Macrolide-Resistance Selection in Tibetan Pigs with a High Load of Mycoplasma hyopneumoniae

Abstract

Currently, tylosin tartrate is the first-line treatment for Mycoplasma hyopneumoniae infections in China. However, the efficacy of tylosin tartrate and resistance to this treatment in M. hyopneumoniae infections of Tibetan pigs are unknown. In this study, we examined the prevalence of M. hyopneumoniae infection in Tibetan pigs at three intensive farms in Tibet, China. In addition, we investigated the efficacy of tylosin tartrate treatment for porcine enzootic pneumonia by monitoring M. hyopneumoniae DNA eradication dynamics and macrolide resistance (MR). Eighty-two of 450 (18.2%) Tibetan pigs tested positive for only M. hyopneumoniae, and most of these animals (85.1%) had symptoms and signs of pneumonia. The elimination of M. hyopneumoniae DNA was substantially faster in Tibetan pigs with a lower pretreatment M. hyopneumoniae load, and the total eradication rate was 97.4% (75/77). Two Tibetan pigs tested positive for M. hyopneumoniae that contained macrolide resistance–determining mutations in the 23S rRNA gene. Our results indicate that the pretreatment M. hyopneumoniae load may be an effective predictor of macrolide treatment efficacy (and possibly that of other antimicrobial agents) and MR. Moreover, our results suggest that danofloxacin mesylate can be used as an alternative drug for the treatment of macrolide-resistant M. hyopneumoniae infection acquired during intensive farming.

Introduction

Mycoplasma hyopneumoniae is a primary cause of swine enzootic pneumonia in Tibetan pig herds. In free-ranging Tibetan pigs, the rate of positivity for M. hyopneumoniae infection ranges from 25% to 100%,^1–4 while among Tibetan pigs in intensive culture, the positivity rate ranges from 1.1% to 100%.^5,6 There are no universally accepted methods for the prevention and control of M. hyopneumoniae infections. After a comprehensive analysis of the large-scale application convenience, investment cost,⁷ and the immediate and residual effects, the recommended drugs for treatment of porcine enzootic pneumonia in the pig agricultural industry in China include macrolides, tetracyclines, fluoroquinolones, valnemulin, and pleuromulin.^8–16 In two large-scale farms in Tibet, tetracyclines have shown a medium or high efficacy against M. hyopneumoniae. Erythromycin thiocyanate, at an oral dose of 2 − 2.5 mg/kg, thrice a day, has been extensively used in China for decades. Thus, erythromycin thiocyanate–resistant M. hyopneumoniae is more prevalent on large-scale farms in China.⁸

Evidence suggests that selective erythromycin thiocyanate resistance is related to its long-term use and genetic mutation in the pathogens. One hypothesis regarding Tibetan pigs is that a higher load of M. hyopneumoniae relates to more advanced clinical severity; more advanced clinical severity relates to a greater likelihood of treatment failure.^17–19 In addition, the erythromycin thiocyanate–resistant strain of M. hyopneumoniae contains a resistance-associated mutation in domain V of the 23S rRNA, which is encoded as a single copy gene in M. hyopneumoniae.

Currently, tylosin tartrate is used, with medium sensitivity, as the first-line treatment against M. hyopneumoniae infection. In the pig agricultural industry in China, tylosin tartrate is administered at a dose of 250 − 500 mg/L in drinking water, twice a day, for 3 − 5 days. Alternatively, a dilution of tylosin tartrate in fresh water can be mixed well with the feed at a dose of 0.5 − 1 g/kg feed of tylosin tartrate and dried for 30 min before feeding, twice a day, for 3 − 5 days. In addition, a subcutaneous or intramuscular injection of tylosin tartrate at a dose of 2 − 13 mg/kg of pig body weight (bw) can be administered twice a day, for 3 days. Several randomized clinical trials have shown that tylosin tartrate is more effective than erythromycin thiocyanate in eradicating M. hyopneumoniae infection in pigs.²⁰

Consistent with the high efficacy of tylosin tartrate against M. hyopneumoniae in vitro,^21,22 in vivo data also show a higher efficacy of tylosin tartrate against M. hyopneumoniae compared with erythromycin thiocyanate. However, clinical trial data on M. hyopneumoniae treatment in Tibetan pigs are limited. Macrolide resistance (MR) can occur within the pig agricultural industry, in which case danofloxacin mesylate at 2.5 mg/kg·bw (<400 mg per day), for 10 days, is widely used in China as an alternative to tylosin tartrate treatment.

The present study was performed to determine the prevalence of M. hyopneumoniae in Tibetan pigs from three intensive farms in Tibet, from September 1, 2016 to December 28, 2016. We investigated the efficacy of tylosin tartrate treatment for porcine enzootic pneumonia, monitoring M. hyopneumoniae DNA eradication dynamics²³ and MR selection in M. hyopneumoniae during tylosin tartrate treatment of porcine enzootic pneumonia.

Methods

The experimental analysis for our study was performed at the Veterinary Pharmacology Laboratory and Plateau Animal Disease Testing Laboratory at the XiZang Agriculture and Animal Husbandry College, Tibet, P.R. China.

Study animals and sample collection

According to a previous report,²⁴ there are currently 300,000 Tibetan pigs in P.R. China; most of the Tibetan pigs (about 200,000) are found in Tibet, P. R. China. Three of the 12 farms investigated were the sites for the present study and are located in the core Tibetan pig-producing area (Linzhi). There are about 4,300 Tibetan pigs in these three farms. From September 1, 2016, to December 28, 2016, we evaluated a consecutively numbered sample of Tibetan pigs (n = 450) from the three intensive farms in Tibet, P. R. China. Cough, asthma, and abdominal breathing were suspected as symptoms of pneumonia. Tibetan pigs with pneumonia symptoms were segregated from intensive farming. The segregated Tibetan pigs were from all production stages of development and were clinically examined. Whole blood samples were collected for automated blood analysis, and bronchoalveolar lavage fluid (BALF) and nasopharyngeal swabs were collected for polymerase chain reactions (PCRs). BALF was collected using a fiber-optic bronchoscope (PENTAX FB-15BS, Montvale, NJ) equipped with sterile rubber pneumatic bag. The bronchoscope was disinfected using 2% glutaraldehyde followed by repeated flushing with sterilized normal saline. Atropine (0.5 mg) was injected intramuscularly 30 min before sample collection. Lidocaine (2%) was used as a local anesthetic for the throat. Each animal was sampled twice.

Laboratory diagnostics: Automatic blood analyzer and quantitative real-time PCR

An automatic blood analyzer was used to analyze pig whole blood. Cough, asthma, and abdominal breathing were suspected as pneumonia symptoms. Simultaneously, the presence of polymorphonuclear leukocytes (PMNLs) at ≥10 × 10⁹/L was suspected as indicating porcine pneumonia.²⁵ Thus, a combination of symptoms, rather than a specific criterion, is used in the diagnostic of swine mycoplasmal pneumoniae. The diagnosis of swine mycoplasmal pneumoniae is based on the diagnostic techniques for swine mycoplasmal pneumoniae of the Standards of Agricultural Industry of the People's Republic of China (NY/T 1186-2006).

M. hyopneumoniae DNA was detected in BALF using real-time quantitative PCR (ABI 7000 Real-time PCR System, Foster City, CA)²⁶ as described in Strait et al. Primers were designed using the Primer Express software (Premier 5.0, Palo Alto, CA) and produced by Sangon Biotech Co., Ltd. (Shanghai, China). Total genomic DNA was extracted using a DNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's procedures. A QuantiTect Probe PCR Kit (QIAGEN, Germantown, MD) was used for the reaction. The extracted DNA was kept at −20°C for further processing. The PCR mix contained 400 nM of each primer, 120 nM of TaqMan probe, 5 μl of DNA, and 12.5 μl of Master Mix and brought to 25 μl with sterile RNase-free water. The thermal cycling conditions were an initial denaturation at 95°C for 15 min, 40 cycles each consisting of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec, and a final extension at 72°C for 8 min. For 23S rRNA detection using real-time PCR, the lactate dehydrogenase (P36) gene was used as the internal standard^27,28; the main steps for analysis were RNA extraction (using TRIzol^® Max™ Bacterial RNA Isolation Kit, Waltham, MA), analysis of RNA quality, and sample cDNA synthesis (First-Strand cDNA Synthesis Kit; GeneCopoeia, Inc., Maryland). Detection of M. hyopneumoniae CVCC359 (the J strain) was used as a positive control. The thermal cycling conditions were the same as those mentioned above, and the resulting PCR DNA amplicons were sequenced using the shotgun method (Sangon Biotech Co., Ltd). The detection limit of this technique is 1,000 genomes/ml.

Monitoring the effects of tylosin tartrate

M. hyopneumoniae–positive Tibetan pigs that did not have other pathogenic infections and that had not been given antimicrobials for 5 weeks before our experiment were used to monitor the curative effect of tylosin tartrate (7 mg/kg of pig bw, twice a day, 5 days). From each Tibetan pig, one whole blood sample was collected for a routine blood test, and one nasopharyngeal swab and one BALF sample were collected for PCR on the third and eighth day of treatment. Similar nasopharyngeal swabs and BALF samples were collected at 2 and 14 days after the treatment finished. BALF (50 ml) was collected twice from each Tibetan pig and placed in Eppendorf tubes. To quantify the M. hyopneumoniae load in these samples, three DNA calibrators, based on the known concentrations of the lactate dehydrogenase gene (i.e., p36 gene, species-specific gene, 10², 10³, 10⁴ genome equivalents [GEQ]/reaction), were used for quantitative real-time PCR assay.²⁹ The concentration of M. hyopneumoniae detected was represented as the amount of [log10] GEQ/ml of transport medium. The M. hyopneumoniae load in every sample was classified as high (≥6 [log10] GEQ/ml), moderate (>4 to <6 [log10] GEQ/ml), or low (≤4 [log10] GEQ/ml). The M. hyopneumoniae-positive specimens were preserved at −80°C before use in sequencing experiments to identify MR-determining mutations. Simultaneously, nasopharyngeal swabs and BALF samples were used to detect porcine Actinobacillus pleuropneumoniae, Streptococcus suis, and Pasteurella multocida by PCR, similar to the detection of M. hyopneumoniae. The porcine A. pleuropneumoniae PCR–based detection was performed in accordance with Bossé's method³⁰; S. suis was detected by PCR based on Wisselink's method³¹; and P. multocida was detected as described by Kacerovsky et al.^19,32 A. pleuropneumoniae (CVCC3559), S. suis (CVCC3313), and P. multocida (CVCC1765) were used as positive control strains.

Antimicrobial susceptibility testing

In vitro M. hyopneumoniae susceptibility to tylosin tartrate (98%; EKEAR, Shanghai, China) was determined using the microbroth dilution method, as previously described.³³ Twofold dilutions of antibiotics, from 0.04 to 10 μg/ml, were tested.

Results

Pneumonia symptoms, PMNL assay results, and pneumonia pathogens in Tibetan pigs

The primers used in this study are shown in Table 1. Of the 450 Tibetan pigs evaluated, 186 (41.33%) had pneumonia symptoms, and neutrophil detection confirmed pneumonia. In addition, 68 (15.11%) pigs had no symptoms, but neutrophil detection revealed a possible bacterial infection (Table 2). Among the 186 cases with pneumonia symptoms, the presence of M. hyopneumoniae was confirmed in 82 (44.09%). M. hyopneumoniae was also detected in five Tibetan pigs without symptoms, but the number of PMNLs was <10 × 10⁹/L.

Table 1.

Primers Used in the Present Study

Primer target		Sequence (5′→3′)
Porcine Actinobacillus pleuropneumoniae transferrin-binding outer membrane protein (tfbA) gene	Forward primer	GGCGATTAATCCTACGGGCA
	Reverse primer	TCGTTAGCCCGACGTTTTGA
Streptococcus suis 16S rRNA	Forward primer	GTTGGTGAGGTAACGGCTCA
Streptococcus suis 16S rRNA	Reverse primer	TGCCGAAGATTCCCTACTGC
Pasteurella multocida 16S rRNA	Forward primer	ACGGGTGAGTAATGCTTGGG
Pasteurella multocida 16S rRNA	Reverse primer	GAGATCGTCGGCTTGGTAGG
Mycoplasma hyopneumoniae p36 gene	Forward primer	AGTATCGCCTAATTCGGTTCAG
Mycoplasma hyopneumoniae p36 gene	Reverse primer	CCGTGAAATCCGTATTCTCCTC
M. hyopneumoniae 23S rRNA	Forward primer	AAAGGCGCAATGATCTCCCT
M. hyopneumoniae 23S rRNA	Reverse primer	TACCCAGCTATGCCTTTGGC

Table 2.

Pneumonia Symptoms, Polymorphonuclear Leukocytes, and Pneumonia Pathogens Detected in 450 Tibetan Pigs from Three Intensive Farms in Tibet, China, Between September and December in 2016

		Porcine Actinobacillus pleuropneumoniae	M. hyopneumoniae	S. suis	P. multocida
Clinical characteristics and PMNLs	Number of Tibetan pigs	Positive	Positive ^a	Positive	Positive
Ss and PMNLs ≥10 × 10⁹/L	186	50	82	35	13
Ss and PMNLs <10 × 10⁹/L	0	0	0	0	0
Nss and PMNLs ≥10 × 10⁹/L	68	18	39	3	5
Nss and PMNLs <10 × 10⁹/L	196	7	5^a	2	3
Total	450	75	126	40	21

Five Tibetan pigs tested positive for M. hyopneumoniae and some other pathogen, that is, porcine A. pleuropneumoniae (n = 3), S. suis (n = 1), or P. multocida (n = 1).

Nss, no symptoms/signs; PMNLs, polymorphonuclear leukocytes; Ss, symptoms/signs.

M. hyopneumoniae-positive Tibetan pigs

In all, M. hyopneumoniae was detected in 126 (28.00%) of 450 Tibetan pigs. However, five of the M. hyopneumoniae–positive Tibetan pigs were also positive for other pneumonia pathogens, including porcine A. pleuropneumoniae, S. suis, and P. multocida. The number of Tibetan pigs receiving treatment with antimicrobials for respiratory system infection for 5 weeks before the experiment was zero.

The 126 Tibetan pigs that tested positive for M. hyopneumoniae corresponded to 67.74% of the 186 confirmed pneumonia cases. In these 126 M. hyopneumoniae–positive Tibetan pigs, 82 (65.08%) had symptoms of pneumonia and PMNL of ≥10 × 10⁹/L, 39 (30.95%) were asymptomatic but had PMNL ≥10 × 10⁹/L, and five (3.97%) had no symptoms and PMNL <10 × 10⁹/L. In addition, 12 (9.52%) of the 126 Tibetan pigs had PMNL >15 × 10⁹/L.

Efficacy of tylosin tartrate

Of the 82 Tibetan pigs that tested positive for only M. hyopneumoniae, 77 (93.9%) were used to evaluate the curative efficacy of tylosin tartrate. The efficacy of tylosin tartrate in the treatment of Tibetan pig pneumonia is shown in Table 3.

Briefly, 21 (27.27%), 45 (58.44%), and 11 (14.29%) Tibetan pigs had a low (≤4 [log10] GEQ/ml), moderate (>4 to <6 [log10] GEQ/ml), and high (≥6 [log10] GEQ/ml) pretreatment M. hyopneumoniae load, respectively. The 23S rRNA gene sequences from the pretreatment M. hyopneumoniae samples (n = 77) showed no mutation. After 3 days of treatment, 51.95% (40/77) of the Tibetan pigs were negative, while 89.61% (69/77) were negative for M. hyopneumoniae after 8 days of treatment. The elimination of M. hyopneumoniae DNA occurred significantly faster in Tibetan pigs with a lower pretreatment M. hyopneumoniae load. After treatment for 3 days, the 21 Tibetan pigs with a low pretreatment bacterial load were negative for M. hyopneumoniae, and only 2.22% (1/45) of Tibetan pigs with a moderate pretreatment M. hyopneumoniae load had detectable levels of M. hyopneumoniae DNA at 2 days posttreatment, with complete elimination at 14 days posttreatment. However, two (18.18%) cases among the 11 Tibetan pigs with a high pretreatment M. hyopneumoniae load remained positive for 2 weeks after the completion of treatment (Table 3). These two Tibetan pigs were strictly isolated during the tylosin tartrate treatment and were followed up for 2 weeks after completing the treatment. These two Tibetan pigs, in which no 23S rRNA point mutation was detected, were finally cured by treatment with aminophylline (0.5 g each time, twice a day, for 3 days) and danofloxacin mesylate injection (2 mg/kg·bw, once a day, for 3 days). Thus, tylosin tartrate treatment had an M. hyopneumoniae DNA eradication rate of 97.4% (75/77). Details regarding the two cases of treatment failure are provided in Table 4.

Table 3.

Efficacy of Tylosin Tartrate in the Treatment of Tibetan Pig Pneumonia

		No. (%) of M. hyopneumoniae-positive Tibetan pigs
Bacterial load pretreatment	M. hyopneumoniae DNA concentration ([log10] GEQ/ml)	0 Day/T	3 Day/T	8 Day/T	2 Day/ACT	14 Day/ACT
Low	≤4	21 (100)	6 (28.57)	0 (0)	0 (0)	0 (0)
Moderate	>4 to <6	45 (100)	25 (55.56)	4 (8.89)	1 (2.22)	0 (0)
High	≥6	11 (100)	6 (54.55)	4 (36.36)	2 (18.18)	2 (18.18)
Total no. of Tibetan pigs examined		77	77	77	77	77

Day/ACT, days/after completed treatment; Day/T, days/treatment; [log10] GEQ/ml, log₁₀ of genome equivalents/ml.

GEQ, genome equivalents.

Table 4.

Bacterial Load in [log10] GEQ/ml (23S rRNA Gene), Symptoms, and Polymorphonuclear Leukocyte at Different Times for the Two Cases of Treatment Failure for M. hyopneumoniae Using Tylosin Tartrate

Tibetan pigs	Culture mode	0 Day/T	3 Day/T	8 Day/T	2 Day/ACT	14 Day/ACT
tmhA	Intensive	7.5 (WR)	5.1 (WR)	0.7 (N)	2.4 (G2059A)	2.5 (G2059A)
tmhA	Intensive	Severe pneumonia symptoms 15 − 35 × 10⁹/L PMNL	Less severe pneumonia symptoms 12 − 23 × 10⁹/L PMNL	Mild pneumonia, 3 − 5 × 10⁹/L PMNL	Asymptomatic, 5 − 10 × 10⁹/L PMNL	Less severe pneumonia symptoms, 20 − 25 × 10⁹/L PMNL
tmhB	Intensive	7.4 (WR)	4.3 (WR)	0.9 (N)	1.9 (A2064G)	2.3 (A2064G)
tmhB	Intensive	Severe pneumonia symptoms, 40 − 50 × 10⁹/L PMNL	Less severe pneumonia symptoms, 15 − 35 × 10⁹/L PMNL	Mild pneumonia 3 − 4 × 10⁹/L PMNL	Asymptomatic, 5 − 13 × 10⁹/L PMNL	Severe pneumonia symptoms, 30 − 50 × 10⁹/L PMNL

N, not detected; WR, wild-type 23S rRNA gene sequence.

Two Tibetan pigs had severe symptoms of pneumonia and PMNL of >10 × 10⁹/L and were diagnosed with swine mycoplasmal pneumonia. They were treated with tylosin tartrate (intramuscular injection of 8 mg/kg·bw for 3 days) and their symptoms and signs were resolved. However, the symptoms and signs of severe pneumonia recurred at the second week after treatment. The two M. hyopneumoniae strains identified in these two Tibetan pigs showed mutations in the MR region of the 23S rRNA gene. The TmhA strain had a G2059A mutation, and the TmhB strain had an A2064G mutation (Table 4). These Tibetan pigs were ultimately cured with an intramuscular injection of danofloxacin mesylate at 2.5 mg/kg·bw for 10 days. The standard of cure was the absence of symptoms and a negative real-time quantitative PCR (qPCR) test. None of the Tibetan pigs with symptoms died.

Drug-resistance susceptibility tests

M. hyopneumoniae field strains with a minimal inhibitory concentration (MIC) of ≥0.63 μg/ml to tylosin tartrate should be considered as resistant strains.³⁴ Drug sensitivity tests showed that the MIC of the tmhA strain was 1.25 μg/ml and 2.5 μg/ml for the tmhB strain; both were considered tylosin tartrate resistant.

Discussion

Our study shows that M. hyopneumoniae in Tibet (P. R. China) is a common cause of pneumonia in Tibetan pigs. None of the Tibetan pigs were vaccinated against M. hyopneumoniae. In addition, for tartrate tylosin, a first-line pneumonia treatment drug in China, the M. hyopneumoniae DNA eradication rate was 97.4% in 2016. It was necessary to evaluate the treatment of Tibetan pig mycoplasmal pneumonia and/or the in vitro efficacy of tylosin tartrate treatment in M. hyopneumoniae. Tylosin tartrate resistance has not previously been reported in the treatment of Tibetan pigs with M. hyopneumoniae infection. The two tylosin tartrate–resistant Tibetan pigs were finally treated successfully with a 2.5 mg/kg·bw dose of danofloxacin mesylate over 10 consecutive days,³⁵ which was 4 weeks after tylosin tartrate treatment. We confirmed a lack of symptoms and signs in a follow-up observation and found no detectable levels of M. hyopneumoniae DNA. The in vitro antimicrobial efficacy of tylosin was reported in 2014,⁹ and the bactericidal activity of tylosin was lower compared with valnemulin.¹⁸ Moreover, the drug-resistance rate was as high as 50%.³⁶ In the present study, tylosin tartrate resistance, which led to failed treatment of Tibetan pig mycoplasma pneumonia, could be quickly identified during the course of treatment. According to veterinary clinical records and other relevant data, after the widespread use of tylosin tartrate in China over the past 10 years, the M. hyopneumoniae DNA eradication rate has significantly declined. Tylosin tartrate-resistance is associated with gene mutation in M. hyopneumoniae.³⁶ Moreover, treatment failure is associated with a high M. hyopneumoniae load.³⁷ In our study, all Tibetan pigs in which treatment failed had a high M. hyopneumoniae pretreatment load (>6 GEQ/ml [log10]), and the MR-determining domain V of the 23S rRNA gene was mutated in M. hyopneumoniae cells. No mutations were found in the 23S rRNA gene in M. hyopneumoniae before treatment; thus, resistance selection rather than induced resistance was likely. M. hyopneumoniae was present before treatment in the Tibetan pigs we evaluated; therefore, M. hyopneumoniae–resistant cells may have been selected during the treatment with tylosin tartrate. This explanation is the most plausible, particularly considering that tylosin tartrate is not known to induce mutations in the 23S rRNA gene directly during the long-term growth of M. hyopneumoniae. Although the symptoms of the two Tibetan pigs gradually subsided, Tibetan pig mycoplasma pneumonia recurred in four cases, which included the aforementioned two Tibetan pigs, indicating that treatment failed in these four pigs. Therefore, the M. hyopneumoniae pretreatment load, as well as screening for MR due to mutations in the 23S rRNA gene, may be an effective predictor of MR (and possibly resistance to other antimicrobial agents). Nonetheless, additional data are needed to support the use of tylosin tartrate as a first-line treatment of Mycoplasma pneumonia in Tibetan pigs in China.

Our study confirmed that the G2059A mutation is closely related to M. hyopneumoniae resistance to tylosin tartrate (a 16-membered macrolide). A previous study reported that a A2059G point mutation in Mycoplasma pneumoniae and Mycoplasma gallisepticum resulted in a high level of resistance to 16-membered macrolides.^38–41 In the present study, we showed that M. hyopneumoniae resistance to tylosin tartrate was associated with a G2059A point mutation. We also reported an MR-associated A2064G mutation that has not previously been reported for M. hyopneumoniae. Previous reports have shown that mutations at the A2062 site in the 23S rRNA gene result in resistance to 16-membered macrolides, but not the 15-membered macrolide class, which has different binding sites.³⁴ The M. hyopneumoniae tmhB strain isolated from a Tibetan pig with the A2064G mutation also showed a significant increase in the MIC for pristinamycin. This finding is disconcerting, as pristinamycin is a macrocyclic lactone class that is highly active against M. hyopneumoniae infection and is currently the final treatment option for tylosin tartrate–resistant M. hyopneumoniae.

Our study was carried out from September to December 2016, a period during which selective resistance to macrolides is widespread, particularly in countries with high tylosin tartrate resistance. Our results revealed the importance of evaluating the efficacy of tylosin tartrate treatment, evaluating the pretreatment M. hyopneumoniae load, and both pre- and posttreatment screening for M. hyopneumoniae resistance to macrolides and other antimicrobial agents. This screening should be performed for both previously described and novel mutations, for example, screening for danofloxacin mesylate-resistance mutations. Culture of M. hyopneumoniae should also be performed to determine the MIC for macrolides, including erythromycin thiocyanate and tylosin tartrate. Moreover, culturing with danofloxacin mesylate and pristinamycin would confirm the phenotypic effects of the mutations on the antimicrobial resistance. More in vivo and in vitro research is critical for further support of the tylosin tartrate as a major treatment drug for the prevention and control of M. hyopneumoniae infection. Present and future research will support the development and implementation of international guidelines for the management of M. hyopneumoniae infection. Our results show that, for diagnosis of M. hyopneumoniae infection, quantitative PCR can identify M. hyopneumoniae and MR mutations (including mutations for danofloxacin sulfonate-resistance). With the identification of novel mutations, new effective treatments for M. hyopneumoniae infection will need to be developed. Combination therapy has been introduced for the treatment of M. gallisepticum infection and may be considered for M. hyopneumoniae infection treatment in future.

Conclusions

Consistent with previous reports, the present study found that M. hyopneumoniae was the main cause of porcine enzootic pneumonia in Tibet, China. Moreover, the efficacy of tylosin tartrate in the treatment of Tibetan pigs with M. pneumoniae has not been reported previously. We found a M. hyopneumoniae DNA eradication rate of 97.4%, indicating that tylosin tartrate is useful as the recommended first-line treatment. In two cases where tylosin tartrate treatment failed, the pretreatment M. hyopneumoniae load was high, and the M. hyopneumoniae cells had a mutation in the MR region of 23S rRNA.

Ethical Approval

This study was approved by the Animal Care and Use Committee of Hubei Province, China. All animal procedures were performed according to the guidelines of The China Council on Animal Care.

Footnotes

Acknowledgments

This work was supported by the National Key Research and Development Program of China (Project No. 2017YFD0502200) and The Joint Fund of Tibet Autonomous Region Department of Science and XiZang Agriculture and Animal Husbandry College (Grant No. 2016ZR-NQ-4).

Authors' Contributions

Conceptualization: G.Q., Y.R. Data curation: G.Q., Y.R. Formal analysis: G.Q. Funding acquisition: G.Q., J.L. Investigation: G.Q., Y.R., L.Z., J.Z., Q.W., Z.H. Methodology: G.Q., Y.R., S.H., K.L., S.L. Software development: G.Q. Writing, editing: G.Q., J.L.

Disclosure Statement

No competing financial interests exist.

References

Shi

2013. The epidemiological investigation of six pig contagious diseases in Tibetan pigs in Nyingchi (Master Thesis). Northwest Agriculture & Forestry University, Yangling, Shaanxi, China. (In Chinese.)

Yang

, Yang

, Liu

, Si

, Wei

, Liu

, Yuan

, and Wu

. 2016. Mycoplasma hyopneumoniae disease prevalence in Guizhou, China. Shanghai Animal Husbandry and Veterinary Communications., 04:32–33. (In Chinese.)

Yang

, Li

, and Li

. 2011. Epidemiological investigation of the mycoplasma hyopneumoniae in North Xinjiang. Chin. J. Anim. Quarantine., 11:44–46. (In Chinese.)

Goedbloed

D.J.

, van Hooft

, Lutz

, Megens

H.J.

, van Wieren

S.E.

, Ydenberg

R.C.

, and Prins

H.H.

. 2015. Increased Mycoplasma hyopneumoniae disease prevalence in domestic hybrids among free-living wild boar. Ecohealth., 12:571–579.

2013. Swine Mycoplasma hyopneumoniae Epidemiological (MHP) Survey in Some Areas of Shanxi Province and Immunity Contrast Test of MHP. Master's thesis, Shanxi Agricultural University, pp. 1–34.

Vangroenweghe

, Karriker

, Main

, Christianson

, Marsteller

, Hammen

, Bates

, Thomas

, Ellingson

, Harmon

, Abate

, and Crawford

. 2015. Assessment of litter prevalence of Mycoplasma hyopneumoniae in preweaned piglets utilizing an antemortem tracheobronchial mucus collection technique and a real-time polymerase chain reaction assay. J. Vet. Diagn. Invest., 27:606–610.

Straw

B.E.

, Tuovinen

V.K.

, and Bigras-Poulin

. 1989. Estimation of the cost of pneumonia in swine herds. J. Am. Vet. Med. Assoc., 195:1702–1706.

Malhotra-Kumar

, Lammens

, Coenen

, Van Herck

, and Goossens

. 2007. Effect of azithromycin and clarithromycin therapy on pharyngeal carriage of macrolide-resistant streptococci in healthy volunteers: a randomised, double-blind, placebo- controlled study. Lancet., 369:482–490.

Bissessor

, Tabrizi

S.N.

, Twin

, Abdo

, Fairley

C.K.

, Chen

M.Y.

, Vodstrcil

L.A.

, Jensen

J.S.

, Hocking

J.S.

, Garland

S.M.

, and Bradshaw

C.S.

. 2015. Macrolide resistance and azithromycin failure in a Mycoplasma genitalium-infected cohort and response of azithromycin failures to alternative antibiotic regimens. Clin. Infect. Dis., 60:1228–1236.

10.

Binder

, Le

N.B.

, Berner

, and Bauer

. 1993. The effectiveness of tilmicosin in respiratory diseases of swine. Berl. Munch. Tierarztl. Wochenschr., 106:6–9.

11.

Hannan

P.C.

, Bhogal

B.S.

, and Fish

J.P.

. 1982. Tylosin tartrate and tiamutilin effects on experimental piglet pneumonia induced with pneumonic pig lung homogenate containing mycoplasmas, bacteria and viruses. Res. Vet. Sci., 33:76–88.

12.

Hannan

P.C.

, Windsor

H.M.

, and Ripley

P.H.

. 1997. In vitro susceptibilities of recent field isolates of Mycoplasma hyopneumoniae and Mycoplasma hyosynoviae to valnemulin (Econor), tiamulin and enrofloxacin and the in vitro development of resistance to certain antimicrobial agents in Mycoplasma hyopneumoniae. Res. Vet. Sci., 63:157–160.

13.

Huhn

R.G.

1971. The action of certain antibiotics and ether on swine enzootic pneumonia. Can. J. Comp. Med., 35:1–4.

14.

Vicca

, Maes

, Jonker

, de Kruif

, and Haesebrouck

. 2005. Efficacy of in-feed medication with tylosin for the treatment and control of Mycoplasma hyopneumoniae infections. Vet. Rec., 156:606–610.

15.

Marco

, Quiroga

, Bollo

J.M.

, Menjón

, Calvo

, Donadeu

, Cia

, and Duran

. 2008. Eradication of Mycoplasma hyopneumoniae in a head using Aivlosin. Proc. Int. Symp. 197. www.valosin.com/_images/news/Aiv.Pig.MhyoSpain%20Print.pdf

16.

Del Pozo Sacristán

, Rodríguez

A.L.

, Sierens

, Vranckx

, Boyen

, Dereu

, Haesebrouck

, and Maes

D.G.

. 2012. Efficacy of in-feed medication with chlortetracycline in a farrow-to-finish herd against a clinical outbreak of respiratory disease in fattening pigs. Vet. Rec., 171:645.

17.

Nilsson

A.C.

, Per

, Christina

W.O.

, Anders

, and Kenneth

. 2010. Clinical severity of Mycoplasma pneumoniae (mp) infection is associated with bacterial load in oropharyngeal secretions but not with mp genotype. BMC Infect. Dis., 10:1–8.

18.

Jiang

, Yan

, Ji

, Wang

, and Chen

. 2014. Clinical significance of different bacterial load of Mycoplasma pneumoniae in patients with Mycoplasma pneumoniae pneumonia. Braz. J. Infect. Dis., 18:124–128.

19.

Kacerovsky

, Pliskova

, Bolehovska

, Musilova

, Hornychova

, Tambor

, . 2011. The microbial load with genital mycoplasmas correlates with the degree of histologic chorioamnionitis in preterm PROM. Am. J. Obstet.Gynecol. 205:213.e1–e7.

20.

Nowakiewicz

, Ziółkowska

, Trościańczyk

, Zięba

, and Gnat

. 2017. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting). J. Med. Microbiol., 66:175–183.

21.

Tavío

M.M.

, Poveda

, Assunção

, Ramírez

A.S.

, and Poveda

J.B.

. 2014. In vitro activity of tylvalosin against Spanish field strains of Mycoplasma hyopneumoniae. Vet. Rec., 175:539.

22.

Pallarés

F.J.

, Lasa

, Roozen

, and Ramis

. 2015. Use of tylvalosin in the control of porcine enzootic pneumonia. Vet. Rec. Open., 2:e000079.

23.

Marois

, Dory

, Fablet

, Madec

, and Kobisch

. 2010. Development of a quantitative real-time TaqMan PCR assay for determination of the minimal dose of Mycoplasma hyopneumoniae strain 116 required to induce pneumonia in SPF pigs. J. Appl. Microbiol., 108:1523–1533.

24.

Jiacuo

2015. Analysis on the present situation, problems and countermeasures of breeding and industrial development of Tibetan pigs. Chin. Pig Ind., 2:176–178. (In Chinese.)

25.

Yangzom

, Hao

, Yangzon

, Jinfeng

, Peng

, and Wangjiu

. 2011. Determination of blood physiological parameters in Tibet pig at high altitude. South China J. Agric. Sci., 24:2382–2384.

26.

Strait

E.L.

, Madsen

M.L.

, Minion

F.C.

, Christopher-Hennings

, Dammen

, Jones

K.R.

, and Thacker

E.L.

. 2008. Real-time PCR assays to address genetic diversity among strains of Mycoplasma hyopneumoniae. J. Clin. Microbiol., 46:2491–2498.

27.

Zhong

and Simons

J.W.

, 1999. Direct comparison of GAPDH, β-actin, cyclophilin, and 28rRS as internal standards for quantifying RNA levels under hypoxia NA. Biochem. Biophys. Res. Comm. 259:523–526.

28.

Quino

M.J.

, Fierro

, De la Mora-De la Mora

, Enríquez Flores

, Gómez Manzo

, Vanoye Carlo

, Garcia Torres

, Sierra Palacios

, and Reyes Vivas

. 2016. Validation of housekeeping genes as an internal control for gene expression studies in Giardia lamblia using quantitative real-time PCR. Gene., 581:21–30.

29.

Shipitsyna

, Zolotoverkhaya

, Dohn

, Benkovich

, Savicheva

, Sokolovsky

, Jensen

J.S.

, Domeika

, and Unemo

. 2009. First evaluation of polymerase chain reaction assays used for diagnosis of Mycoplasma genitalium in Russia. J. Euro. Acad. Dermatol. Venereol., 23:1164–1172.

30.

Gerchman

, Levisohn

, Mikula

, and Lysnyansky

. 2009. In vitro antimicrobial susceptibility of Mycoplasma bovis isolated in Israel from local and imported cattle. Vet. Microbiol., 137:268–275.

31.

Bossé

J.T.

, Li

, Sárközi

, Gottschalk

, Angen

Ø.

, Nedbalcova

, et al. 2017. A unique capsule locus in the newly designated Actinobacillus pleuropneumoniae serovar 16 and development of a diagnostic PCR assay. J. Clin. Microbiol., 55:902–907.

32.

Wisselink

H.J.

, Joosten

J.J.

, and Smith

H.E.

. 2002. Multiplex PCR assays for simultaneous detection of six major serotypes and two virulence-associated phenotypes of Streptococcus suis in tonsillar specimens from pigs. J. Clin. Microbiol., 40:2922–2929.

33.

Wisselink

H.J.

, Cornelissen

JBWJ

, van der Wal

F.J.

, Kooi

E.A.

, Koene

M.G.

, Bossers

, et al. 2017. Evaluation of a multiplex real-time PCR for detection of four bacterial agents commonly associated with bovine respiratory disease in bronchoalveolar lavage fluid. BMC Vet. Res., 13:221.

34.

Jordan

F.T.

, and Horrocks

B.K.

. 1996. The minimum inhibitory concentration of tilmicosin and tylosin for Mycoplasma gallisepticum and Mycoplasma synoviae and a comparison of their efficacy in the control of mycoplasma gallisepticum infection in broiler chicks. Avian Dis., 40:326–334.

35.

Hannan

, Windsor

, De Jong

, Schmeer

, and Stegemann

. 1997. Comparative susceptibilities of various animal-pathogenic mycoplasmas to fluoroquinolones. Antimicrob. Agents Chemother., 41:2037–2040.

36.

Gerchman

, Levisohn

, Mikula

, Manso-Silván

, and Lysnyansky

. 2011. Characterization of in vivo-acquired resistance to macrolides of Mycoplasma gallisepticum strains isolated from poultry. Vet. Res., 42:90.

37.

Garza Ramos

, Xiong

, Zhong

, and Mankin

. 2001. Binding site of macrolide antibiotics on the ribosome: new resistance mutation identifies a specific interaction of ketolides with rRNA. J. Bacteriol., 183:6898–6907.

38.

Lucier

T.S.

, Heitzman

, Liu

S.K.

, and Hu

P.C.

. 1995. Transition mutations in the 23S rRNA of erythromycin-resistant isolates of Mycoplasma pneumoniae. Antimicrob. Agents Chemother., 39:2770–2773.

39.

Guschin

, Ryzhikh

, Rumyantseva

, Gomberg

, and Unemo

. 2015. Treatment efficacy, treatment failures and selection of macrolide resistance in patients with high load of Mycoplasma genitalium during treatment of male urethritis with josamycin. BMC Infect. Dis., 15:40.

40.

Zhang

, Ye

, Wu

, Huang

, Gu

, Cai

, Shen

, Jiang

, and Ding

. 2017. Determination of the mutant selection window and evaluation of the killing of Mycoplasma gallisepticum by danofloxacin, doxycycline, tilmicosin, tylvalosin and valnemulin. PLoS ONE. 12:e0169134. doi:10.1371/journal.pone.0169134

41.

B.B.

, Shen

J.Z.

, Cao

X.Y.

, Wang

, Dai

, Huang

S.Y.

, and Wu

C.M.

. 2010. Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum. FEMS Microbiol. Lett., 308:144–149.