 (24)
eno	20 (43)	46^** (98)	15 (68)	17 (94)	6 (60)	16^* (100)	18 (55)	12^* (100)	1 (50)	0 (0)	0 (0)	1 (100)	1 (100)	0 (0)	0 (0)	0 (0)	61 (53)	92^* (98)
dam	21 (45)	46^** (98)	0 (0)	2 (11)	6 (60)	16^* (100)	1 (3)	1 (8)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	28 (24)	65^* (69)
hlyA	19 (40)	43^** (91)	0 (0)	2 (11)	5 (50)	16^* (100)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	24 (21)	61^* (65)
ascV	0 (0)	21^** (45)	0 (0)	2 (11)	0 (0)	0 (0)	0 (0)	1 (8)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	24^* (26)
aexU	3 (6)	19^** (40)	0 (0)	2 (11)	0 (0)	0 (0)	0 (0)	1 (8)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	3 (3)	22^* (23)
Virulence gene subset	S	M	S	M	S	M	S	M	S	M	S	M	S	M	S	M	S	M
alt/ast	3 (6)	4 (9)	0 (0)	0 (0)	8 (80)	16 (100)	0 (0)	1 (8)	0 (0)	0 (0)	0 (0)	1 (100)	0 (0)	0 (0)	0 (0)	0 (0)	11 (9)	22 (23)
alt/ast/act	0 (0)	3 (6)	0 (0)	0 (0)	4 (40)	9 (56)	0 (0)	1 (8)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	4 (3)	13 (14)

Significant difference (p < 0.05) between isolates from Singapore and Malaysia.

Very significant difference (p < 0.0001) between isolates from Singapore and Malaysia.

Table 5.

Distribution of Virulence Gene Subsets in Aeromonas Strains from Different Anatomic Sites

	Enterotoxins		Enterotoxin and regulatory protein	Aerolysin/hemolysin	Proteases and enzymes	Type 3 secretion system
Virulence subsets	alt/ast (%)	alt/ast/act (%)	act/dam (%)	aer/hlyA (%)	ser/ela/lip/exu (%)	ascV/aexT/aexU (%)	Average number of virulence gene
Pus/wound n = 34	4 (12)	6^* (18)	14^** (41)	17^** (50)	25^** (74)	6^* (18)	10
Peritoneal fluid n = 19	0	4^* (21)	6^* (32)	11^* (58)	11^* (58)	1 (5)	8
Stool n = 85	7 (8)	4 (5)	14 (16)	26^* (31)	38^* (45)	5 (6)	8
Blood n = 32	1 (3)	2 (6)	3 (9)	5 (16)	14 (44)	0	7
Tissue n = 9	2 (22)	1 (10)	1 (11)	1 (11)	6 (67)	0	8
Bile drain n = 13	1 (8)	0	2 (15)	4 (31)	5 (38)	0	7
Urine n = 6	0	0	0	1 (17)	3 (50)	0	7
Sputum n = 4	0	0	0	0	2 (50)	0	7
Others n = 8	1 (13)	0	1 (13)	4 (8)	6 (75)	1 (13)	9
Total	16	17	41	69	110	13

Significant association (p < 0.05) of virulence gene subset with source of isolation.

Very significant association (p < 0.0001) of virulence gene subset with source of isolation.

The frequency of the eno gene was significantly higher among A. dhakensis (p < 0.0001), A. hydrophila (p < 0.05) and A. veronii group (p < 0.05) from Malaysia than those from Singapore. The fla gene was significantly associated with A. dhakensis (p < 0.05) and A. veronii group (p < 0.0001) strains from Singapore. T3SS genes ascV and aexU were almost exclusively (p < 0.0001) detected in A. dhakensis from Malaysia either singly or in combination. Every strain positive for ascV and/or aexU gene carried the aexT gene as well. Strains with a subset of virulence genes aexT/ascV/aexU were the most prevalent (6/14, 43%) from pus associated with chronic osteomyelitis, burn wounds, fractures, and traumatic wounds. Strains from pus/wound specimens harbored the highest number of virulence genes compared with specimens from other anatomic sites (Table 5).

Antimicrobial susceptibility

More than 80% of the strains were susceptible to cefepime, cefotaxime, chloramphenicol, amikacin, gentamicin, ciprofloxacin, norfloxacin, and meropenem. Susceptibility to cephalothin was significantly higher in A. veronii group compared with A. dhakensis, A. caviae, and A. hydrophila (p < 0.0001) for both geographical regions.

Ninety-seven percent of the strains were resistant to amoxicillin. In both countries, A. caviae was significantly more resistant against chloramphenicol than A. dhakensis (p < 0.05), A. veronii group (p < 0.05), and A. jandaei (p < 0.05). Resistance against tetracycline, ciprofloxacin, and norfloxacin was also significantly higher (p < 0.05) in A. caviae than A. dhakensis and A. veronii group.

Resistance to cefotaxime (p < 0.0001), ciprofloxacin (p < 0.05), and norfloxacin (p < 0.05) was more significant in the Singapore strains than those from Malaysia, and vice versa for cephalothin (p < 0.05) and gentamicin (p < 0.0001). At the species level, Malaysian A. dhakensis strains were significantly resistant to gentamicin (p < 0.05), whereas A. dhakensis from Singapore was significantly resistant to cefotaxime (p < 0.05) and tetracycline (p < 0.05) (Table 6).

Table 6.

Antimicrobial Resistance to Eleven Antimicrobial Agents of Aeromonas Strains from Singapore and Malaysia

			Number of isolates resistant to the indicated antimicrobial agent (%)
			A. dhakensis (n = 94)		A. caviae (n = 40)		A. hydrophila (n = 26)		A. veronii (n = 45)		A. jandaei (n = 2)		Other Aeromonas species (n = 3)		% of resistant isolates
			S	M	S	M	S	M	S	M	S	M	S	M	S	M
Class of antimicrobial agent	Antimicrobial agent (μg)	Breakpoint diameters, S/I/R (mm)	47	47	22	18	10	16	33	12	2	0	2	1	116	94
Penicillins	Amoxicillin (10 μg)	≥21/14–20/<14	47 (100)	43 (91)	21 (95)	18 (18)	10 (100)	16 (100)	32 (97)	12 (100)	2 (100)	0 (0)	2 (100)	0 (0)	114 (98)	89 (95)
Cephems	Cefepime (30 μg)	≥18/15–17/≤14	0 (0)	0 (0)	2 (9)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	2 (2)	0 (0)
	Cephalothin (30 μg)	≥18/15–17/≤14	47 (100)	46 (98)	20 (91)	17 (94)	10 (100)	15 (94)	1 (3)	1 (8)	2 (100)	0 (0)	2 (100)	1 (100)	82 (71)	80^* (85)
	Cefotaxime (30 μg)	≥26/23–25/≤22	9^** (19)	0 (0)	5 (23)	0 (0)	2 (20)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	16^* (24)	0 (0)
Phenicols	Chloramphenicol (30 μg)	≥18/13–17/≤12	0 (0)	0 (0)	2 (9)	4 (22)	2 (20)	0 (0)	0 (0)	1 (8)	0 (0)	0 (0)	0 (0)	0 (0)	4 (3)	5 (5)
Tetracyclines	Tetracycline (30 μg)	≥15/12–14/≤11	8^* (17)	0 (0)	8 (36)	5 (28)	3 (30)	3 (19)	2 (6)	1 (8)	1 (50)	0 (0)	0 (0)	0 (0)	22 (19)	9 (10)
Aminoglycosides	Amikacin (30 μg)	≥17/15–16/≤14	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
Aminoglycosides	Gentamicin (10 μg)	≥15/13–14/≤12	0 (0)	6^** (13)	1 (5)	1 (6)	0 (0)	6 (38)	0 (0)	1 (8)	0 (0)	0 (0)	0 (0)	0 (0)	1 (1)	14^* (15)
Quinolones	Ciprofloxacin (5 μg)	≥21/16–20/≤15	1 (2)	0 (0)	4 (18)	0 (0)	2 (20)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	7^* (6)	0 (0)
Quinolones	Norfloxacin (10 μg)	≥17/13–16/≤12	1 (2)	0 (0)	4 (18)	0 (0)	2 (20)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	7^* (6)	0 (0)
Carbapenems	Meropenem (10 μg)	≥16/14–15/≤13	1 (2)	0 (0)	1 (5)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	2 (2)	0 (0)

Significant difference (p < 0.05) between isolates from Singapore and Malaysia.

Very significant difference (p < 0.0001) between isolates from Singapore and Malaysia.

S, strains from Singapore; M, strains from Malaysia.

Multidrug resistance (MDR) is defined as nonsusceptibility to at least one agent in three or more antimicrobial categories: nonsusceptibility refers to resistant, intermediate, and nonsusceptible in in vitro antimicrobial susceptibility testing.¹⁵ MDR patterns were observed in 26% (54/210) of the strains and most prevalent from peritoneal fluids (Table 7). One A. caviae from peritoneal fluid from Singapore was resistant to all classes of antimicrobial agents, except the aminoglycosides. Eleven MDR strains were from peritoneal fluids of renal failure patients, but the MDR trait was not specifically associated with any species or geographic region.

Table 7.

Anatomic Site and Species of Multidrug-Resistant Strains (Resistant to ≥3 Antimicrobial Classes) from Singapore and Malaysia

	Number of multidrug-resistant strains (%)
	A. dhakensis (n = 94)		A. caviae (n = 40)		A. hydrophila (n = 26)		A. veronii (n = 45)		A. jandaei (n = 2)		Other Aeromonas species (n = 3)		% of multidrug-resistant strains
	S	M	S	M	S	M	S	M	S	M	S	M	S	M
Anatomic site	47	47	22	18	10	16	33	12	2	0	2	1	116	94
Peritoneal fluid^*	1 (7)	5 (56)	1 (11)	2 (40)	0 (0)	4 (44)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	2 (7)	11 (42)
Pus	0 (0)	0 (0)	0 (0)	1 (20)	0 (0)	3 (33)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	4 (15)
Blood	4 (27)	0 (0)	4 (44)	0 (0)	0 (0)	1 (11)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	8 (33)	1 (4)
Stool	4 (27)	4 (44)	1 (11)	3 (50)	0 (0)	1 (11)	0 (0)	1 (50)	0 (0)	0 (0)	0 (0)	0 (0)	4 (14)	9 (35)
Urine	0 (0)	0 (0)	0 (0)	0 (0)	1 (33)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	1 (4)	0 (0)
Sputum	0 (0)	0 (0)	1 (11)	0 (0)	1 (33)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	2 (8)	0 (0)
Bile	2 (13)	0 (0)	2 (22)	0 (0)	0 (0)	0 (0)	0 (0)	1 (50)	0 (0)	0 (0)	0 (0)	0 (0)	4 (14)	1 (4)
Wound	1 (7)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	1 (100)	0 (0)	0 (0)	0 (0)	2 (7)	0 (0)
Others	3 (20)	0 (0)	0 (0)	0 (0)	1 (33)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	4 (17)	0 (0)
Total	15 (100)	9 (100)	9 (100)	6 (100)	3 (100)	9 (100)	0 (0)	2 (100)	1 (100)	0 (0)	0 (0)	0 (0)	28 (100)	26 (100)

Very significant (p < 0.0001) association with source of isolation.

Detection of resistance genes

The MOX gene was detected in 56 (27%) of the strains and significantly associated with A. caviae regardless of country of origin. The cphA gene was detected in 7 (7%) A. dhakensis, 3 (11%) in A. hydrophila, and 3 (7%) in A. veronii group, but none of the A. caviae strains had the cphA gene (Table 8). All cphA-positive strains were susceptible to meropenem, but the cphA gene was not detected in the two meropenem-resistant strains. There was no significant difference in the distribution of resistance genes between strains of the same species from Singapore and Malaysia, except that the frequency of the MOX gene was significantly higher in A. dhakensis strains from Malaysia than those from Singapore. None of the strains carried the VIM and KPC genes.

Table 8.

Distribution of Resistance Genes and Susceptibility to Meropenem Among the Aeromonas Strains

Species	Country of origin	Number of strains resistant to meropenem (%)	MOX gene (%)	cphA gene (%)
A. dhakensis	Singapore, n = 47	1 (2)	2 (4)	4 (9)
A. dhakensis	Malaysia, n = 47	0 (0)	21 (45)^*	3 (6)
A. hydrophila	Singapore, n = 10	0 (0)	0 (0)	2 (20)
A. hydrophila	Malaysia, n = 16	0 (0)	0 (0)	1 (6)
A. caviae	Singapore, n = 22	1 (5)	15 (68)	0 (0)
A. caviae	Malaysia, n = 18	0 (0)	15 (83)	0 (0)
A. veronii	Singapore, n = 33	0 (0)	1 (3)	3 (9)
A. veronii	Malaysia, n = 12	0 (0)	0 (0)	0 (0)
A. jandaei	Singapore, n = 2	0 (0)	0 (0)	0 (0)
A. jandaei	Malaysia, n = 0	0 (0)	0 (0)	0 (0)
A. sanarellii	Singapore, n = 1	0 (0)	1 (100)	0 (0)
A. sanarellii	Malaysia, n = 0	0 (0)	0 (0)	0 (0)
A. taiwanensis	Singapore, n = 1	0 (0)	1 (100)	0 (0)
A. taiwanensis	Malaysia, n = 0	0 (0)	0 (0)	0 (0)
A. trota	Singapore, n = 0	0 (0)	0 (0)	0 (0)
A. trota	Malaysia, n = 1	0 (0)	0 (0)	0 (0)
Total	Singapore, n = 116	2 (2)	20 (17)	9 (8)
Total	Malaysia, n = 94	0 (0)	36 (38)	4 (4)

Very significant difference (p < 0.0001) between isolates from Singapore and Malaysia.

Discussion

The rpoD gene was used by Puthucheary et al. as a molecular tool for inferring the taxonomy of Aeromonas,⁷ but since then 15 new species have been described: A. aquatica, A. aquatilis, A. australiensis, A. cavernicola, A. crassostreae, A. diversa, A. enterica, A. finlandiensis, A. fluvialis, A. intestinalis, A. lacus, A. rivipollensis, A. rivuli, A. sanarellii, and A. taiwanensis.^16–24 Using the updated taxonomy we reevaluated the phylogeny of the Malaysian isolates used by Puthucheary et al.,⁷ and found the identity of each strain to be the same as described previously, except that A. veronii isolates were clustered into A. veronii group consisting of A. veronii, A. allosaccharophila, A. finlandiensis, and A. aquatilis. These four species are closely related, forming a distinct cluster with a bootstrap value of 100% following multilocus phylogenetic analysis and in silico DNA–DNA hybridization.²³ Isolates within the A. veronii group would require additional molecular markers for more refined discrimination.

Aeromonas dhakensis was identified as the predominant species for both countries. Reports of A. dhakensis clinical isolates are scanty probably due to previous identification as A. hydrophila.^8,25,26 A. dhakensis is increasingly recognized as a pathogen of considerable virulence with reports of infection in Taiwan and Australia.^27,28 Our results confirm a previous report that A. dhakensis and A. hydrophila possess more virulence genes than A. veronii group or A. caviae,²⁹ but situational expression of virulence factors due to genetic regulation is reported to occur in Aeromonas.³⁰ Chen et al. found A. dhakensis more pathogenic than A. hydrophila because of higher biofilm formation, higher minimum inhibitory concentration for certain antimicrobial agents, lower survival rate in Caenorhabditis elegans, higher cytotoxicity against human normal skin fibroblast cell lines and mouse fibroblast cell lines, and shorter lifespan of infected mice.³¹ Furthermore, A. dhakensis bacteremia contributed to higher mortality rates in patients compared with other species.²⁸ A. dhakensis is thus probably more virulent than the other species in vitro and in vivo.²⁵

The Aeromonas species from clinical material were similar in both Singapore and Malaysia, perhaps due to comparable environmental factors, such as climate, temperature and humidity, and dietary patterns with an annual consumption of 20–50 kg of fish per capita, but cooking methods may vary allowing the survival of bacteria. Presence of Aeromonas in different environments has been reported in both countries.^10,32,33 Moreover, seafood supply in Singapore relies largely on imports from Malaysia.³⁴ There are reports of A. hydrophila isolation from aquaculture in Malaysia, and other Asian nations have reported A. dhakensis contamination in marine shrimps cultured in low-salinity ponds in Thailand and farmed eels in Korea^35–37 Nevertheless, ERIC fingerprinting demonstrated that strains recovered from patients in Singapore and Malaysia were different clones, suggesting that patients were not infected by clonally related strains. Our data show genetic diversity of the strains and that no predominant pathogenic clones were circulating among patients in both the countries. Similarly, Szczuka and Kaznowski did not find evidence of predominant clones responsible for Aeromonas-associated infections with no genetic relationship between stool isolates from different parts of Europe and Asian countries.¹¹

Uncommon Aeromonas species detected in this study was A. trota, an ampicillin-susceptible species from a stool specimen of a Malaysian patient with severe gastroenteritis and watery diarrhea, and one strain each of A. taiwanensis and A. sanarellii from peritoneal fluid and foot tissue culture from Singapore.

Different subsets of virulence genes were detected in different Aeromonas species and only one A. dhakensis strain (strain C51) from a stool specimen from Malaysia carried the full complement of all 15 virulence genes, suggesting its high virulence potential. T3SS genes (ascV and aexU) were only present in A. dhakensis from Malaysia either singly or in combination and they were not present in the Singapore strains. These results indicate that different subsets of virulence genes of the T3SS complex are present in subpopulations of Aeromonas, suggesting distinct pathogenic mechanisms.

Aeromonas harboring both alt and ast enterotoxic genes causing watery diarrhea may represent true diarrheal pathogens in Southeast Asia.³⁸ Ninety-six percent of our A. hydrophila strains carried both the enterotoxin genes, but no significant association with diarrheal cases was recorded (Table 2). Only 12% (10/85) of stool isolates carried both the enterotoxin genes that were reported to be exclusively detected in diarrheal isolates.³⁸ Our findings imply that enterotoxigenic aeromonads in Singapore and Malaysia were not unequivocally considered diarrheal pathogens as they were frequently isolated from peritoneal fluids and blood cultures. Strains from pus/wound specimens carried the widest array of virulence genes probably indicating their ability to invade the mucosa and deeper tissues.

Cephalothin sensitivity was exclusive to A. veronii group and this feature confirms previous reports that it be used as a phenotypic marker to differentiate A. veronii from other Aeromonas species.^39,40 High resistance rates to beta-lactam antibiotics, amoxicillin (97%), was seen. The frequency of the MOX gene–an AmpC beta-lactamase was higher among A. dhakensis strains from Malaysia. Geographic-related variations in antimicrobial susceptibility probably depend on several factors, for example, differences in healthcare systems, guideline recommendations, and compliance of patients. Antimicrobial prescribing policies in Malaysian government hospitals are guided by the national database,⁴¹ whereas healthcare systems in Singapore refer to hospital policies or published guidelines, although antibiotics are not usually prescribed for self-limiting diarrhea.

Resistance to meropenem by the disc diffusion method, but absence of the cphA gene was seen in 1% of our strains, and it may have been due to the presence of other resistance genes, efflux pumps, and porin mutations.⁴²

Our A. caviae strains were resistant to many antimicrobial agents as 68% of them carried the MOX gene belonging to class C beta lactamase, as AmpC present in Aeromonas can hydrolyze many beta-lactamases.⁴³ An A. caviae isolate with resistance to all antimicrobial agents was recovered from tropical ornamental fish and carriage water from Singapore, and it is possible that this strain may be disseminated during export of these fish to other countries.⁴⁴

MDR was recorded in 13 (68%) of peritoneal strains with 9 of the 13 from renal failure specimens. Colonization and infection rates by MDR strains were reported to be higher in patients on dialysis than patients in other healthcare settings.⁴⁵ One A. caviae strain from a postmortem peritoneal specimen from Singapore was susceptible to only the aminoglycosides. The high rate of MDR in peritoneal dialysis patients found in our study and published reports⁴⁵ highlights the necessity for increased awareness of adherence to infection control measures in hospitals, and among healthcare workers and caregivers.

Conclusions

The prevalence of A. dhakensis infections in Singapore and Malaysia is an indication of the virulence potential rather than antimicrobial resistance of this species. ERIC fingerprinting suggests that infections in Singapore and Malaysia were not clonally related. The diverse distribution of the virulence genes denotes that different subsets of virulence determinants occur in different subpopulations of Aeromonas species. Definitive species identification using molecular methods is necessary to predict virulence potential and resistant phenotypes. High prevalence of multidrug-resistant strains from peritoneal dialysis fluids highlights the necessity for increased awareness and adherence to good infection control measures.

Footnotes

Acknowledgments

The authors gratefully appreciate and thank members of the participant hospitals for their donation of clinical isolates. This work was funded by the University of Malaya Research Grant RP039A-15HTM and Postgraduate Research Grant PG082-2014B from the University of Malaya.

Disclosure Statement

No competing financial interests exist.

References

Janda

J.M.

, and Abbott

S.L.

. 2010. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev., 23:35–73.

Lamy

, Laurent

, Verdier

, Decousser

J.W.

, Lecaillon

, Marchandin

, Roger

, Tigaud

, de Montclos

, col Study Group

BVH

, and Kodjo

. 2010. Accuracy of 6 commercial systems for identifying clinical Aeromonas isolates. Diagn. Microbiol. Infect. Dis., 67:9–14.

Beaz-Hidalgo

, Alperi

, Buján

, Romalde

J.L.

, and Figueras

M.J.

. 2010. Comparison of phenotypical and genetic identification of Aeromonas strains isolated from diseased fish. Syst. Appl. Microbiol., 33:149–153.

Chacón

M.R.

, Castro-Escarpulli

, Soler

, Guarro

, and Figueras

M.J.

. 2002. A DNA probe specific for Aeromonas colonies. Diagn. Microbiol. Infect. Dis., 44:221–225.

Latif-Eugenín

, Beaz-Hidalgo

, and María José

. 2016. A culture independent method for the detection of Aeromonas sp. from water samples. Ital. J. Food Saf., 5:5489.

Soler

, Yáñez

M.A.

, Chacon

M.R.

, Aguilera-Arreola

M.G.

, Catalán

, Figueras

M.J.

, and Martínez-Murcia

A.J.

. 2004. Phylogenetic analysis of the genus Aeromonas based on two housekeeping genes. Int. J. Syst. Evol. Microbiol., 54(Pt 5):1511–1519.

Puthucheary

S.D.

, Puah

S.M.

, and Chua

K.H.

. 2012. Molecular characterization of clinical isolates of Aeromonas species from Malaysia. PLoS One, 7:e30205.

Beaz-Hidalgo

, Martínez-Murcia

, and Figueras

M.J.

. 2013. Reclassification of Aeromonas hydrophila subsp. dhakensis Huys et al. 2002 and Aeromonas aquariorum Martínez-Murcia et al. 2008 as Aeromonas dhakensis sp. nov. comb nov. and emendation of the species Aeromonas hydrophila. Syst. Appl. Microbiol., 2013; 36:171–176.

Puah

S.M.

, Puthucheary

S.D.

, Liew

F.Y.

, and Chua

K.H.

. 2013. Aeromonas aquariorum clinical isolates: antimicrobial profiles, plasmids and genetic determinants. Int. J. Antimicrob. Agents, 41:281–284.

10.

Khor

W.C.

, Puah

S.M.

, J. Tan

A.M.A.

, Puthucheary

S.D.

, and Chua

K.H.

. 2015. Phenotypic and genetic diversity of Aeromonas species isolated from fresh water lakes in Malaysia. PLoS One, 10:e0145933.

11.

Szczuka

, and Kaznowski

. 2004. Typing of clinical and environmental Aeromonas sp. strains by random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus sequence PCR. J. Clin. Microbiol. 42:220–228.

12.

CLSI. 2010. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated Fastidious Bacteria; Approved Guideline - Second Edition. CLSI Document M45-A2. Clinical and Laboratory Standards Institute, Wayne, PA.

13.

Dallenne

, Da Costa

, Decré

, Favier

, and Arlet

. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother., 65:490–495.

14.

C.J.

, Chen

P.L.

, Wu

J.J.

, Yan

J.J.

, Lee

C.C.

, Lee

H.C.

, Lee

N.Y.

, Chang

C.M.

, Lin

Y.T.

, Chiu

Y.C.

, and Ko

W.C.

. 2012. Distribution and phenotypic and genotypic detection of a metallo-lactamase, CphA, among bacteraemic Aeromonas isolates. J. Med. Microbiol., 61(Pt 5):712–719.

15.

Magiorakos

A.P.

, Srinivasan

, Carey

R.B.

, Carmeli

, Falagas

M.E.

, Giske

C.G.

, Harbarth

, Hindler

J.F.

, Kahlmeter

, Olsson-Liljequist

, Paterson

D.L.

, Rice

L.B.

, Stelling

, Struelens

M.J.

, Vatopoulos

, Weber

J.T.

, and Monnet

D.L.

. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect., 18:268–281.

16.

Beaz-Hidalgo

, Latif-Eugenín

, Hossain

M.J.

, Berg

, Niemi

R.M.

, Rapala

, Lyra

, Liles

M.R.

, and Figueras

M.J.

. 2015. Aeromonas aquatica sp. nov., Aeromonas finlandiensis sp. nov. and Aeromonas lacus sp. nov. isolated from Finnish waters associated with cyanobacterial blooms. Syst. Appl. Microbiol., 38:161–168.

17.

Aravena-Román

, Beaz-Hidalgo

, Inglis

T.J.J.

, Riley

T.V.

, Martínez-Murcia

A.J.

, Chang

B.J.

, and Figueras

M.J.

. 2013. Aeromonas australiensis sp. nov., isolated from irrigation water. Int. J. Syst. Evol. Microbiol., 63(Pt 6):2270–2276.

18.

Martínez-Murcia

, Beaz-Hidalgo

, Svec

, Saavedra

M.J.

, Figueras

M.J.

, and Sedlacek

. 2013. Aeromonas cavernicola sp. nov., isolated from fresh water of a brook in a cavern. Curr. Microbiol., 66:197–204.

19.

Miñana-Galbis

, Farfán

, Gaspar Lorén

, and Carmen Fusté

. 2010. Proposal to assign Aeromonas diversa sp. nov. as a novel species designation for Aeromonas group 501. Syst. Appl. Microbiol., 33:15–19.

20.

Alperi

, Martínez-Murcia

A.J.

, Monera

, Saavedra

M.J.

, and Figueras

M.J.

. 2010. Aeromonas fluvialis sp. nov., isolated from a Spanish river. Int. J. Syst. Evol. Microbiol., 2010; 60(Pt 1):72–77.

21.

Figueras

M.J.

, Alperi

, Beaz-Hidalgo

, Stackebrandt

, Brambilla

, Monera

, and Martínez-Murcia

A.J.

. 2011. Aeromonas rivuli sp. nov., isolated from the upstream region of a karst water rivulet. Int. J. Syst. Evol. Microbiol., 61(Pt 2):242–248.

22.

Alperi

, Martínez-Murcia

A.J.

, Ko

W.C.

, Monera

, Saavedra

M.J.

, and Figueras

M.J.

. 2010. Aeromonas taiwanensis sp. nov. and Aeromonas sanarellii sp. nov., clinical species from Taiwan. Int. J. Syst. Evol. Microbiol., 60(Pt 9):2048–2055.

23.

Figueras

M.J.

, Latif-Eugenín

, Ballester

, Pujol

, Tena

, Berg

, Hossain

M.J.

, Beaz-Hidalgo

, and Liles

M.R.

. 2017. “Aeromonas intestinalis” and “Aeromonas enterica” isolated from human faeces, “Aeromonas crassostreae” from oyster and “Aeromonas aquatilis” isolated from lake water represent novel species. New Microbes New Infect., 15:74–76.

24.

Marti

, and Balcázar

J.L.

. 2015. Aeromonas rivipollensis sp. nov., a novel species isolated from aquatic samples. J. Basic Microbiol., 55:1435–1439.

25.

Morinaga

, Yanagihara

, Eugenin

F.L.L.

, Beaz-Hidalgo

, Kohno

, and Figueras Salvat

M.J.

. 2013. Identification error of Aeromonas aquariorum: a causative agent of septicemia. Diagn. Microbiol. Infect. Dis., 76:106–109.

26.

Beaz-Hidalgo

, Hossain

M.J.

, Liles

M.R.

, and Figueras

M.J.

. 2015. Strategies to avoid wrongly labelled genomes using as example the detected wrong taxonomic affiliation for Aeromonas genomes in the GenBank database. PLoS One, 10:e0115813.

27.

Aravena-Román

, Harnett

G.B.

, Riley

T.V.

, Inglis

T.J.J.

, and Chang

B.J.

. 2011. Aeromonas aquariorum is widely distributed in clinical and environmental specimens and can be misidentified as Aeromonas hydrophila. J. Clin. Microbiol., 49:3006–3008.

28.

C.J.

, Chen

P.L.

, Hsueh

P.R.

, Chang

M.C.

, Tsai

P.J.

, Shih

H.I.

, Wang

H.C.

, Chou

P.H.

, and Ko

W.C.

. 2015. Clinical implications of species identification in monomicrobial Aeromonas bacteremia. PLoS One, 10:e0117821.

29.

Aravena-Román

, Inglis

T.J.J.

, Riley

T.V.

, and Chang

B.J.

. 2014. Distribution of 13 virulence genes among clinical and environmental Aeromonas spp. in Western Australia. Eur. J. Clin. Microbiol. Infect. Dis., 33:1889–1895.

30.

Rasmussen-Ivey

C.R.

, Figueras

M.J.

, McGarey

, and Liles

M.R.

. 2016. Virulence factors of Aeromonas hydrophila: in the wake of reclassification. Front Microbiol., 7:1337.

31.

Chen

P.L.

, Wu

C.J.

, Chen

C.S.

, Tsai

P.J.

, Tang

H.J.

, and Ko

W.C.

. 2014. A comparative study of clinical Aeromonas dhakensis and Aeromonas hydrophila isolates in southern Taiwan: A. dhakensis is more predominant and virulent. Clin. Microbiol. Infect., 20:O428–O434.

32.

Koh

T.H.

, Ko

, Jureen

, Deepak

R.N.

, Tee

N.W.

, Tan

T.Y.

, Tay

M.R.

, Lee

V.J.

, and Barkham

T.M.

. 2015. High counts of carbapenemase-producing Enterobacteriaceae in hospital sewage. Infect. Control Hosp. Epidemiol., 36:619–621.

33.

Hamid

, Ahmad

, and Usup

. 2016. Pathogenicity of Aeromonas hydrophila isolated from the Malaysian sea against coral (Turbinaria sp.) and sea bass (Lates calcarifer). Environ. Sci. Pollut .Res., 23:17269–17276.

34.

Tey

Y.S.

, Suryani

, Emmy

F.A.

, and Illisriyani

. 2009. Food consumption and expenditures in Singapore: implications to Malaysia's agricultural exports. Int. Food Res. J., 16:119–126.

35.

Laith

, and Najiah

. 2013. Aeromonas hydrophila: antimicrobial susceptibility and histopathology of isolates from diseased catfish, Clarias gariepinus (Burchell). J. Aquacult. Res. Dev., 5:215.

36.

Yano

, Hamano

, Tsutsui

, Aue-umneoy

, Ban

, and Satomi

. 2015. Occurrence, molecular characterization, and antimicrobial susceptibility of Aeromonas spp. in marine species of shrimps cultured at inland low salinity ponds. Food Microbiol., 47:21–27.

37.

S.W.

, You

M.J.

, Cho

H.S.

, Lee

C.S.

, Kwon

J.K.

, and Shin

G.W.

. 2013. Molecular characterization of Aeromonas species isolated from farmed eels (Anguilla japonica). Vet. Microbiol., 164:195–200.

38.

Albert

M.J.

, Ansaruzzaman

, Talukder

K.A.

, Chopra

A.K.

, Kuhn

, Rahman

, Faruque

A.S.

, Islam

M.S.

, Sack

R.B.

, and Mollby

. 2000. Prevalence of enterotoxin genes in Aeromonas spp. isolated from children with diarrhoea, healthy controls, and the environment. J. Clin. Microbiol. 38:3785–3790.

39.

Aravena-Román

, Inglis

T.J.J.

, Henderson

, Riley

T.V.

, and Chang

B.J.

. 2012. Antimicrobial susceptibilities of Aeromonas strains isolated from clinical and environmental sources to 26 antimicrobial agents. Antimicrob. Agents Chemother., 56:1110–1112.

40.

Abbott

S.L.

, Cheung

W.K.W.

, and Janda

J.M.

. 2003. The genus Aeromonas: biochemical characteristics, atypical reactions, and phenotypic identification schemes. J. Clin. Microbiol., 41:2348–2357.

41.

Pharmaceutical Services Division. 2014. National Antibiotic Guideline. 2nd ed. Gastrointestinal Infections. Ministry of Health Malaysia, Petaling Jaya, Malaysia, p. 69.

42.

Ruppé

É.

, Woerther

P.L.

, and Barbier

. 2015. Mechanisms of antimicrobial resistance in Gram-negative bacilli. Ann Intensive Care., 5:61.

43.

Chen

P.L.

, Ko

W.C.

, and Wu

C.J.

. 2012. Complexity of β-lactamases among clinical Aeromonas isolates and its clinical implications. J. Microbiol. Immunol. Infect., 45:398–403.

44.

Verner-Jeffreys

D.W.

, Welch

T.J.

, Schwarz

, Pond

M.J.

, Woodward

M.J.

, Haig

S.J.

, Rimmer

G.S.

, Roberts

, Morrison

, and Baker-Austin

. 2009. High prevalence of multidrug-tolerant bacteria and associated antimicrobial resistance genes isolated from ornamental fish and their carriage water. PLoS One, 4:e8388.

45.

Calfee

D.P.

2013. Multidrug-resistant organisms in dialysis patients. Semin. Dial., 26:447–456.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.05 MB

0.12 MB