Molecular Characterization of Methicillin and Vancomycin Resistant Staphylococcus aureus Strains Isolated from Hospitalized Patients

Abstract

Objectives:

Nosocomial infections caused by methicillin resistant Staphylococcus aureus (MRSA) and emergence of vancomycin resistant S. aureus (VRSA) have led to great concern in healthcare settings worldwide.

Methods:

A total of 100 S. aureus clinical isolates from hospitalized patients were investigated for antimicrobial susceptibility, the presence of resistance (mecA, vanA, and vanB) and virulence (hlaA, fnbpA, cna, clfA, tsst-1, eta, and spa) encoding genes, and molecular typing based on polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) of spa gene.

Results:

All isolates were resistant to one or more antibiotics, with the most frequent resistance found against amoxicillin (69%). A total of 46 isolates were MRSA, and 40% of isolates were multidrug resistant (MDR). Of all S. aureus isolates, two isolates were confirmed as VRSA and four isolates confirmed as vancomycin intermediate S. aureus (VISA). The frequency of clfA, cna, tsst-1, and eta genes among MRSA isolates was significantly higher than methicillin sensitive S. aureus (MSSA). The significant correlation between MDR isolates and the carriage of multiple virulence genes was seen. All MDR isolates carried at least four virulence genes. Furthermore, biofilm formation in MRSA isolates was significantly higher than MSSA. The spa gene PCR products generated 4 major and 10 minor types. After digestion of spa amplicons with HindIII restriction enzyme, 10 different patterns ranging 174–938 bp were detected. S2b and S2a subtypes were detected frequently in MRSA isolates.

Conclusions:

It seems that the appropriate surveillance and control measures are essential to prevent the emergence and transmission of MRSA and VRSA strains in our country.

Introduction

Staphylococcus aureus is an opportunistic nosocomial pathogen that causes wide variety of infections, including endocarditis, food poisoning, toxic shock syndrome, septicemia, pneumonia, osteomyelitis, skin and soft tissue infections, and others.^1,2 Methicillin resistant S. aureus (MRSA) outbreaks have become a serious problem in healthcare settings worldwide. The therapeutic options in MRSA infections are limited to glycopeptides, linezolid, tigecycline, and ceftaroline.^1,3,4 Furthermore, the multidrug resistant (MDR) hospital-acquired MRSA strains and their intrinsic resistance to beta-lactams confer limited treatment options to the most available and less costly antibiotics.⁵

During the last decade, S. aureus isolates with decreased susceptibility to vancomycin (vancomycin intermediate S. aureus [VISA]) and vancomycin resistant S. aureus (VRSA) have been reported in various parts of the world. These isolates are associated with increased mortality because of the limited therapeutic options remaining.⁶ Horizontal transfer of antibiotic resistance genes and production of multiple virulence factors are thought to play a major role in the emergence and persistence of resistant S. aureus strains in the hospital environment.³

S. aureus possesses several virulence factors that contribute to colonization and invasion of host tissue, evasion of the hosts' immune systems, and nutrient acquisition.² These factors include microbial surface components that recognize adhesive matrix molecules, cytolytic toxins, exoenzymes, exotoxins, hemolysins, leucocidins, and superantigens.^2,7 S. aureus also has an inherent ability to form biofilms on biotic and abiotic surfaces. Biofilm formation plays an important role in the persistence of chronic infections.^7,8 Recent studies showed the association between the presence of virulence factors in clinical isolates of S. aureus with emergence and persistence of infections in nosocomial settings.^8–10

As S. aureus is a heterogeneous species, various molecular typing techniques have been developed for local outbreak investigation. These techniques include pulsed-field gel electrophoresis (PFGE), multilocus sequence typing, SCCmec typing, and typing of the variable tandem repeat region of protein A (spa typing). PFGE is considered as the “gold standard” method for typing, but it is relatively difficult to standardize and is more time consuming than polymerase chain reaction (PCR)-based methods.¹¹ The spa typing has been shown to be an effective and rapid method for MRSA typing.¹² This method is based on the number of tandem repeats and the sequence variation in the X region of spa gene. The X region includes a variable number of 24-bp repeats, with more than 25 allelic forms. Moreover, the number of repeats in the X region has been related to the dissemination potential of MRSA, with higher numbers of repeats associated with higher epidemic capability.^12–14

The present study aimed to investigate the antimicrobial susceptibility profile, the frequency of important virulence encoding genes (including cna, clfA, fnbp A, eta, hlaA, spa, and tsst-1), and molecular typing based on PCR-restriction fragment length polymorphism (RFLP) of spa gene in S. aureus isolates.

Materials and Methods

Bacterial isolates

Between February 2015 and January 2016, a total of 100 S. aureus clinical isolates were randomly recovered from different specimens, including blood, sputum, wound swabs, chest tube secretions, and urine, and were submitted to the Clinical Microbiology Department from three major hospitals in Zanjan, Iran. All specimens were collected from hospitalized patients. The identification of isolates was performed by routine biochemical tests, including Gram staining, production of catalase, coagulase, DNase, and growth on mannitol salt agar (Merck). Verified isolates of S. aureus were preserved at −70°C in Trypticase soy broth (Merck) containing 20% (v/v) glycerol for further analysis.

Antimicrobial susceptibility testing

Susceptibility of isolates to the following antibiotics was determined by disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines¹⁵: amoxicillin (25 μg), erythromycin (15 μg), cefoxitin (30 μg), linezolid (30 μg), gentamicin (10 μg), quinupristin–dalfopristin (15 μg), trimethoprim–sulfamethoxazole (1.25/23.75 μg), ciprofloxacin (5 μg), and tetracycline (30 μg; MAST, Merseyside, United Kingdom). The MRSA isolates were screened using a cefoxitin disc (30 μg) on Mueller Hinton agar (Merck). The plates supplemented with 4% NaCl were confirmed by the amplification of mecA gene by PCR method (primers are shown in Table 1).

Table 1.

The Sequences of Primers Used in This Study

Target genes	Function	Primer sequence (5′-3′)	Size (bp)	References
cna	Collagen binding protein	AAAGCGTTGCCTAGTGGAGA	192	²
cna	Collagen binding protein	AGTGCCTTCCCAAACCTTTT	192	²
clfA	Clumping factor A	CGCCGGTAACTGGTGAAGCT	314	²
clfA	Clumping factor A	TGCTCTCATTCTAGGCGCACTT	314	²
fnbpA	Fibronectin binding protein A	GCG GAG ATC AAA GAC AA	1,279	²
fnbpA	Fibronectin binding protein A	CCA TCT ATA GCT GTG TGG	1,279	²
eta	Exfoliative toxin A	GCAGGT GTT GAT TTA GCA TT	93	²
eta	Exfoliative toxin A	GCAGGTGTT GAT TTA GCA TT	93	²
hlaA	Alpha toxin	GTACTACAG ATA TTG GAA GC	274	²
hlaA	Alpha toxin	GTAATCAGATATTTGAGC TAC	274	²
spa	Protein A	ATCTGGTGGCGTAACACCTG	Variable	¹⁷
spa	Protein A	CGCTGCACCTAACGCTAATG	Variable	¹⁷
tsst-1	Toxic shock syndrome toxin-1	ACC CCT GTT CCC TTA TCA TC	326	²
tsst-1	Toxic shock syndrome toxin-1	TTTTCAGTA TTT GTA ACG CC	326	²
mecA	Penicillin binding protein 2a	GTGAAGATATACCAAGTGATT	147	⁴⁴
mecA	Penicillin binding protein 2a	ATGCGCTATAGATTGAAAGGAT	147	⁴⁴
vanA	Vancomycin resistance	GGCAAGTCAGGTGAAGATG	713	¹
vanA	Vancomycin resistance	ATCAAGCGGTCAATCAGTTC	713	¹
vanB	Vancomycin resistance	GTGACAAACCGGAGGCGAGGA	430	⁴⁵
vanB	Vancomycin resistance	CCGCCATCCTCCTGCAAAAAA	430	⁴⁵

Minimum inhibitory concentration (MIC) of vancomycin was determined by the Agar dilution method, according to the CLSI guidelines.¹⁵ Appropriate dilutions of vancomycin were added to Mueller Hinton agar (Merck). Then, 5 μL of each bacterial suspension containing 10⁴ cfu was spotted onto the agar surface, and the plates were incubated at 35°C for 24 h. The MIC was recorded as the lowest concentration that completely inhibited growth except for a single colony or a faint haze caused by the inoculum. MIC breakpoints for vancomycin were defined as follows: susceptible, ≤2 μg/mL; intermediate, 4–8 μg/mL; and resistant, ≥16 μg/mL. The reference strains of S. aureus ATCC 25923 and Enterococcus faecalis ATCC 51299 were used as vancomycin susceptible and resistant quality control. MDR was defined as resistance to at least one agent in three or more antimicrobial categories.¹⁶ Furthermore, PCR was performed to determine the presence of vanA and vanB resistance encoding genes (primers are shown in Table 1).

DNA extraction

DNA extraction of S. aureus isolates was performed according to the protocol provided with the QIAGEN DNA Mini Kit (QIAGEN, Inc., Valencia, CA). One isolate from each patient was grown in LB broth (Merck) until the exponential phase with 2 McFarland turbidity and then DNA extraction was performed. The concentration and purity of DNA samples were determined using a NanoDrop Spectrophotometer (ND-1000; Nano-Drop Technologies, Wilmington, DE) at 260 and 260/280 nm, respectively.

Detection of virulence related genes

The presence of the virulence genes cna, clfA, fnbpA, eta, hlaA, spa, and tsst-1was assessed using PCR method. The sequences of primers are shown in Table 1. Simplex PCR was performed using DreamTaq PCR Master Mix (Thermo Fisher Scientific), which contains Taq polymerase, dNTPs, MgCl₂, and the appropriate buffer. Each PCR tube contained 25 μL reaction mixture composed of 12.5 μL of the master mix, 1 μL of each forward and reverse primer solution (in a final concentration of 200 nM), 1 μL of DNA with concentration of 200 ng/μL, and nuclease-free water to complete the final volume. PCR was performed using the GeneAtlas 322 system (ASTEC). Amplification involved an initial denaturation at 94°C, 5 min followed by 30 cycles of denaturation (94°C, 1 min), annealing (48°C, 1 min for hlaA and fnbpA; 52°C, 45 sec for tsst-1 and cna; and 57°C, 45 sec for clfA and eta), and extension (72°C, 1 min), with a final extension step (72°C, 10 min). The amplified DNA was separated by submarine gel electrophoresis, stained with ethidium bromide, and visualized under ultraviolet transillumination.

PCR-RFLP for spa typing

The X region of spa gene was amplified using suitable primers spa1 (5′-ATCTGGTGGCGTAACACCTG-3′) and spa2 (5′-CGCTGCACCTAACGCTAATG-3′).¹⁷ PCR was performed using DreamTaq PCR Master Mix (Thermo Fisher Scientific) with the following PCR conditions: initial denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 56°C for 1 min, and extension at 72°C for 1 min with a final extension at 72°C for 10 min. The HindIII enzyme (Fermentas Co.) was used to digest the purified PCR products of spa gene according to the instructions of Fermentas Co. Ten microliters (0.1–0.5 μg of DNA) of PCR product was mixed and digested with 2 μL of HindIII at 37°C for 4 h, and fragments were detected by electrophoresis in 1.5% agarose gel and subsequent ethidium bromide staining.

Biofilm assay

Biofilm formation was determined using a microtiter plate assay as described previously.¹⁸ S. aureus isolates were grown overnight at 37°C in brain heart infusion (BHI) broth plus 0.25% glucose. Free cells were removed, and biofilms were washed thrice with sterile PBS and fixed with 150 μL of 99% (v/v) methanol. The wells were stained with 1% (w/v) crystal violet for 15 min at room temperature. Crystal violet was dissolved using ethanol/acetone (80:20, v/v) for 20 min, and the absorbance was measured at 595 nm. Biofilm formation was scored as follows: negative, nonbiofilm forming (A595 < 1); +, weak (1 < A595 ≤ 2); ++, moderate (2 < A595 ≤ 3); and +++, strong (A595 > 3). All assays were performed in triplicate.

Statistical analysis

The data were analyzed with SPSS version 22.0 software (SPSS, Inc., Chicago, IL). Contingency table analysis was used to determine the statistical significance of the data. A p value of <0.05 was considered significant.

Results

Characteristics of isolates

A total of 100 S. aureus isolates were collected from clinical specimens. Out of 100 isolates, 23% were recovered from blood, 26% from wound swab, 26% from sputum, 15% from urine, and 10% from secretions collected from chest tube (thoracic catheter).

Antimicrobial susceptibility

Antimicrobial resistance patterns of isolates are presented in Table 2. Overall, all isolates were resistant to one or more antimicrobial agents, with the most frequent resistance found against amoxicillin (69%), followed by cefoxitin (46%) and tetracycline (45%). Forty-six isolates were resistant to cefoxitin and considered as MRSA, and eight isolates were linezolid resistant. All linezolid resistant isolates in disk diffusion confirmed by MIC method (Broth microdilution) and MIC values of isolates were 8–32 μg/mL. All MRSA isolates were confirmed by detection of mecA gene.

Table 2.

Antimicrobial Susceptibility Patterns of 100 Staphylococcus aureus Isolates

Antimicrobial agents	Resistant (%)	Susceptible (%)
Tetracycline	45	55
Linezolid	8	92
Ciprofloxacin	28	72
Cefoxitin	46	54
Gentamicin	29	71
Quinupristin–dalfopristin	14	86
Erythromycin	41	59
Co-trimoxazole	16	84
Amoxicillin	69	31

A total of 40 isolates were resistant to at least three different classes of antimicrobial agents and considered as MDR. Table 3 summarized MDR patterns of S. aureus isolates. The most prevalent MDR pattern was resistance to six different classes of antibiotics, including “amoxicillin-erythromycin-cefoxitin-gentamicin-ciprofloxacin-tetracycline.”

Table 3.

Multidrug Resistance Patterns of Staphylococcus aureus Isolates

No. of antimicrobial agents	MDR pattern	Percent (%) of all isolates
3	Amoxicillin-Co-trimoxazole-tetracycline	1
3	Amoxicillin-cefoxitin-ciprofloxacin	1
4	Erythromycin-cefoxitin-linezolid-quinupristin	2
	Amoxicillin-erythromycin-linezolid-Co-trimoxazole	1
	Amoxicillin-cefoxitin-gentamicin-ciprofloxacin	1
	Amoxicillin-cefoxitin-Co-trimoxazole-tetracycline	2
5	Amoxicillin-cefoxitin-gentamicin-Co-trimoxazole-tetracycline	1
	Amoxicillin-erythromycin-cefoxitin-gentamicin-ciprofloxacin	1
	Erythromycin-cefoxitin-gentamicin-quinupristin-tetracycline	5
	Amoxicillin-cefoxitin-gentamicin-ciprofloxacin-tetracycline	1
6	Amoxicillin-erythromycin-cefoxitin-gentamicin-quinupristin-ciprofloxacin-tetracycline	1
	Amoxicillin-erythromycin-cefoxitin-gentamicin-ciprofloxacin-tetracycline	10
	Erythromycin-cefoxitin-linezolid-gentamicin-quinupristin-tetracycline	1
	Amoxicillin-erythromycin-cefoxitin-Co-trimoxazole-ciprofloxacin-tetracycline	1
	Erythromycin-cefoxitin-gentamicin-quinupristin-Co-trimoxazole-tetracycline	1
7	Amoxicillin-erythromycin-cefoxitin-gentamicin-Co-trimoxazole-ciprofloxacin-tetracycline	4
8	Amoxicillin-erythromycin-cefoxitin-gentamicin-quinupristin-Co-trimoxazole-tetracycline	3
8	Amoxicillin-erythromycin-cefoxitin-linezolid-quinupristin-Co-trimoxazole-ciprofloxacin-tetracycline	3

MDR, multidrug resistant.

The MIC of vancomycin was determined by Agar dilution method. Two isolates were resistant to vancomycin (VRSA), with MIC value of 32 μg/mL, and 4% of isolates showed MIC values of 4–8 μg/mL and considered as VISA. The vanA gene was found in two VRSA isolates. However, the vanB gene was not detected in any VRSA or VISA isolates. Moreover, two VRSA isolates were also methicillin resistant and carried mecA gene, whereas among four VISA isolates, two were methicillin resistant. All VRSA and VISA isolates were MDR (Table 4).

Table 4.

Molecular Characterization of Vancomycin Resistant Staphylococcus aureus and Vancomycin Intermediate Staphylococcus aureus Isolates

Spa types	Sample	Drug resistance profile	Virulence and resistance gene profile	Vancomycin MIC
S2b	Blood	Amoxicillin, erythromycin, cefoxitin, gentamicin, ciprofloxacin, tetracycline	hlaA, fnbpA, tsst-1, cna, clfA, eta, vanA, mecA	32
S2b	Sputum	Amoxicillin, erythromycin, cefoxitin, linezolid, quinupristin, co-trimoxazole, ciprofloxacin, tetracycline	hlaA, fnbpA, tsst-1, cna, clfA, eta, van A, mecA	32
S2d	Wound	Amoxicillin, erythromycin, cefoxitin, co-trimoxazole, ciprofloxacin, tetracycline	hlaA, fnbpA, tsst-1, cna, clfA, eta, mecA	8
S1b	Wound	Erythromycin, gentamicin, cefoxitin, quinupristin, tetracycline	hlaA, fnbpA, clfA, cna, eta, mecA	8
S2b	Chest tube	Amoxicillin, erythromycin, cefoxitin, gentamicin, ciprofloxacin, tetracycline	hlaA, fnbpA, clfA, eta, cna	4
S2a	Blood	Erythromycin, cefoxitin, gentamicin, quinupristin, tetracycline	hlaA, tsst-1, cna, clfA, eta	8

MIC, minimum inhibitory concentration.

Distribution of virulence related genes

All 46 MRSA isolates harbored mecA gene with a 147-bp size of the PCR amplicon. The frequency of virulence related genes is shown in Table 5. All S. aureus isolates carried at least one virulence gene. The most frequent virulence gene was eta (76%), followed by hlaA (71%), cna (58%), clfA (43%), fnbpA (35%), and tsst-1 (32%).

Table 5.

Distribution of Virulence Related Genes Among Staphylococcus aureus Isolates

No. of virulence genes	Virulence gene profile	No. (%) of S. aureus
One gene	cna	3 (3)
	hlaA	4 (4)
	clfA	3 (3)
	eta	5 (5)
Two genes	hlaA+eta	4 (4)
	clfA+eta	6 (6)
	cna+eta	2 (2)
	hlaA+fnbpA	3 (3)
	clfA+fnbpA	2 (2)
Three genes	hlaA+cna+clfA	2 (2)
	hlaA+fnbpA+clfA	2 (2)
	hlaA+cna+fnbpA	3 (3)
	hlaA+fnbpA+eta	3 (3)
	hlaA+clfA+eta	2 (2)
	hlaA+cna+eta	3 (3)
	hlaA+cna+tsst-1	5 (5)
	hlaA+clfA+eta	6 (6)
Four genes	hlaA+fnbpA+clfA+eta	8 (8)
	tsst-1+cna+clfA+eta	5 (5)
	hlaA+tsst-1+clfA+cna	4 (4)
	hlaA+fnbpA+cna+clfA	4 (4)
	hlaA+eta+cna+clfA	3 (3)
	tsst-1+cna+clfA+eta	3 (3)
Five genes	hlaA+fnbpA+cna+clfA+eta	2 (2)
	hlaA+tsst-1+cna+clfA+eta	3 (3)
	hlaA+tsst-1+cna+clfA+fnbpA	3 (3)
	hlaA+fnbpA+tsst-1+cna+eta	3 (3)
Six genes	hlaA+fnbpA+tsst-1+cna+clfA+eta	4 (4)

Several different combinations of virulence genes were found in S. aureus isolates. Table 5 shows that many S. aureus isolates had two or more virulence genes, and only 15% of isolates carried one virulence gene. The most frequent combination was “hlaA-fnbpA-clfA-eta” (8%), followed by “hlaA-clfA-eta” (6%).

There is significant correlation between MDR isolates and the carriage of multiple virulence genes. All 40 MDR isolates carried at least 4 virulence genes. Distribution of virulence genes among methicillin and VRSA isolates is shown in Table 6. The frequency of clfA, cna, tsst-1, and eta genes among MRSA isolates was significantly higher than methicillin sensitive S. aureus (MSSA; p < 0.05) (Table 6).

Table 6.

Distribution of Virulence Genes Among Methicillin and Vancomycin Resistant Staphylococcus aureus Isolates

Virulence genes	MRSA (n = 46), n (%)	MSSA (n = 54), n (%)	p	VRSA/VISA (n = 6), n (%)	VSSA (n = 94), n (%)	p
hlaA	42 (91.3)	29 (53.7)	0.106	6 (100)	65 (69.1)	0.177
clfA	32 (69.5)	11 (20.4)	0.000	5 (83.3)	38 (40.4)	0.082
fnbpA	22 (47.8)	13 (24.1)	0.192	4 (66.6)	31 (32.9)	0.180
tsst-1	25 (54.3)	7 (12.9)	0.001	4 (66.6)	28 (29.7)	0.081
cna	24 (52.1)	34 (62.9)	0.003	6 (100)	52 (55.3)	0.038
eta	35 (76.1)	41 (75.9)	0.005	6 (100)	70 (74.4)	0.331

MRSA, methicillin resistant S. aureus; MSSA, methicillin sensitive S. aureus; VISA, vancomycin intermediate S. aureus; VRSA, vancomycin resistant S. aureus.

PCR-RFLP for spa typing

The size of spa genes in S. aureus isolates ranged from 360 to 1,436 bp. These patterns were classified as type S1 (one band), S2 (two bands), S3 (three bands), and S4 (no band), including 39%, 52%, 2%, and 7%, respectively (Table 7). After digestion of spa amplicons with HindIII restriction enzyme, 10 different patterns ranging from 174 to 938 bp were detected. The restriction patterns of spa genes are shown in Table 7. The S2b (21%) and S2a (14%) subtypes were most prevalent among S. aureus isolates. Furthermore, S2b and S2a subtypes were detected frequently in MRSA isolates (28.2% and 19.5%, respectively).

Table 7.

Patterns of spa Gene Among Staphylococcus aureus Isolates

Spa Types (4)	spa Gene subtypes (11)	Size of PCR product (bp)	Size of HindIII fragments (bp)	No. of MRSA isolates	No. of VRSA isolates	Total No. (%) of isolates
S1 (one band, 39%)	S1a	360	360	1	—	7
	S1b	1,396	914, 482	4	—	8
	S1c	1,370	714, 482, 174	3	—	10
	S1d	1,436	780, 482, 174	3	—	11
	S1e	1,420	938, 482	—	—	3
S2 (two bands, 52%)	S2a	360, 1,396	914, 482, 360	9	—	14
	S2b	360, 1,370	714, 482, 174, 360	13	2	21
	S2c	360, 1,436	360, 780, 174, 482	3	—	6
	S2d	360, 1,262	360, 780, 482	7	—	11
S3 (three bands, 2%)	S3	360, 1,396, 1,262	914, 482, 360, 780, 482	1	—	2
S4 (no band) (7%)	S4 no band	—	—	2	—	7

PCR, polymerase chain reaction.

Biofilm formation

Biofilm formation was detected among 64 isolates. Of biofilm forming isolates, 20 isolates produced weak biofilm (+), 27 isolates formed moderate biofilm (++), and 17 isolates formed strong biofilm (+++) (Table 8). There is significant correlation between MRSA isolates and biofilm formation. Biofilm formation among MRSA isolates (84.7%) was significantly higher than MSSA (46.3%) (p < 0.05). Furthermore, 67.4% of MRSA isolates produced strong or moderate biofilm, while 24.1% of MSSA formed strong or moderate biofilm (p < 0.05).

Table 8.

Biofilm Formation Among Staphylococcus aureus Isolates

Biofilm formation	MRSA (n = 46), n (%)	MSSA (n = 54), n (%)	Total (n = 100), n (%)
Strong	12 (20)	5 (9.2)	17 (17)
Moderate	19 (41.3)	8 (14.8)	27 (27)
Weak	8 (17.3)	12 (22.2)	20 (20)
None	7 (15.2)	29 (53.7)	36 (36)

Discussion

Nosocomial infections caused by MRSA have become a serious problem in healthcare settings worldwide.¹⁹ In our study, 100% of S. aureus isolates were resistant to one or more antimicrobial agents and 40% were MDR. It has been recently shown that MRSA infections are increasing. In the United States, more than 50% of S. aureus infections are caused by MRSA strains.²⁰ Our study also reports this tendency, with a high rate of MRSA (46%), posing another challenge to adequate treatment of S. aureus infections. According to previous studies in Iran, the frequency of MRSA isolates ranged from 41% to 72%.^21–23

The vancomycin is an important therapeutic choice for treatment of severe MRSA infections especially in nosocomial infections.²³ The first clinical isolate of S. aureus with vancomycin resistance was detected in a patient from Michigan, United States. Since that time, there have been a total of 14 isolates reported in the United States.²⁴ The emergence of VISA and VRSA isolates in healthcare settings was also reported from Japan, France, Korea, South Africa, India, Brazil, Scotland, and Iran.^25–29 In a study conducted by Moses et al. from Nigeria, the relatively high frequency of VRSA (5.3%) was reported.²⁵ Furthermore, vancomycin resistance was detected in 2.8% and 1.4% of S. aureus isolates in Brazil and India, respectively.^26,27

According to results, we found two MRSA strains with resistance to vancomycin. The glycopeptides or vancomycin exposure is the most important risk factor for emergence of VRSA.^28,29 In our study, two VRSA strains were isolated from patients who have previous use of vancomycin. Similar to our results, several cases of VRSA were reported in different provinces of Iran, including Tehran, Mashhad, Isfahan, Mazandaran, Gilan, and Lorestan.²⁹ Up to September 2012, a total of 24 VRSA isolates were reported from Iran.^28,29 It seems that Iran is a hotspot region for the emergence of VRSA isolates, which is of great concern in healthcare settings. In contrast to previous studies, we detected higher frequency of resistance to linezolid.^21–24 The high incidence of antibiotic resistance found in this survey is most probably due to the extensive misuse of antimicrobial agents in our country. Furthermore, the loss and gain of resistance genes by mobile genetic elements is an important mechanism in development of MDR isolates.^21,22

Previous studies showed the association between the presence of virulence factors in clinical isolates of S. aureus with promoting emergence of infections and persistence of these strains in nosocomial settings.³⁰ Our results showed different frequency of virulence related genes in S. aureus, which ranged from 32% to 76%. The most frequent virulence encoding genes were eta and hlaA. According to previous reports, the frequency of eta gene was higher than our study.^31,32 However, the studies conducted in Germany, Czech, and Colombia showed the lower frequency of eta (2%, 10%, and 3%, respectively).^33–35 Similar to our results, Shukla et al. showed the high frequency of hlaA gene (100%) among MRSA isolates.³⁶ In contrast to some previous studies that the tsst-1 gene was rarely detected (<1%), we found tsst-1 gene with higher frequency (32%).^37,38 There is significant correlation between the presence of multiple virulence genes and MDR in our study. Furthermore, the frequency of clfA, cna, tsst-1, and eta genes among MRSA isolates was significantly higher than MSSA (p < 0.05).

Biofilm formation is associated with antimicrobial resistance and considered as a virulence factor. This virulence factor plays an important role in the persistence of chronic infections.^39,40 According to our results, 64% of S. aureus isolates were shown biofilm formation phenotype. Furthermore, biofilm formation in MRSA isolates (84.7%) was significantly higher than MSSA (46.3%; p < 0.05). Similar results were showed in Ohadian Moghadam et al. study.⁴⁰

The molecular typing of S. aureus isolates is an important tool for epidemiological surveys and control and prevention of nosocomial infections. The spa typing is based on sequencing of the polymorphic X region of spa gene that present in all strains of S. aureus. The X region is constituted of a variable number of 24-bp repeats flanked by well-conserved regions.^12,13 According to Wichelhaus et al.¹⁴ and Omar et al.¹⁷ studies, the discriminatory power of PCR-RFLP of coa and spa genes was found to be sufficiently high and corresponded reasonably well with PFGE. We used PCR-RFLP technique for spa typing, and according to the results, the size of spa PCR products ranged from 360 to 1,436 bp, reflecting the number of 24-bp repeats. These PCR products generated 4 major and 10 minor different spa types. Thirty-nine strains (39%) showed single PCR band (type S1), 52% had two bands (type S2), and only 2% strains showed three PCR bands (type S3). The absence of PCR product is considered a separate type and detected in seven strains (S4). This was also shown in Adesida et al.⁴¹ study, where spa gene was absent in 5% of their S. aureus isolates. Omar et al. have reported that spa gene PCR products in 75 isolates of MRSA generated 4 major and 11 minor types ranging from 144 to 1,392 bp (144, 192, 240, 360, 408, 600, 1,104, 1,200, 1,296, and 1,392 bp), and their HaeII restriction digestion showed 5 distinct banding patterns (designated as A, B, C, D, and E) and 12 subtypes (A1, 2/B1, 2, 3, 4, 5/C1, 2, 3/D/E).¹⁷ In their study, S1c and S1d subtypes were most prevalent among S. aureus isolates. Restriction profile analysis of the spa gene in our isolates demonstrated 10 different patterns ranging from174 to 938 bp, which is more than those reported by Mitani et al. from Japan. They evaluated 35 isolates of MRSA and PCR-RFLP analysis of spa gene with restriction enzyme of HhaI, which showed eight restriction patterns (S1–S8).¹¹ Similar results were reported in spa restriction profile analysis of clinical and nonclinical S. aureus isolates.^11,17,42,43

In the previous study from Iran, 4 types of spa, including S1 (1,450 bp), S2 (1,250 bp), S3 (1,100 bp), and S4 (1,000 bp; 36.4%, 32.4%, 23.2%, and 8%, respectively), were detected in 151 randomly selected S. aureus isolates, and the HaeII digestion demonstrated 16 different RFLP patterns for spa gene.⁴² Furthermore, the number of repeats in X region of spa has been related to the dissemination potential of MRSA, with higher numbers of repeats associated with higher epidemic capability.¹⁷ This observation might explain our findings that MRSA strains with long spa bands were isolated in nosocomial infections. HindIII was the restriction enzyme used to digest spa PCR products in this study, showing 5 distinct spa banding RFLP patterns and 10 subtype patterns.

Our study revealed the high frequency of MRSA and the existence of VRSA and VISA strains in hospitalized patients. In addition, according to our results, linezolid resistance was detected in 8% of isolates, which is of great concern in healthcare settings. Significant correlation between MDR isolates and the carriage of multiple virulence genes was seen. PCR-RFLP of spa gene showed that both VRSA isolates belong to S2b subtype. It seems that the appropriate surveillance and control measures are essential to prevent the emergence and transmission of MRSA and VRSA in our country.

Footnotes

Acknowledgment

This work as an MSc thesis in Medical Microbiology was supported by the Zanjan University of Medical Sciences (A-12-535-18, ZUMS.REC.1395.293).

Disclosure Statement

No competing financial interests exist.

References

Azimian

, Havaei

S.A.

, Fazeli

, Naderi

, Ghazvini

, Samiee

S.M.

, Soleimani

, and Peerayeh

S.N.

. 2012. Genetic characterization of a vancomycin-resistant Staphylococcus aureus isolate from the respiratory tract of a patient in a university hospital in northeastern Iran. J. Clin. Microbiol., 50:3581–3585.

Waryah

C.B.

, Gogoi-Tiwari

, Wells

, Eto

K.Y.

, Masoumi

, Costantino

, Kotiw

, and Mukkur

. 2016. Diversity of virulence factors associated with West Australian methicillin-sensitive Staphylococcus aureus isolates of human origin. Biomed. Res. Int., 2016:8651918.

Zetola

, Francis

J.S.

, Nuermberger

E.L.

, and Bishai

W.R.

. 2005. Community-acquired meticillin-resistant Staphylococcus aureus: an emerging threat. Lancet Infect. Dis., 5:275–286.

Liu

, Bayer

, Cosgrove

S.E.

, Daum

R.S.

, Fridkin

S.K.

, Gorwitz

R.J.

, Kaplan

S.L.

, Karchmer

A.W.

, Levine

D.P.

, Murray

B.E.

, Rybak

J.M.

, Talan

D.A.

, and Chambers; Infectious Diseases Society of America

H.F.

. 2011. Clinical practice guidelines by the Infectious Diseases Society of America for the treatment of methicillin-resistant Staphylococcus aureus infections in adults and children. Clin. Infect. Dis., 52:e18–e55.

Kong

E.F.

, Johnson

J.K.

, and Jabra-Rizk

M.A.

. 2016. Community-associated methicillin-resistant Staphylococcus aureus: an enemy amidst us. PLoS Pathog., 12:e1005837.

Kim

J.W.

, Kang

G.S.

, Yoo

J.I.

, Kim

H.S.

, Lee

Y.S.

, Yu

J.Y.

, Lee

K.J.

, Park

, and Kim

I.H.

. 2016. Molecular typing and resistance profiles of vancomycin-intermediate Staphylococcus aureus in Korea: results from a National Surveillance Study, 2007–2013. Ann. Clin. Microbiol., 19:88–96.

Otto

2012. MRSA virulence and spread. Cell. Microbiol., 14:1513–1521.

Figueiredo

A.M.S.

, Ferreira

F.A.

, Beltrame

C.O.

, and Côrtes

M.F.

. 2017. The role of biofilms in persistent infections and factors involved in ica-independent biofilm development and gene regulation in Staphylococcus aureus. Crit. Rev. Microbiol., 43:602–620.

Gill

S.R.

, McIntyre

L.M.

, Nelson

C.L.

, Remortel

, Rude

, Reller

L.B.

, and Fowler

V.G.

Jr.

2011. Potential associations between severity of infection and the presence of virulence-associated genes in clinical strains of Staphylococcus aureus. PLoS One, 6:e18673.

10.

Lalani

, Federspiel

J.J.

, Boucher

H.W.

, Rude

T.H.

, Bae

I.G.

, and Rybak

M.J.

. 2008. Associations between the genotypes of Staphylococcus aureus blood stream isolates and clinical characteristics and outcomes of bacteremic patients. J. Clin. Microbiol., 46:2890–2896.

11.

Mitani

, Koizumi

, Sano

, Masutani

, Murakawa

, and Mikasa

. 2005. Molecular typing of methicillin-resistant Staphylococcus aureus by PCR-RFLP and its usefulness in an epidemiological study of an outbreak. Jpn. J. Infect. Dis., 58:250–252.

12.

Hallin

, Friedrich

A.W.

, and Struelens

M.J.

. 2009. Spa typing for epidemiological surveillance of Staphylococcus aureus. Methods Mol. Biol., 551:189–202.

13.

Fasihi

, Fooladi

, Mohammadi

M.A.

, Emaneini

, and Kalantar-Neyestanaki

. 2017. The spa typing of methicillin-resistant Staphylococcus aureus isolates by high resolution melting (HRM) analysis. J. Med. Microbiol., 66:1335–1337.

14.

Wichelhaus

T.A.

, Hunfeld

K.P.

, Böddinghaus

, Kraiczy

, Schäfer

, and Brade

. 2001. Rapid molecular typing of methicillin-resistant Staphylococcus aureus by PCR-RFLP. Infect. Control Hosp. Epidemiol., 22:294–298.

15.

CLSI. 2016. Performance Standards for Antimicrobial Susceptibility Testing. 26th ed. CLSI supplement M100S. Clinical and Laboratory Standards Institute, Wayne, PA.

16.

Magiorakos

A.P.

, Srinivasan

, Carey

R.B.

, Carmeli

, Falagas

M.E.

, and Giske

C.G.

. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect., 18:268–281.

17.

Omar

N.Y.

, H. Abdel Salam Ali, R.A.H. Harfoush, and E.H. El Khayat. 2014. Molecular typing of methicillin resistant Staphylococcus aureus clinical isolates on the basis of protein A and coagulase gene polymorphisms. Int. J. Microbiol., 2014; 650328.

18.

Cramton

S.E.

, Gerke

, Schnell

N.F.

, Nichols

W.W.

, and Götz

. 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect. Immun., 67:5427–5433.

19.

Pai

, Rao

V.I.

, and Rao

D.P.

. 2010. Prevalence and antimicrobial susceptibility pattern of methicillin-resistant Staphylococcus aureus [MRSA] isolates at a tertiary care hospital in Mangalore, South India. J. Lab. Physicians, 2:82–84.

20.

Pillar

C.M.

, Draghi

D.C.

, Sheehan

D.J.

, and Sahm

D.F.

. 2008. Prevalence of multidrug-resistant, methicillin-resistant Staphylococcus aureus in the United States: findings of the stratified analysis of the 2004 to 2005 LEADER Surveillance Programs. Diagn. Microbiol. Infect. Dis., 60:221–224.

21.

Seifi

, Kahani

, Askari

, Mahdipour

, and Naderi Nasab

N.M.

. 2012. Inducible clindamycin resistance in Staphylococcus aureus isolates recovered from Mashhad, Iran. Iran J. Microbiol., 4:82–86.

22.

Japoni

, Alborzi

A.V.

, Rasouli

, and Pourabbas

. 2004. Modified DNA extraction for rapid PCR detection of methicillin resistant Staphylococci. Iranian Biomed. J., 8:61–65.

23.

Mehdinejad

, Frajzade

, and Jolodar

. 2008. Study of methicillin resistance in Staphylococcus aureus and species of coagulase negative staphylococci isolated from various clinical specimens. Pak. J. Med. Sci., 24:115–117.

24.

McGuinness

W.A.

, Malachowa

, and DeLeo

F.R.

. 2017. Vancomycin resistance in Staphylococcus aureus. Yale J. Biol. Med., 90:269–281.

25.

Moses

, Uchenna

, and Nworie

. 2013. Epidemiology of vancomycin resistant Staphyloccus aureus among clinical isolates in a tertiary hospital in Abakaliki, Nigeria. Am. J. Epidemiol. Infect. Dis., 1:24–26.

26.

Breves

, Miranda

C.A.C.

, Flores

, de Filippis

, and Clementino

M.M.

. 2015. Methicillin- and vancomycin-resistant Staphylococcus aureus in health care workers and medical devices. J. Bras. Patol. Med. Lab., 51:143–152.

27.

Goud

, Gupta

, Neogi

, Agarwal

, Naidu

, Chalannavar

, and Subhaschandra

. 2011. Community prevalence of methicillin and vancomycin resistant S aureus in and around Bangalore, southern India. Rev. Soc. Bras. Med. Trop., 44:309–312.

28.

Shekarabi

, Hajikhani

, Salimi Chirani

, Fazeli

, and Goudarzi

. 2017. Molecular characterization of vancomycin- resistant Staphylococcus aureus strains isolated from clinical samples: a three year study in Tehran, Iran. PLoS One, 12:e0183607.

29.

Askari

, Zarifian

, Pourmand

, and Naderi-Nasab

. 2012. High-level vancomycin-resistant Staphylococcus aureus (VRSA) in Iran: a systematic review. J. Med. Bacteriol., 1:53–61.

30.

Tong

S.Y.

, Davis

J.S.

, Eichenberger

, Holland

T.L.

, and Fowler

V.G.

Jr.

2015. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations and management. Clin. Microbiol. Rev., 28:603–661.

31.

Dinges

M.M.

, Orwin

P.M.

, and Schlievert

P.M.

. 2000. Exotoxins of Staphylococcus aureus. Clin. Microbiol. Rev., 13:16–34.

32.

van Trijp

M.J.

, Melles

D.C.

, Snijders

S.V.

, Wertheim

H.F.

, Verbrugh

H.A.

, van Belkum

, and, van Wamel

W.J.

. 2010. Genotypes, superantigen gene profiles, and presence of exfoliative toxin genes in clinical methicillin-susceptible Staphylococcus aureus isolates. Diagn. Microbiol. Infect. Dis., 66:222–224.

33.

Becker

, Haverkämper

, von Eiff Roth

C, R.

, and Peters

. 2001. Survey of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene in non-Staphylococcus aureus species. Eur. J. Clin. Microbiol. Infect. Dis., 20:4071–409.

34.

Sila

, Sauer

, and Kolar

. 2009. Comparison of the prevalence of genes coding for enterotoxins, exfoliatins, panton-valentine leukocidin and tsst-1 between methicillin-resistant and methicillin-susceptible isolates of Staphylococcus aureus at the university hospital in Olomouc. Biomed. Pap. Med. Fac. Univ. Palacky Olomouc Czech Repub., 153:215–218.

35.

Smyth

, and Kahlmeter

. 2005. Mannitol salt agar-cefoxitin combination as a screening medium for methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol., 43:3797–3799.

36.

Shukla

S.K.

, Karow

M.E.

, Brady

J.M.

, Stemper

M.E.

, Kislow

, and Moore

. 2010. Virulence genes and genotypic associations in nasal carriage, community-associated methicillin-susceptible and methicillin-resistant USA400 Staphylococcus aureus isolates. J. Clin. Microbiol., 48:3582–3592.

37.

Sina

, Ahoyo

T.A.

, Moussaoui

, Keller

, Bankolé

H.S.

, Barogui

, Stienstra

, Kotchoni

S.O.

, Prévost

, and Baba-Moussa L

. 2013. Variability of antibiotic susceptibility and toxin production of Staphylococcus aureus strains isolated from skin, soft tissue, and bone related infections. BMC Microbiol., 13:188.

38.

Wang

L.X.

, Hu

Z.D.

, Hu

Y.M.

, Tian

, Li

, Wang

F.X.

, Yang

, Xu

H.R.

, Li

Y.C.

, and Li

. 2013. Molecular analysis and frequency of Staphylococcus aureus virulence genes isolated from bloodstream infections in a teaching hospital in Tianjin, China. Genet. Mol. Res., 12:646–654.

39.

Diemond-Hernández

, Solórzano-Santos

, Leaños-Miranda

, Peregrino-Bejarano

, and Miranda-Novales

. 2010. Production of icaADBC-encoded polysaccharide intercellular adhesin and therapeutic failure in pediatric patients with staphylococcal device-related infections. BMC Infect. Dis., 10:68.

40.

Ohadian Moghadam

, Pourmand

M.R.

, and Aminharati

. 2014. Biofilm formation and antimicrobial resistance in methicillin-resistant Staphylococcus aureus isolated from burn patients, Iran. J. Infect. Dev. Ctries., 8:1511–1517.

41.

Adesida

S.A.

, Likhoshvay

, Eisner

, Coker

A.O.

, Abioye

O.A.

, Ogunsola

F.T.

, and Kreiswirth

B.N.

. 2006. Repeats in the 3′ region of the protein A gene is unique in a strain of Staphylococcus aureus recovered from wound infections in Lagos, Nigeria. Afr. J. Biotechnol., 5:1858.

42.

Ahangarzadeh Rezaee

, Mirkarimi

S.F.

, Hasani

, Sheikhalizadeh

, Soroush

M.H.

, and Abdinia

. 2016. Molecular typing of Staphylococcus aureus isolated from clinical specimens during an eight-year period (2005–2012) in Tabriz, Iran. Arch. Pediatr. Infect. Dis., 4:e35563.

43.

Soltan Dallal

M.M.

, Salehipour

, Eshraghi

, Fallah Mehrabadi

, and Bakhtiari

. 2010. Occurrence and molecular characterization of Staphylococcus aureus strains isolated from meat and dairy products by PCR-RFLP. Ann. Microbiol., 60:189–196 .

44.

Zhang

, McClure

J.A.

, Elsayed

, Louie

, and Conly

J.M.

. 2005. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol., 43:5026–5033.

45.

Saadat

, Solhjoo

, Norooz-Nejad

M.-J.

, and Kazemi

. 2014. vanA and vanB positive vancomycin-resistant Staphylococcus aureus among clinical isolates in Shiraz, South of Iran. Oman Med. J., 29:335.