Fluoroquinolone Resistance Mechanisms in Shigella Isolates in Shanghai,China,Between 2010 and 2015

Abstract

Objectives:

This study aimed to investigate the antimicrobial susceptibility of Shigella isolated in Shanghai, China and to determine the genetic basis of its resistance to fluoroquinolones.

Materials and Methods:

A total of 402 strains of Shigella, including 145 Shigella flexneri and 257 Shigella sonnei isolates, were analyzed. The Kirby–Bauer disk diffusion method was used to determine the susceptibility of the strains to 13 antimicrobials. Minimum inhibitory concentration of ciprofloxacin was determined by E-test. Mutations within the quinolone resistance-determining regions (QRDRs) of gyrA and parC and in the plasmid-mediated quinolone resistance (PMQR) genes, including qnrA, qnrB, qnrS, and aac (6′)-Ib-cr, were detected by polymerase chain reaction. All the products were then sequenced.

Results:

Most of the Shigella isolates were found to be resistant to nalidixic acid (96.4%), streptomycin (96.4%), ampicillin (86.2%), tetracycline (79.8%), and sulfamethoxazole/trimethoprim (80.6%). S. flexneri isolates showed a significantly higher resistance to cefepime (33.6%), ciprofloxacin (54.2%), norfloxacin (34.1%), and levofloxacin (12.1%) compared with that observed for the S. sonnei strains (χ² analysis, p < 0.05). Three mutations (Ser83, Asp87, and His211) in gyrA and one mutation (Ser80) in parC were detected. Of 257 S. sonnei isolates, 11.7% possessed gyrA mutations and 2% had parC mutations. Of 145 S. flexneri isolates, 98.6% possessed gyrA mutations and 97.9% had parC mutations. The plasmid-mediated resistance genes of qnrS and aac (6′)-Ib-cr were detected among 17 strains (4.2%).

Conclusions:

The mutation percentage within the QRDR of S. flexneri was as high as 98.6 in gyrA and 97.9 in parC. The significant abundance of mutations within QRDRs conferred high levels of fluoroquinolone resistance. Moreover, the PMQR genes, particularly qnrS, played an important role in the decreased susceptibility of Shigella to fluoroquinolones.

Introduction

Shigellosis (bacillary dysentery) caused by Shigella spp. is a major infectious disease among the most common diarrheal diseases in humans worldwide, especially in developing countries.^1,2 About 125 million cases of endemic shigellosis occur annually in Asia, of which 14,000 result in death.³ Children are at highest risk of Shigella spp. infection.⁴ Among the four species of Shigella (Shigella dysenteriae, Shigella flexneri, Shigella sonnei, and Shigella boydii), S. flexneri tends to be the predominant species in developing countries and was mainly responsible for endemic and epidemic shigellosis, while S. sonnei is most reported in developed countries,^5,6 and usually causes a relatively mild illness of watery or bloody diarrhea. S. dysenteriae and S. boydii are comparatively rare. However, the frequency of S. sonnei has become dominant in some developing Asian countries in recent years.^7–9

Appropriate antimicrobial therapy can effectively alleviate the symptoms and reduce the risk of complications of Shigella infection. Fluoroquinolones are the first-line antimicrobial agents used for the clinical treatment of bacillary dysentery.¹⁰ However, with the widespread use of fluoroquinolones, fluoroquinolone-resistant Shigella isolates have emerged in many areas of the world, particularly in Asia,¹¹ resulting in the failure of the treatment of shigellosis. In China, an increase in the level of antimicrobial resistance has been reported. Yang et al.¹² reported that the resistance rate to norfloxacin was 22.3% in the period of 2005–2011 in Anhui province. In Jiangsu province, the resistance rate to norfloxacin was as high as 36.8% in surveillance between 2006 and 2011.¹³ Qu et al.¹⁴ reported that >90% of Shigella isolates showed resistance to at least three wide spectrum drugs in an 8-year study of Shigella species in Beijing. Surveillance data acquired from the sentinel hospital-based surveillance system (2005–2014) in China showed that Shigella isolates resistant to ciprofloxacin and cefotaxime increased from 8.53% and 7.87% in 2005 to 44.65% and 29.94% in 2014, respectively.¹⁵ Because of the prevalence of antimicrobial-resistant Shigella isolates in China, long-term surveillance to resistance patterns of Shigella is essential.

This study aims to investigate the antimicrobial characteristics of Shigella spp. isolated in Shanghai from January 2010 to December 2015 and to determine the genetic basis of fluoroquinolone resistance. To this end, we determined the susceptibility of these strains to 13 antimicrobials, and identified mutations in the quinolone resistance-determining regions (QRDRs) of gyrA and parC, and the presence of plasmid-mediated quinolone resistance (PMQR) genes using polymerase chain reaction (PCR) and sequencing.

Materials and Methods

Clinical isolates

From 2010 to 2015, a total of 402 strains of Shigella were collected from patients with diarrhea in 15 district hospitals in Shanghai, China, as part of ongoing sentinel-based bacillary dysentery surveillance. All isolates were stored at −70°C in 30% glycerine brain heart broth and identified using the Vitek 2 System (bioMerieux, St. Louis, MO), and serological identification was then performed using Shigella antisera (Denka Seiken, Tokyo, Japan). Positive control strains for the qnrA, qnrB, qnrS, and aac (6′)-Ib-cr genes were provided by Institute of Antibiotics, Huashan Hospital, Fudan University.

Antimicrobial susceptibility testing

Susceptibility of the strains to 13 antimicrobials was determined using the Kirby–Bauer disk diffusion method on Muller–Hinton agar plates. The antimicrobial agents were as follows: ampicillin (AMP), ciprofloxacin (CIP), cefotaxime (CTX), cefepime (FEP), trimethoprim/sulfamethoxazole (SXT), levofloxacin (LEV), amoxicillin/clavulanic acid (AMC), chloramphenicol (C), cefoxitin (FOX), nalidixic acid (NA), norfloxacin (NOR), streptomycin (S), and tetracycline (TE). All isolates were tested using the E-test to determine the minimum inhibitory concentration (MIC) of ciprofloxacin. Susceptibility testing was performed according to the guidelines of the Clinical and Laboratory Standards Institute.¹⁶ Escherichia coli ATCC 25922 was used as a control strain. Zone diameter and MIC breakpoints used for susceptibility and resistance to ciprofloxacin were ≥21 mm and ≤15 mm and ≤1 mg/L and ≥4 mg/L, respectively.

PCR amplification and sequencing

PCR was used to detect mutations in the QRDRs of gyrA and parC, and the presence of the PMQR genes qnrA, qnrB, qnrS, and aac (6′)-Ib-cr. PCR conditions were 94°C for 45 sec, 56–61°C for 45 sec, and 72°C for 45 sec for 34 cycles. Primer sequences, amplified fragment lengths, and annealing temperatures are shown in Table 1. PCR amplification products were sequenced by Mai Pu Biotechnology Co., Ltd. Sequence results were analyzed by BLAST in GenBank after splicing. Strain S. flexneri 2a str. 301 (GenBank accession no. AE005674) was used as a reference.

Table 1.

Primer Sequences for Genes Related to Quinolone Resistance

Target gene	Primer sequences (5′-3′)	Length of amplification fragment (bp)	Annealing temperature (°C)	References
gyrA-R	TACACCGGTCAACATTGAGG	648	56	⁴¹
gyrA-F	TTAATGATTGCCGCCGTCGG	648	56	⁴¹
parC-R	GTACGTGATCATGGACCGTG	531	61	⁴¹
parC-F	TTCGGCTGGTCGATTAATGC	531	61	⁴¹
qnrA-R	GGCAGCACTATTACTCCC A	627	56	⁴²
qnrA-F	TCAGCA AGAGGATTT CTC A	627	56	⁴²
qnrB-R	ATGACGCCATTACTGTATAA	562	56	⁴³
qnrB-F	GAT CGCAATGTGTGAAGTTT	562	56	⁴³
qnrS-R	AGTGATCTCACCTTCACC GC	550	58	⁴⁴
qnrS-F	CAGGCTGCAATT TTGATACC	550	58	⁴⁴
aac(6′)-Ib-cr-R	TTGCGATGCTCTATGAGTGGCTA	482	57	⁴⁵
aac(6′)-Ib-cr-F	CTCGAATGCCTGGCGTGTTT	482	57	⁴⁵

Statistical analysis

Uncorrected chi-square test was used to show the association between the species (S. flexneri and S. sonnei) and the prevalence of resistance to each antimicrobial in SPSS13.0 software. For each species, the count data of resistant or nonresistant to each antimicrobial were filled in a single 2 × 2 table. When the expected number of observations in any cell was <5, the Fisher exact test would be used. When two-tailed p-value was <0.05, the association was considered statistically significant.

Results

Bacterial isolates

Four hundred two Shigella isolates were collected from 15 district hospitals in Shanghai, China, during 2010–2015. Among the 402 Shigella isolates, 257 (63.9%) were identified as S. sonnei, which witnessed a significant increase in the year 2011 (Table 2). Nine serotypes of S. flexneri were identified. The four major serotypes were serotype 2a (n = 69, 47.6%), serotype 1a (n = 30, 20.7%), serotype 4c (n = 19, 13.1%), and serotype X (n = 10, 6.9%).

Table 2.

Serotype Distribution of Shigella from 2010 to 2015

Year	Shigella flexneri (n/%)										Shigella sonnei (n/%)	Total
Year	F1a	F2a	F2b	F3a	F4a	F4c	F6	Fx	Fy	Subtotal	Shigella sonnei (n/%)	Total
2010	5	10	0	1	0	5	0	2	0	23 (30.3)	53 (69.7)	76
2011	9	13	0	0	0	9	3	2	2	38 (25.5)	111 (75.5)	149
2012	3	20	4	0	1	2	1	1	0	32 (52.5)	29 (47.5)	61
2013	7	14	1	0	0	2	0	4	0	28 (47.5)	31 (52.5)	59
2014	5	6	2	0	1	1	0	0	0	15 (44.1)	19 (55.9)	34
2015	1	6	0	0	1	0	0	1	0	9 (39.1)	14 (60.9)	23
Total	30	69	7	1	3	19	4	10	2	145 (36.1)	257 (63.9)	402

Comparison of antimicrobial resistance rates between S. flexneri and S. sonnei

Because of the significant increase in S. sonnei in 2011, the antimicrobial resistance rates were analyzed without the date in 2011, although no outbreaks of shigellosis were reported during the sampling period. A wide spectrum of antimicrobial resistance rates were observed across the 253 Shigella strains isolated from 2010 to 2015, except for 2011 (Table 3). Of these strains, 244 (96.4%) were resistant to nalidixic acid and streptomycin, 218 (86.2%) to ampicillin, 202 (79.8%) to tetracycline, and 204 (80.6%) to trimethoprim/sulfamethoxazole. Lower rates of resistance were observed for amoxicillin–clavulanic acid (16.2%), levofloxacin (5.9%), and cefoxitin (3.2%). Significant differences in drug resistance between the two species of Shigella were observed for ampicillin (96.3% vs. 78.8%; p < 0.05), cefepime (33.6% vs. 23.3%; p < 0.05), chloramphenicol (86% vs. 0%; p < 0.05), amoxicillin–clavulanic acid (28% vs. 7.5%; p < 0.05), tetracycline (96.3% vs. 67.6%; p < 0.05), ciprofloxacin (54.2% vs. 3.4%; p < 0.05), norfloxacin (34.6% vs. 1.4%; p < 0.05), levofloxacin (12.1% vs. 1.4%; p < 0.05), and trimethoprim/sulfamethoxazole (71% vs. 87.7%; p < 0.05).

Table 3.

Comparison of Antimicrobial Resistance Rates Between Shigella flexneri and Shigella sonnei

Antimicrobial agent	Resistance no. (%) isolates			χ²	p
Antimicrobial agent	Shigella total N = 253	S. flexneri N = 107	S. sonnei N = 146	χ²	p
Ampicillin	218 (86.2)	103 (96.3)	115 (78.8)	15.85	<0.001
Cefotaxime	97 (38.3)	44 (41.1)	53 (36.3)	0.61	0.22
Cefepime	70 (27.7)	36 (33.6)	34 (23.3)	3.31	0.03
Streptomycin	244 (96.4)	103 (96.3)	99 (96.6)	0.02	0.45
Chloramphenicol	92 (36.4)	92 (86)	0 (0.0)	197.3	<0.001
Amoxicillin–clavulanic acid	41 (16.2)	30 (28)	11(7.5)	19.12	<0.001
Tetracycline	202 (79.8)	103 (96.3)	99 (67.6)	31.06	<0.001
Nalidixic acid	244(96.4)	105 (98.1)	139 (95.2)	1.54	0.11
Ciprofloxacin	63 (24.9)	58 (54.2)	55 (3.4)	85.15	<0.001
Norfloxacin	39 (15.4)	37 (34.6)	2 (1.4)	52.23	<0.001
Levofloxacin	15 (5.9)	13 (12.1)	2 (1.4)	12.86	0.0002
Cefoxitin	8 (3.2)	3 (2.8)	5 (3.4)	0.08	0.39
Trimethoprim/sulfamethoxazole	204 (80.6)	76 (71.0)	128 (87.7)	10.95	0.0005

Molecular analysis of the QRDR sequences

The QRDRs of 402 strains of Shigella were analyzed. Of these strains, 227 (88.3%) of S. sonnei but only 2 (1.4%) of S. flexneri strains displayed no mutations in gyrA or parC. The ciprofloxacin MICs of strains without mutations in these genes were 0.006 and 0.016 mg/L for S. flexneri and ranged from 0.003 to 0.5 mg/L for S. sonnei (Table 4). Three mutations, at position 83 (Ser → Leu), position 87 (Asp → Asn or Gly), and position 211(His → Tyr), were detected in gyrA; only one mutation, at position 80 (Ser → Ile or Arg), was detected in parC. There were 143 strains of S. flexneri with QRDR mutations in gyrA and 142 strains with such mutations in parC, with respective mutation percentages of 98.6 and 97.9. All mutant strains of S. flexneri had mutations in both gyrA and parC, with the exception of one strain with a ciprofloxacin MIC of 4 mg/L, which had mutations only in gyrA (Ser83leu, Asp87Asn, and His211Tyr). Of the143 mutant S. flexneri strains, 71 (49.7%) (ciprofloxacin MIC range, 0.19 to >32 mg/L) had two gyrA mutations (Ser83leu and His211Tyr) and one parC mutation (Ser80 Ile), and 65 (45.5%) of these strains had three gyrA mutations (Ser83leu, Asp87Asn or Asp87Gly, and His211Tyr) and one parC mutation (Ser80 Ile). Of the mutant S. sonnei strains, 83.3% (25/30) (ciprofloxacin MIC range, 0.094–1 mg/L) had a mutation only in gyrA (Ser83leu). One strain (ciprofloxacin MIC, 32 mg/L) had two gyrA mutations (Ser83leu and His211Tyr) and one parC mutation (Ser80 Ile). Four strains (ciprofloxacin MIC range, 4–8 mg/L) had two gyrA mutations (Ser83Leu and Asp87Asn) and one parC mutation (Ser80 Ile) (Table 4).

Table 4.

Fluoroquinolone Resistance and Amino Acid Substitutions in Shigella Isolates

No. of Shigella isolates nucleotide and amino acid change (%)				Amino acid substitutions
S. flexneri		S. sonnei		GyrA			parC
No. (%)	CIP	No. (%)	MIC (mg/L)	TCG (Ser83)	GAC (Asp87)	CAC (His211)	AGC (Ser80)
No. (%)	MIC (mg/L)	No. (%)	CIP	TCG (Ser83)	GAC (Asp87)	CAC (His211)	AGC (Ser80)
2 (1.4)	0.006–0.016	227 (88.3)	0.003–0.5	—	—	—	—
0	—	25 (9.7)	0.094–1	TTG (Leu)	—	—	—
71 (49.0)	0.19 to >32	1 (0.4)	32	TTG (Leu)	—	TAC (Tyr)	ATC (Ile)
2 (1.4)	32	4 (1.6)	4–8	TTG (Leu)	AAC (Asn)	—	ATC (Ile)
49 (33.8)	2–24	0	—	TTG (Leu)	AAC (Asn)	TAC (Tyr)	ATC (Ile)
4 (2.8)	0.38–1	0	—	TTG (Leu)	—	—	AGA (Arg)
16 (11.0)	1.5–8	0	—	TTG (Leu)	GGC (Gly)	TAC (Tyr)	ATC (Ile)
1 (0.7)	4	0	—	TTG (Leu)	AAC (Asn)	TAC (Tyr)	—

MIC, minimum inhibitory concentration; CIP, ciprofloxacin.

All the strains that had no mutation or contained a mutation in gyrA (Ser83) alone or in association with a mutation in parC (Ser80) were susceptible to ciprofloxacin. Of the strains with double mutations in gyrA (Ser83 and His211) and one mutation in parC (Ser80), 14.7% (11/75) were resistant to ciprofloxacin. Moreover, none of the strains with a point mutation at Asp87 were susceptible to ciprofloxacin.

Identification of plasmid-mediated quinolone resistance genes

Of the 145 strains of S. flexneri, 9 (6.2%) carried the gene qnrS1 and 6 (4.1%) carried the gene aac (6′)-Ib-cr (ciprofloxacin MIC range, 0.5–32 mg/L); only one carried both qnrS1 and aac (6′)-Ib-cr. None of the isolates analyzed in this study carried qnrA or qnrB gene. One S. sonnei strain was found to carry a plasmid-mediated aac (6′)-Ib-cr quinolone resistance gene (Table 5).

Table 5.

Effects of Amino Acid Changes and Resistance Plasmids on the Minimum Inhibitory Concentration of Ciprofloxacin

Strain	Year	Species	MIC (mg/L)	PMQR gene	Mutation in QRDR
			CIP		gyrA			parC
			CIP		Ser83	Asp87	His211	Ser80
SH10-48	2010	S. flexneri	32	aac (6′)-Ib-cr	Leu	—	Tyr	Ile
SH11-33	2011	S. flexneri	1.5	aac (6′)-Ib-cr	Leu	—	Tyr	Ile
SH11-72	2011	S. flexneri	0.5	aac (6′)-Ib-cr	Leu	—	Tyr	Ile
SH11-112	2011	S. flexneri	3	qnrS1	Leu	—	Tyr	Ile
SH11-135	2011	S. sonnei	0.38	aac (6′)-Ib-cr	Leu	—	—	—
SH12-1	2012	S. flexneri	1.5	aac (6′)-Ib-cr	Leu	—	Tyr	Ile
SH12-12	2012	S. flexneri	1.5	aac (6′)-Ib-cr	Leu	—	Tyr	Ile
SH12-13	2012	S. flexneri	4	aac (6′)-Ib-cr	Leu	Asn	Tyr	Ile
SH12-27	2012	S. flexneri	4	qnrS1	Leu	—	Tyr	Ile
SH12-33	2012	S. flexneri	4	qnrS1	Leu	Asn	Tyr	Ile
SH12-49	2012	S. flexneri	4	qnrS1	Leu	—	Tyr	Ile
SH13-23	2013	S. flexneri	4	qnrS1	Leu	—	Tyr	Ile
SH13-35	2013	S. flexneri	8	qnrS1	Leu	—	Tyr	Ile
SH13-37	2013	S. flexneri	8	qnrS1	Leu	—	Tyr	Ile
SH14-4	2014	S. flexneri	3	qnrS1	Leu	—	Tyr	Ile
SH14-18	2014	S. flexneri	6	qnrS1	Leu	—	Tyr	Ile
SH15-15	2015	S. flexneri	8	qnrS1, aac (6′)-Ib-cr	Leu	Asn	Tyr	Ile

PMQR, plasmid-mediated quinolone resistance; QRDR, quinolone resistance-determining regions.

Discussion

In our study, we analyzed the levels of fluoroquinolone resistance and their mechanisms among Shigella isolates in Shanghai, China, between 2010 and 2015. Of 402 collected Shigella isolates, 63.9% were S. sonnei and 39.1% were S. flexneri. The fact was that S. sonnei became the dominant species, revealing the shift in the epidemiologic distribution of Shigella in Shanghai, compared with the report that most prevalent species of Shigella was S. flexneri (86%) in China during 1991–2000.¹⁷ This was similar to the trends and patterns reported in Isfahan (Iran) from 2010 to 2015.¹⁸ The shift of the species is likely due to the rapid economic development and environmental conditions. Among S. flexneri isolates, the most prevalent serotype was 2a, which was also identified as a predominant serotype in China and other developing countries.^19–21

The rapid emergence of drug-resistant Shigella is one of the most serious global public health concerns. Most of the Shigella isolates investigated in our study were resistant to nalidixic acid (96.4%), streptomycin (96.4%), ampicillin (86.2%), and tetracycline (79.8%). The resistance rates were higher than those reported in Switzerland,²² New York,²³ and Isfahan, Iran.¹⁸ Therefore, these drugs should no longer be considered appropriate empirical therapy. Fortunately, the resistance rate to ciprofloxacin and the fourth-generation cephalosporin cefepime was lower, showing resistance rates of 24.9% and 27.7%, respectively. However, this rate was still higher when compared with those found before 2012 in Shanghai^9,24 and other areas of China.^20,25 Notably, S. flexneri isolates displayed a much higher prevalence of resistance to most antimicrobials than did S. sonnei. Those MDR strains may result from the fact that traditional antibiotic-associated selection of S. flexneri has been underway for decades.

In recent years, fluoroquinolones, as the frontline antibiotics, have been widely applied for the treatment of diarrhea, which led to significantly higher resistance to quinolones, particularly to ciprofloxacin (54.2% vs. 3.4%; p < 0.05) and norfloxacin (36.4% vs. 1.4%; p < 0.05). Also, a significant difference between serotypes and resistance rate to ciprofloxacin was observed. Among the common serotypes, the resistance rate to ciprofloxacin in serotypes 2a and 1a was 65.2% and 43.3%, respectively, which was much higher than that in serotype 4c (5.26%). The result was consistent with that reported by Tingting Qin.²⁰ However, what was more worrying was that the resistance rate to norfloxacin in S. sonnei reached a peak of 40.7% in Jiangsu province, China.²⁶ This phenomenon may be a result of the continuous abuse of fluoroquinolones in the local community of patients with diarrhea. Bing Gu et al.²⁶ reported that fluoroquinolone-resistant Shigella isolates may spread across geographic regions even across the country by population mobility. In the United States, the Shigella resistance rate to ciprofloxacin reached 87% during 2014–2015.²⁷ This further emphasizes the necessity to monitor the long-term resistance patterns of Shigella to guide effective empirical treatment regimens.

The resistance of Shigella to fluoroquinolone is mainly produced by mutational alterations in the QRDR of DNA gyrase and topoisomerase IV genes, the targets of quinolones.^28,29 Of the 257 S. sonnei isolates investigated in our study, 227 (88.3%) (ciprofloxacin MIC range, 0.003–0.5 mg/L) had no mutations in the gyrA or parC, and 25 (9.7%) had a single mutation of Ser83 in gyrA (ciprofloxacin MIC range, 0.094–1 mg/L). The result is not consistent with a study in Jiangsu province, reporting that 78% strains of S. sonnei contained mutations in the gyrA genes.²⁶ The high mutation percentage in S. sonnei strains in Jiangsu province accounted for the high resistance rate of 21.8% to norfloxacin. In contrast, of the 145 S. flexneri isolates, 138 (95.2%) had at least double mutations in gyrA, some were associated with one mutation in parC. In addition, all the strains containing mutations displayed a mutation at codon Ser83 in gyrA followed by a mutation at position His211 (138/173), which was first detected in the S. flexneri isolates in Bangladesh.³⁰

All the strains that had no mutation, and contained a mutation in gyrA (Ser83) alone, were susceptible to ciprofloxacin, with the MIC₅₀ and MIC₉₀ values of 0.125 and 0.25 mg/L. However, two strains with a ciprofloxacin MIC of 1 mg/L displayed decreased susceptibility to ciprofloxacin, thus leading to a greater likelihood of treatment failure. Moreover, a total of 72 strains possessed double mutations in gyrA (Ser83 and His211) and one mutation in parC (Ser80) (ciprofloxacin MIC range, 0.19 to >32 mg/L, MIC₅₀ and MIC₉₀ values, 0.5 and 4 mg/L), of which 15.3% (11/72) were resistant to ciprofloxacin. This finding is consistent with a report that the presence of a single mutation in the QRDR of gyrA usually results in high-level resistance to nalidixic acid. However, to obtain high levels of resistance to fluoroquinolones, the presence of additional mutations in gyrA and/or in another target such as parC is required.³¹

Notably, all the strains that did possess the point mutation at Asp87 in gyrA and in association with additional mutations in gyrA and parC were resistant to ciprofloxacin, indicating that the mutation at position 87 of gyrA is necessary for high-level resistance to fluoroquinolones in Shigella isolates. The results suggest that with alteration at Ser80 in parC, the presence of Ser83 mutation in gyrA may lead to a decrease in the sensitivity of Shigella to fluoroquinolones, and it may further result in the emergence or increase of resistance if an additional mutation is acquired at Asp87 in gyrA. This conclusion is in agreement with a previous report of acquired resistance to fluoroquinolones caused by dual gyrA mutations of Ser83 and Asp87.³² Our study reveals the alarming finding that 78.7% (59/75) of the ciprofloxacin-susceptible S. flexneri isolates have mutations at Ser83 and/or His211 in gyrA, in association with a mutation at Ser80 in parC. Therefore, these strains are likely to acquire resistance to fluoroquinolone antimicrobials if a mutation at Asp87 in gyrA occurs.

Over the past few years, the determinants of PMQR have become an important issue worldwide.^33–35 Our study found that the PMQR genes were present in 4.2% (17/402) of the strains, including seven isolates positive for aac (6′)-Ib-cr, nine isolates positive for qnrS1, and one isolate positive for both aac (6′)-Ib-cr and qnrS1. Xiong et al. also showed that aac (6′)-Ib-cr and qnrS were found in 19.2% and 11.5% of S. flexneri in Anhui province.³⁶ However, no qnrA or qnrB genes were detected in these isolates.

All of the 17 PMQR-positive strains were S. flexneri, except for one S. sonnei isolate that carried the aac (6′)-Ib-cr gene. Notably, before 2012, aac (6′)-Ib-cr was the most prevalent gene, followed by qnrS, as reported in most of the surveillance studies in China.^26,37,38 However, after 2012, a significant shift occurred in the detection rate of PMQR genes; the qnrS gene has become most prevalent replacing aac (6′)-Ib-cr. In addition, an S. flexneri strain with dual PMQR genes, qnrS1 and aac (6′)-Ib-cr, was first detected in 2015, supporting the report that qnr alleles were coexpressed with aac (6′)-Ib-cr on the same plasmid.³⁹ A similar phenomenon was observed in SiXian of Anhui province, reporting that most Shigella isolates with the aac (6′)-Ib-cr and qnr genes in combination exhibited higher levels of resistance to quinolone than did those with aac (6′)-Ib-cr alone.⁴⁰

In our study, we found that all of the Shigella strains with qnrS1 or associated with aac (6′)-Ib-cr were resistant to ciprofloxacin, with MICs in the range of 4–8 mg/L, except for two strains with ciprofloxacin MIC of 3 mg/L. All of the strains carrying aac (6′)-Ib-cr alone were susceptible to ciprofloxacin (MIC range, 0.38–1.5 mg/L), except for two strains with ciprofloxacin MICs of 4 and 32 mg/L. This observation suggests that the plasmid-borne quinolone resistance gene qnrS plays an important role in the decreased susceptibility of Shigella strains to fluoroquinolones. It was also reported in the study suggested by Pu that the MICs of ciprofloxacin increased two-to-eight fold for aac (6′)-Ib-cr-positive plasmids.³³ However, S. flexneri SH10-48 with a ciprofloxacin MIC of 32 mg/L carries a single-determinant gene of aac (6′)-Ib-cr. Thus, we consider that other mechanisms (the impermeable status of the membrane and/or an overexpression of efflux pump systems) may result in the high levels of fluoroquinolone resistance to the strain SH10-48, and warrant further study and discussion.

In conclusion, this study elucidates the genetic basis of fluoroquinolone resistance among Shigella strains isolated in the Shanghai area from 2010 to 2015. The significant abundance of mutations within QRDRs and the prevalence of the PMQR gene qnrS, which confers high levels of fluoroquinolone resistance, constitute a stern warning that we must continue the active surveillance of fluoroquinolone resistance among Shigella strains in Shanghai and control the use of antimicrobials.

Footnotes

Acknowledgment

We acknowledge Antibiotics Research Institute of Shanghai Huashan Hospital that provided the positive control strains.

Disclosure Statement

No competing financial interests exist.

References

Niyogi

S.K.

2005. Shigellosis. J. Microbiol. 43:133–143.

Anderson

, Sansonetti

P.J.

, and Marteyn

B.S.

. 2016. Shigella diversity and changing landscape: insights for the Twenty-First Century. Front. Cell. Infect. Microbiol. 6:45.

Bardhan

, Faruque

A.S.

, Naheed

, and Sack

D.A.

. 2010. Decrease in shigellosis-related deaths without Shigella spp.-specific interventions, Asia. Emerg. Infect. Dis. 16:1718–1723.

Parisot

, Parez

, Boukhari

, Breurec

, and Jolivet

. 2018. Shigella infection in children under 5 years old in western French Guiana. Epidemiol. Infect. 2018:1–5.

Ud-Din

A.I.

, Wahid

S.U.

, Latif

H.A.

, Shahnaij

, Akter

, Azmi

I.J.

, Hasan

T.N.

, Ahmed

, Hossain

M.A.

, Faruque

A.S.

, Faruque

S.M.

, and Talukder

K.A.

. 2013. Changing trends in the prevalence of Shigella species: emergence of multi-drug resistant Shigella sonnei biotype g in Bangladesh. PLoS One, 8:e82601.

Khan

, Jabeen

, Ejaz

, Siddiqui

, Shezad

M.F.

, and Zafar

. 2009. Trends in antimicrobial resistance in Shigella species in Karachi, Pakistan. J. Infect. Dev. Ctries. 3:798–802.

Filliol-Toutain

, Chiou

C.S.

, Mammina

, Gerner-Smidt

, Thong

K.L.

, Phung

D.C.

, Pichel

, Ranjbar

, Sow

A.G.

, Cooper

, Ribot

, Binsztein

, and Liang

S.Y.

. 2011. Global distribution of Shigella sonnei clones. Emerg. Infect. Dis. 17:1910–1912.

Bangtrakulnonth

, Vieira

A.R.

, Lo Fo Wong

D.M.

, Pornreongwong

, Pulsrikarn

, Sawanpanyalert

, Hendriksen

R.S.

, and Aarestrup

F.M.

. 2008. Shigella from humans in Thailand during 1993 to 2006: spatial-time trends in species and serotype distribution. Foodb. Pathog. Dis. 5:773–784.

Zhang

, Jin

, Hu

, Yuan

, Shi

, Yang

, Xu

, and Meng

. 2014. Antimicrobial resistance of Shigella spp. from humans in Shanghai, China, 2004–2011. Diagn. Microbiol. Infect. Dis. 78:282–286.

10.

World Health Organization. 2005. Guidelines for the control of shigellosis, including epidemics due to Shigella Dysenteriae type1. Available at www.who.int/cholera/publications/shigellosis/en/ (accessed January, 3, 2018).

11.

, Cao

, Pan

, Zhuang

, Yu

, Peng

, Qian

, Wei

, Zhao

, Liu

, Tong

. 2012. Comparison of the prevalence and changing resistance to nalidixic acid and ciprofloxacin of Shigella between Europe-America and Asia-Africa from 1998 to 2009. Int. J. Antimicrob. Agents, 40:9–17.

12.

Yang

, Chen

, Zhu

, Liu

, Cheng

, Hu

, Ye

, and Li

. 2013. Surveillance of antimicrobial susceptibility patterns among Shigella species isolated in China during the 7-year period of 2005–2011. Ann. Lab. Med. 33:111–115.

13.

Qin

, Bi

, Fan

, Kang

, Ma

, and Gu

. 2016. Novel mutations in quinolone resistance-determining regions of gyrA, gyrB, parC and parE in Shigella flexneri clinical isolates from eastern Chinese populations between 2001 and 2011. Eur. J. Clin. Microbiol. Infect. Dis. 35:2037–2045.

14.

, Zhang

, Liu

, Huang

, Jia

, Liang

, Li

, Wu

, Li

, Yan

, Kan

, and Wang

. 2014. An eight-year study of Shigella species in Beijing, China: serodiversity, virulence genes, and antimicrobial resistance. J. Infect. Dev. Countries, 8:904–908.

15.

Chang

, Zhang

, Ran

, Sun

, Liu

, Luo

, Zeng

, Wang

, Li

, Yu

, and Liao

. 2016. The changing epidemiology of bacillary dysentery and characteristics of antimicrobial resistance of Shigella isolated in China from 2004–2014. BMC Infect. Dis. 16:685.

16.

Clinical and Laboratory Standards Institute. 2017. M100-S27. Performance Standards for Antimi-crobial Susceptibility Testing; Twenty-Seventh Informational Supplement[S]. Wayne PC.

17.

Wang

X.Y.

, Tao

, Xiao

, Lee

, Deen

, Gong

, Zhao

, Zhou

, Li

, Shen

, Song

, Ma

, Li

Z.M.

, Wang

, Su

P.Y.

, Chang

, Xu

J.H.

, Ouyang

P.Y.

, von Seidlein

, Xu

Z.Y.

, and Clemens

J.D.

. 2006. Trend and disease burden of bacillary dysentery in China (1991–2000). Bull. World Health Organ. 84:561–568.

18.

Mostafavi

, Bighamian

, Mobasherizade

, and Kelishadi

. 2016. Resistance of Shigella strains to extended-spectrum cephalosporins in Isfahan province. Med. J. Islam. Repub. Iran. 30:428.

19.

Zhao

, Xiong

, Meng

, Guo

, Li

, Liang

, Han

, Wang

, Guo

, Wang

, Zhang

, Gao

, and Wang

. 2017. An 11-year study of shigellosis and Shigella species in Taiyuan, China: active surveillance, epidemic characteristics, and molecular serotyping. J. Infect. Public Health, 10:794–798.

20.

Qin

, Qian

, Fan

, Ma

, Zhou

, Dong

, Gu

, and Huo

. 2017. Newest data on fluoroquinolone resistance mechanism of Shigella flexneri isolates in Jiangsu Province of China. Antimicrob. Resist. Infect. Control, 6:97.

21.

Shakya

, Acharya

, Adhikari

, and Rijal

. 2016. Shigellosis in Nepal: 13 years review of nationwide surveillance. J. Health Popul. Nutr. 35:36.

22.

Nuesch-Inderbinen

, Heini

, Zurfluh

, Althaus

, Hachler

, and Stephan

. 2016. Shigella antimicrobial drug resistance mechanisms, 2004–2014. Emerg. Infect. Dis. 22:1083–1085.

23.

Murray

, Reddy

, Kornblum

J.S.

, Waechter

, Chicaiza

L.F.

, Rubinstein

, Balter

, Greene

S.K.

, Braunstein

S.L.

, Rakeman

J.L.

, and Dentinger

D.M.

. 2017. Increasing antibiotic resistance in Shigella spp. from infected New York city residents, New York, USA. Emerg. Infect. Dis. 23:332–335.

24.

Zhang

, Wang

, Jin

, Hu

, Yuan

, Shi

, Yang

, Meng

, and Xu

. 2015. Laboratory monitoring of bacterial gastroenteric pathogens Salmonella and Shigella in Shanghai, China 2006–2012. Epidemiol. Infect. 143:478–485.

25.

, Bao

, Chen

, Cui

, Guo

, Wang

, Zhang

, Wang

, Tang

Y.W.

, and Mao

. 2012. Genotypes and antimicrobial profiles of Shigella sonnei isolates from diarrheal patients circulating in Beijing between 2002 and 2007. Diagn. Microbiol. Infect. Dis. 74:166–170.

26.

, Qin

T.T.

, Fan

W.T.

, Bi

R.R.

, Chen

, Li

, and Ma

. 2017. Novel mutations in gyrA and parC among Shigella sonnei strains from Jiangsu Province of China, 2002–2011. Int. J. Infect. Dis. 59:44–49.

27.

Bowen

A., J.

, Hurd

, Hoover

, Khachadourian

, Traphagen

, Harvey

, Libby

, Ehlers

, Ongpin

J.C.

, Norton

, Bicknese

, Kimura ; Centers for Disease Control and Prevention. 2015. Importation and domestic transmission of Shigella sonnei resistant to ciprofloxacin—United States, May 2014-February 2015. MMWR Morb. Mortal. Wkly. Rep. 64:318–320.

28.

X.Y.

, Pan

J.C.

, Wang

H.Q.

, Zhang

, Huang

Z.C.

, and Gu

Y.M.

. 2009. Characterization of fluoroquinolone-resistant Shigella flexneri in Hangzhou area of China. J. Antimicrob. Chemother. 63:917–920.

29.

Pazhani

G.P.

, Niyogi

S.K.

, Singh

A.K.

, Sen

, Taneja

, Kundu

, Yamasaki

, and Ramamurthy

. 2008. Molecular characterization of multidrug-resistant Shigella species isolated from epidemic and endemic cases of shigellosis in India. J. Med. Microbiol. 57,(Pt 7)::856–863.

30.

Azmi

I.J.

, Khajanchi

B.K.

, Akter

, Hasan

T.N.

, Shahnaij

, Akter

, Banik

, Sultana

, Hossain

M.A.

, Ahmed

M.K.

, Faruque

S.M.

, and Talukder

K.A.

. 2014. Fluoroquinolone resistance mechanisms of Shigella flexneri isolated in Bangladesh. PLoS One, 9:e102533.

31.

Ruiz

2003. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J. Antimicrob. Chemother. 51:1109–1117.

32.

Oonaka

, Fukuyama

, Tanaka

, Sato

, Ohnishi

, Ajima

, and Murata

. 1998. [Mechanism of resistance of Shigella flexneri 2a resistant to new quinolone antibiotics]. Kansenshogaku Zasshi, 72:365–370.

33.

X.Y.

, Gu

, Li

, Song

S.J.

, and Lu

. 2018. Characterization of the complete sequences and stability of plasmids carrying the genes aac (6′)-Ib-cr or qnrS in Shigella flexneri in the Hangzhou area of China. World J. Microbiol. Biotechnol. 34:72.

34.

Vinothkumar

, Bhalara

S.R.

, Shah

, Ramamurthy

, Niyogi

S.K.

, Kumar

G.N.

, and Bhardwaj

A.K.

. 2017. Involvement of topoisomerase mutations and qnr and aac (6′)Ib-cr genes in conferring quinolone resistance to clinical isolates of Vibrio and Shigella spp. from Kolkata, India(1998–2009). J. Glob. Antimicrob. Resist. 13:85–90.

35.

Eftekhar

F.P.

, and Seyedpour

S.M.M.

2015. Prevalence of qnr and aac (6′)-Ib-cr genes in clinical isolates of Klebsiella pneumoniae from Imam Hussein Hospital in Tehran. Iranian J. Med. Sci. 40:515–521.

36.

Xiong

, Li

, Shen

, Hu

, and Wang

. 2010. Prevalence of plasmid-mediated quinolone-resistance determinants in Shigella flexneri isolates from Anhui Province, China. J. Antibiot. 63:187–189.

37.

Cui

, Wang

, Yang

, Liang

, Ma

, Yi

, Li

, Liu

, Li

, Wu

, Xie

, Jia

, Hao

, Wang

, Hua

, Qiu

, and Song

. 2015. Prevalence and antimicrobial resistance of Shigella flexneri serotype 2 variant in China. Front. Microbiol. 2015; 6:435.

38.

Zhu

, Cao

, Zhou

, Li

, and Zhang

. 2017. Epidemic characterization and molecular genotyping of Shigella flexneri isolated from calves with diarrhea in Northwest China. Antimicrob. Resist. Infect. Control, 6:92.

39.

Luo

, Yang

, Zhang

, Ye

, Wang

, and Guo

. 2011. Prevalence of beta-lactamases and 16S rRNA methylase genes amongst clinical Klebsiella pneumoniae isolates carrying plasmid-mediated quinolone resistance determinants. Int. J. Antimicrob. Agents, 37:352–355.

40.

Zhu

Y.L.

, Yang

H.F.

, Liu

Y.Y.

, Hu

L.F.

, Cheng

, Ye

, and Li

J.B.

. 2013. Detection of plasmid-mediated quinolone resistance determinants and the emergence of multidrug resistance in clinical isolates of Shigella in SiXian area, China. Diagn.Microbiol. Infect. Dis. 75:327–329.

41.

L.F.

, Li

J.B.

, Ye

, and Li

. 2007. Mutations in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in clinical strains of fluoroquinolone-resistant Shigella in Anhui, China. J. Microbiol. 45:168–170.

42.

Wang

, Sahm

D.F.

, Jacoby

G.A.

, and Hooper

D.C.

. 2004. Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States. Antimicrob. Agents Chemother. 48:1295–1299.

43.

Jacoby

G.A.

, Walsh

K.E.

, Mills

D.M.

, Walker

V.J.

, Oh

, Robicsek

, and Hooper

D.C.

. 2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother. 50:1178–1182.

44.

Cattoir

, Weill

F.X.

, Poirel

, Fabre

, Soussy

C.J.

, and Nordmann

. 2007. Prevalence of qnr genes in Salmonella in France. J. Antimicrob. Chemother. 59:751–754.

45.

Park

C.H.

, Robicsek

, Jacoby

G.A.

, Sahm

, and Hooper

D.C.

. 2006. Prevalence in the United States of aac (6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother. 50:3953–3955.