The First Report of Phenotypic and Molecular Characterization of Extended-Spectrum Beta-Lactamase-Producing Uropathogens in Sikkim and Darjeeling Hills of India

Abstract

Extended-spectrum β-lactamase (ESBL)-producing bacteria are a global health threat both in hospital and in community settings. The emergence of these organisms poses major difficulty in treating infections. This study was carried out to assess major ESBL-producing uropathogens in female patients of Sikkim and Darjeeling by phenotypic and genotypic methods. Out of 1,516 urine samples, 454 uropathogens were isolated with a prevalence rate of 29.94%. Among them, Escherichia coli (74.3%) was the predominant type followed by Klebsiella pneumoniae (20.1%), Pseudomonas aeruginosa (2.4%), and Proteus mirabilis (1.98%). Four different ESBL genes were detected in 63 isolates, which included CTX-M (n = 32), CTX-M+OXA-2 (n = 15), CTX-M-15+OXA-2+TEM (n = 6), OXA-2 (n = 5), TEM+CTX-M-15 (n = 2), TEM+OXA-2+SHV-76 (n = 2), and TEM (n = 1). All ESBL genes (bla genes) were found on a plasmid, which was mostly of HI1, I1, FIA+FIB, FIA, and Y types and was horizontally transferable. Among all ESBL genes, blaCTX-M-I5 group was the most prevalent. The study of urinary tract infection (UTI) caused by ESBL-producing bacteria needs to be studied in other high-altitude parts of India to understand the actual burden of UTI in the female.

Introduction

Penicillins, broad-spectrum cephalosporins, and monobactams hydrolyzing rapidly evolving plasmid-mediated and diverse complex enzymes are known as extended-spectrum β-lactamase (ESBL). ESBL-producing organisms that cause urinary tract infections (UTIs) are increasing in incidence and pose a major burden to healthcare.¹ ESBLs are generally derived from TEM and SHV-type enzymes. CTX-M type enzyme isolated from ESBL producers plays an important role in multidrug resistance as it has been recognized as an important subtype.^1,2 The occurrence of point mutations in the sequence of the primary β-lactamase gene results in variants with both broad- and extended-spectrum activity.³ β-lactamases are classified into four main groups, including A, B, C, and D on the basis of their inhibitory mechanism, type of substrate, and physical characterization such as molecular weight and isoelectric point. According to this classification, broad-spectrum β-lactamase enzyme is categorized among group A.^3,4 Treatment option becomes complicated when an infection is associated with ESBL-producing organisms. Escherichia coli and Klebsiella pneumoniae are common producers of ESBL, and are a major cause of UTIs. β-lactamase-producing bacteria can play an important role in polymicrobial infections.⁵ They can have a direct pathogenic impact in causing the infection as well as an indirect effect on their ability to produce the enzyme β-lactamase. These enzyme-producing Enterobacteriaceae families are associated with a higher morbidity, mortality, and economic burden.⁵ More than 200 types of ESBLs have been found worldwide, most of them belong to the Enterobacteriaceae family.¹ This study was carried out to assess major ESBL-producing uropathogens in female patients of Sikkim and Darjeeling by phenotypic and genotypic characterization.

Materials and Methods

Study design, setting, and sample collection

This study was carried out at the Department of Microbiology, Sikkim University, Sikkim, India. From May 2014 to July 2016, a total number of 1,516 urine samples were collected from female patients suspected to have UTIs. The urine samples were collected from in-patient and out-patient departments of two tertiary hospitals in India: Sikkim Manipal Institute of Medical Sciences in Sikkim and Neotia Get Well Healthcare Centre in Siliguri, Darjeeling.

Standard microbiological techniques were used for the collection, transportation, and processing of clean-catch midstream samples. The uropathogens were isolated on cystine lactose electrolyte deficient agar, Hi chrome UTI agar and Mac Conkey agar plate by the semiquantitative method.⁶ Specimens yielding more than or equal to 10⁵ cfu/ml of urine were interpreted as significant bacteriuria. All the isolates were identified on the basis of gram staining, colony morphology, and standard biochemical tests and a few isolates were further confirmed by Vitek 2 instruments (VITEK 2 compact; Biomerieux).

Phenotypic tests for the detection of ESBL

Screening for ESBL—the screening test of the isolates was done using five antibiotics namely cefotaxime (CTX), ceftazidime (CAZ), ceftriaxone, aztreonam at 1 μg/ml, and cefpodoxime 4 μg/ml (1 μg/ml for Proteus mirabilis) in Mueller Hinton agar (MHA) by the agar dilution method. The isolates that showed growth in any of these antibiotic containing media were suspected to be an ESBL producer and were subjected to a confirmatory test.⁷ Confirmatory tests for ESBL production (combined disk diffusion test): isolates considered to be positive for ESBL production by the screening test were subjected to the phenotypic confirmatory test by using an ESBL kit consisting of CAZ (30 μg) (), ceftazidime+clavulanic acid (30/10 μg) (CAC), CTX (30 μg), and cefotaxime+clavulanic acid (30/10 μg) (CEC).⁷

Molecular characterization of blaESBL genes by multiplex PCR

For the extraction of DNA from bacterial samples, the boiling centrifugation method was used. The organism was cultured in 5 ml Luria–Bertani (LB) broth. One milliliter of culture was transferred into an Eppendorf tube and heated at 85°C for 20 min in a thermomixer. The lysed cell obtained after heating was centrifuged at 15,680 g for 10 min. The supernatant containing DNA was collected in a sterile Eppendorf tube for the detection of ESBL genes.⁸ ESBL genes were detected by multiplex PCR (BioRad) in a total volume of 25 μl containing 23.5 master mix and 1.5 μl of template DNA. For amplification and characterization of blaESBL, a set of eight primers were used, namely blaTEM, blaCTX-M, blaSHV, blaOXA-2, blaOXA-1O, blaPER, blaGES, and blaVEB (Table 1). Reactions were run under the following conditions: initial denaturation at 94°C for 5 min, 33 cycles of 94°C for 35 sec, 51°C for 1 min, 72°C for 1 min, and the final extension at 72°C for 7 min.⁸ PCR products were separated by gel electrophoresis on 1% agarose gel.

Table 1.

Detailed Information of Primers Used in Multiplex PCR for Detection of bla Genes in Extended-Spectrum β-Lactamase Producers

List of primer pairs	Target	Sequence (5′-3′)	Product size (bp)	References
TEM-F	TEM	ATGAGTATTCAACATTCCG	867	Bert et al. (2002)¹⁶
TEM-R	TEM	CTGACAGTTACCAATGCTTA	867	Bert et al. (2002)¹⁶
SHV-F	SHV	AGGATTGACTGCCTTTTTG	392	Colom et al. (2003)¹⁷
SHV-R	SHV	ATTTGCTGATTTCGCTCG	392	Colom et al. (2003)¹⁷
CTX-M-F	CTX-M	CGCTTTGCGATGTGCAG	550	Lee et al. (2005)¹⁸
CTX-M-R	-1, -2, -9 group	ACCGCGATATCGTTGGT	550	Lee et al. (2005)¹⁸
OXA-10-F	OXA-2 group	TCAACAAATCGCCAGAGAAG	478	Bert et al. (2002)¹⁶
OXA-10-R	OXA-2 group	TCCCACA CCAGAAAAACCAG	478	Bert et al. (2002)¹⁶
OXA-2-F	OXA-2	AAGAAACGCTACTCGCCTGC	276	Bert et al. (2002)¹⁶
OXA-2-F	OXA-2	CCACTCAACCCATCCTACCC	276	Bert et al. (2002)¹⁶
VEB-F	PER	CATTTCCCGATGCATGCAAAGCGT	650	Lee et al. (2005)¹⁸
VEB-R	PER	CGAAGTTTCTTTGGACTCTG	650	Lee et al. (2005)¹⁸
GES-F	GES	AGTCGGCTAGACCGGAAAG	863	Lee et al. (2005)¹⁸
GES-R	GES	TTTGTCCGTGCTCAGGAT	863	Lee et al. (2005)¹⁸
PER-F	VEB	AATTTGGGCTTAGGGCAGAA	923	Lee et al. (2005)¹⁸
PER-R		AATTTGGGCTTAGGGCAGAA
PER-R		ATGAATGTCATTATAAAAGC

Plasmid stability test of isolates harboring ESBLs

Plasmid stability analysis of all ESBL producers as well as their transformants was analyzed by the serial passages method for 110 consecutive days at 1:1,000 dilutions in LB broth without antibiotic pressure.⁹ PCR assay was carried out for the presence of bla genes in the isolates after each passage.

Plasmid preparation, genetic transferability, and incompatibility typing

ESBL positive bacterial isolates were cultured in LB broth (Hi-Media, Mumbai, India) containing 0.25 μg/ml of cefoxitin. After overnight incubation, plasmids were extracted by QIAprep Spin Miniprep kit (Qiagen, Germany). Plasmids of bla genes were subjected to transformation by heat shock method using E. coli JM107 as a recipient. Transformants were selected on LB agar with 0.25 μg/ml of cefoxitin, which were then confirmed both by phenotypic and by PCR analysis. The plasmids were characterized by PCR-based replicon typing for determining the incompatibility group type of the plasmid in all bla genes harboring strains.¹⁰ A total of 18 different replicon types such as FIA, FIB, FIC, HI1, HI2, I1/Iγ, L/M, N, P, W, T, A/C, K, B/O, X, Y, F, and FIIA were targeted by 5 multiplex and 3 simplex PCR.¹¹

DNA sequence analysis

Chromosomal DNA from representative strains was prepared and purified by procedures described previously.⁸ Sequencing was performed to identify specific CTX-M and SHV type ESBL genes. The DNA was sequenced using the dideoxynucleotide chain termination method at Sci genome, Kakkanad, Cochin, India. The ABI sequence files were assembled, and contigs were prepared using Codon Code aligner software (CodonCode Aligner 7.0.1.).

Nucleotide sequence similarity searches were performed using the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) server on GenBank database, release 138.0.¹²

Antibiotic susceptibility testing

Antibiotic susceptibility testing was performed by the Kirby–Bauer disk diffusion method on the MHA as per Clinical Laboratory Standards Institute guidelines to determine the resistance pattern of different bacterial isolates.⁷

Results

Among the 1,516 urine samples collected from female patients suspected to have a UTI, 454 showed significant growth (significant bacteriuria) of a single type of microorganism with a prevalence rate of 29.94%.

E. coli were found to be the most predominant uropathogen among the 454 samples with a percentage of 74.3% followed by K. pneumoniae (20.1%), Pseudomonas aeruginosa (2.4%), and P. mirabilis (1.98%). Among the total uropathogens, ESBL producers by the phenotypic test were 18.9% (n = 86). Among 86 samples that were phenotypically confirmed as ESBL producers, 63 isolates showed the presence of β-lactamase genes by multiplex PCR (13.8%). Sanger sequencing confirmed the occurrence of ESBL genes and also revealed its different variants. Four different ESBL gene variants were detected, which included CTX-M-15 (n = 32), OXA-2 (n = 5), TEM (n = 1), CTX-M-15+OXA-2 (n = 15), TEM+CTX-M-15 (n = 2), CTX-M-15+OXA-2+TEM (n = 6), and TEM+OXA-2+SHV-76 (n = 2) (Fig. 1). CTX-M-15 gene was found to be more prevalent (87.03%). The ESBL genes were distributed among different uropathogens (Table 2). It was observed that in 25 isolates, blaCTX-M-15 was present with other coexisting ESBL genes.

FIG. 1.

Agarose gel showing PCR amplified products. Lane M: 1,000 bp DNA ladder. Lane 1: blaCTX-M, Lane 2: blaCTX-M, Lane 3: No band, Lane 4: blaTEM+SHV, Lane 5: blaCTX-M, Lane 6: blaCTX-M, Lane 7: blaCTX-M, Lane 8: bla CTX-M+OXA-2, Lane 9: +ve control (blaCTX-M), Lane 10: −ve control.

Table 2.

Distribution of Extended-Spectrum β-Lactamase Gene Among Uropathogens

	Microorganism
blagene	Escherichia coli	Klebsiella pneumoniae	Proteus mirabilis	Total frequency
CTX-M-15	24	8	0	32
OXA-2	4	1	0	5
TEM	0	1	0	1
CTX-M-15+OXA-2	9	6	0	15
CTX-M-15+TEM	2	0	0	2
TEM+SHV-76	1	0	0	1
CTX-M-15+OXA-2+TEM	4	2	1	6
TEM+OXA-2+SHV-76	1	0	0	2

Plasmid analysis showed that the ESBL gene was encoded within the plasmid of ∼18 kb in size. In the transformation assay, the ESBL gene was found to be horizontally transferable and the resistance determinant was carried within diverse incompatibility (inc) group, namely HI1, I1, FIA+FIB, FIA, and Y types. Nine plasmids had an incompatibility group of FIA+FIB and Y, respectively, followed by HI1 (n = 5), FIA (n = 4), and I1 (n = 3). In the stability analysis, the mentioned Inc types harboring ESBL genes showed progressive plasmid loss after 28 passages. This implicates the specialized adaptation of this plasmid for the survival of host under cephalosporin stress in both hospitals and in the community.

Imipenem, gentamicin, and piperacillin/tazobactam showed good response against ESBL uropathogens, whereas high (>60%) resistance was shown against ampicillin (Table 3). P. aeruginosa and P. mirabilis showed 100% resistance to nitrofurantoin.

Table 3.

Resistance Pattern of Isolated Uropathogens Against Commonly Used Antibiotics

	Antibiotics
Microorganisms	AMP (%)	GEN (%)	TZP (%)	NET (%)	NOR (%)	CEP (%)	FOX (%)	CXM (%)	CIP (%)	CAZ (%)	SXT (%)	NIT (%)	IMI (%)
E. coli	84.7	25.14	25.88	20.7	87.88	52.9	43.27	66.76	57.89	66.37	71.6	44	10.1
K. pneumoniae	88	4.67	23.91	16.30	20.65	44.56	31.52	48.91	35.86	60.86	70	67	13.4
P. mirabilis	66.67	11.12	11.12	22.23	22.23	44.45	33.34	44.45	36.37	55.56	81.5	100	10.4
Pseudomonas aeruginosa	90	9	9.09	54.5	27.2	64.6	54.54	72.7	11.12	81.81	100	100	15.8

AMP, ampicillin; GEN, gentamicin; TZP, piperacillin/tazobactam; NET, netillin; CEP, cephalothin; FOX, cefoxitin; CXM, cefuroxime; CIP, ciprofloxacin; CAZ, ceftazidime; SXT, trimethoprim/sulfamethoxazole; NIT, nitrofurantoin; IMP, imipenem.

Discussion

It is well known that CTX-M enzymes are replacing SHV and TEM enzymes as the most predominant ESBL type.¹³ Moreover, it has been reported that blaCTX-M-15 producing E. coli has spread worldwide¹⁴ and this resistance determinant is a major contributor to expanded-spectrum cephalosporin resistance in clinical settings.¹⁰ Similarly, in this study, most of the Gram-negative bacilli produced blaCTX-M-15 in concomitant with blaOXA-2. From our study, we documented that blaCTX-M-15 in combination with blaOXA-2 is the dominant ESBLs in Sikkim and Darjeeling hills of India. On the contrary, Bajpai et al. observed blaTEM as the dominant type followed by blaCTX-M and blaSHV in central India among male and female UTI patients of the study area.¹⁵

Moreover, we also found that some uropathogens harbored a combination of three ESBL genes. None of the isolates produced GES, VEB, or PER β-lactamase. We tried to check the medical history of patients harboring the resistance gene and we found that most of the patients were suffering from pyelonephritis and recurrent UTI with multidrug-resistant bacteria. In the stability analysis, the different incompatibility types harboring β-lactamase genes showed progressive plasmid loss after 28 days, unlike Maurya et al., who showed a complete plasmid loss after 40 passages in P Inc type harboring blaCTX-M-15.¹⁰ Through this kind of study that has been conducted in this region, we can understand the local distribution of these ESBL resistant genes and their movement, adaptability, and propagation under antibiotic exposure in different clinical environmental conditions. Interestingly, in this study, it was observed that β-lactamase genes were horizontally transferred through multiple incompatible types of plasmids. This proves their diverse source of origin and adaptation in both hospital and community settings. ESBL genes are known to be pandemic and are often reported to be carried within Inc FII plasmid.¹⁵

In our study, we found the majority of plasmids belonged to an incompatibility group of FIA+FIB (n = 9), followed by Y (n = 9), HI1 (n = 5), FIA (n = 4), and I1 (n = 3). There are some reports of plasmids belonging to incompatibility groups of I1, A/C, L/M, and N types as well. On the contrary, Maurya et al., reported their carriage through I1, F (FIA = 6; FIC = 3; FrepB = 3), W, and P Inc groups 15. The presence of this resistance gene in uropathogens in hospital and community might be due to the extensive use of CTX and ceftriaxone in this setting.

Conclusion

In this study, E. coli was found to be the main etiological agent of UTI with ESBL production among the patients of Sikkim and Darjeeling. The blaCTX-M-I5 group was the most prevalent ESBL type, followed by blaOXA-2 and blaCTX-M-I5 enzymes together. Imipenem and gentamicin were found to be the drug of choice against commonly isolated uropathogens. This study was conducted for the first time in this part of India. This study advocates further investigation of community-acquired UTIs to identify the cause and sources of such infections. Therefore, continuous surveillance for ESBL-producing uropathogens needs to be carried out specifically among women residing in higher altitude areas in different parts of this country.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Fernando

M.M.

, Luke

W.A.

, Miththinda

J.K.

, Wickramasinghe

R.D.

, Sebastiampillai

B.S.

, Gunathilake

M.P.

, Silva

F.H.

, and Premaratna

. 2017. Extended-spectrum beta-lactamase producing organisms causing urinary tract infections in Sri Lanka and their antibiotic susceptibility pattern—a hospital-based cross-sectional study. BMC Infect. Dis., 17:138.

Jesus

R.B.

, and Paterson

D.L.

. 2006. Change in the epidemiology of infections due to extended-spectrum β-lactamase—producing organisms. Clin. Infect. Dis., 42:935–937.

Al-Jasser

A.M.

2006. Extended-spectrum beta-lactamases (ESBLs): a global problem. Kuwait Med. J., 38:171–185.

Medeiros

A.A.

1993. Nosocomial outbreaks of multiresistant bacteria. Extended-spectrum beta-lactamases have arrived in North America. Ann. Intern. Med., 119:428–430.

Thenmozhi

, Moorthy

, Sureshkumar

B.T.

, and Suresh

. 2014. Antibiotic resistance mechanism of ESBL producing Enterobacteriaceae in clinical field: a review. Int. J. Pure App. Biosci., 2:207–226.

Collee

J.G.

, Miles

R.S.

, and Wan

. 1996. Tests for the identification of bacteria. In Mackie and Cartney

(ed.), Practical medical microbiology. Elsevier, London, United Kingdom, pp. 131–150.

Clinical and Laboratory Standards Institute.. 2008. Performance Standards for Antimicrobial Disk and Dilution Antimicrobial Susceptibility Tests for Bacteria Isolated from Animals; Approved Standard. 3rd ed. CLSI document, M31-A3. CLSI, Wayne, PA.

Upadhyay

, Hussain

, Mishra

, Maurya

A.P.

, Bhattacharjee

, and Joshi

S.R.

. 2015. Genetic environment of plasmid-mediated CTX-M-15 extended-spectrum beta-lactamases from clinical and foodborne bacteria in North-Eastern India. PLoS One, 10:e0138056.

Locke

J.B.

, Rahawi

, Lamarre

, Mankin

A.S.

, and Shaw

K.J.

. 2012. Genetic environment and stability of cfr in methicillin-resistant Staphylococcus aureus CM05. Antimicrob. Agents Chemother., 56:332–340.

10.

Maurya

A.P.

, Mishra

, Talukdar

A.D.

, Dhar Chanda

, Chakravarty

, and Bhattacharjee

. 2016. Diverse genetic array of bla CTXM-15 in Escherichia coli: a single-center study from India. Microb. Drug Resist., 22:7–14.

11.

Carattoli

2011. Plasmids in gram-negatives: molecular typing of resistance plasmids. Int. J. Med. Microbiol., 301:654–658.

12.

Altschul

S.F.

, Gish

, Miller

, Myers

E.W.

, and Lipman

D.J.

. 1990. Basic local alignment search tool. J. Mol. Biol., 215:403–410.

13.

Eriksson

, Gustafson

, Fagerström

, and Olofsson

. 2011. Urinary tract infection in very old women is associated with delirium. Int. Psychogeriatr., 23:496–502.

14.

Pitout

J.D.

, and Laupland

K.B.

. 2008. Extended-spectrum β-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect. Dis., 8:159–166.

15.

Bajpai

, Pandey

, Varma

, and Bhatambare

G.S.

. 2017. Prevalence of TEM, SHV, and CTX-M beta-lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J. Med., 7:12–16.

16.

Bert

2002. Identification of PSE and OXA beta-lactamase genes in Pseudomonas aeruginosa using PCR–restriction fragement length polymorphism. J. Antimicrob. Chemother., 50:11–18.

17.

Colom

, Perez

, Alonso

, Fernandez-Aranguiz

, Larino

, and Cisterna

. 2003. Simple and reliable multiplex PCR assay for detection of bla TEM, bla SHV and bla OXA-1 genes in Enterobacteriaceae. FEMS Microbiol. Lett., 223:147–151.

18.

Lee

, Park

Y.J.

, Kim

, Lee

H.K.

, Han

, Kang

C.S.

, and Kang

M.W.

. 2005. Prevalence of Amber class A and D Beta-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J. Antimicrob. Chemother., 56:122–127.