High-Level Resistance to Aminoglycosides due to 16S rRNA Methylation in Enterobacteriaceae Isolates

Abstract

Introduction:

High-level aminoglycoside resistance due to methylase genes has been reported in several countries. The purpose of this study was to investigate the diversity of the genes encoding 16S rRNA methylase and their association with resistance phenotype in Enterobacteriacae isolates.

Materials and Methods:

Based on sampling size formula, from February to August 2014, a total of 307 clinical Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration (MIC) for aminoglycosides (except streptomycin), was used. Six 16S rRNA methylase genes (armA, npmA, and rmtA–D) were screened by PCR and sequencing assays.

Results:

In this study, 220 (71.7%) of 307 isolates were aminoglycoside resistant and 40 isolates (18.2%, 40/220) were positive for methylase genes. The frequency of armA, rmtC, npmA, rmtB, and rmtA genes was 9.5%, 4.5%, 3.6%, 2.3%, and 1%, respectively. The rmtD gene was not detected in the tested bacteria. Sixty percent of positive methylase gene isolates displayed high-level resistance (MIC ≥512 μg/mL to amikacin and kanamycin; and MIC ≥128 μg/mL to gentamicin and tobramycin).

Conclusions:

The prevalence of resistance to aminoglycoside in Iran is high. Furthermore, there is a statistically significant association between amikacin and kanamycin resistance with the presence of rmtC and rmtB genes.

Introduction

The new β-lactams, fluoroquinolones and aminoglycosides, have been used for the treatment of infections caused by bacterial pathogens.^1,2 Unfortunately, their efficacy has been reduced by the surge and dissemination of resistance.³ Resistance to aminoglycosides has been attributed to enzymatic inactivation by the production of aminoglycoside-modifying enzymes (AMEs), decreasing in intracellular antibiotic accumulation, efflux pumps, and mutation of ribosomal proteins or rRNA.⁴

Plasmid-encoded 16S rRNA methylase, as a new type of resistance mechanism, has emerged in Enterobacteriaceae and conferred high levels of resistance to all aminoglycosides.^5,6 To date, 10 16S rRNA methylase enzymes (ArmA, NpmA, and RmtA–H) have been described in Gram-negative bacteria. These genes are mainly mediated through bacterium-specific recombination systems such as transposons and are translocated to other DNA target sites.⁷

To the best of our knowledge, the prevalence of 16S rRNA methylase genes among Enterobacteriaceae is unknown in Iran. The aims of this study were to investigate the antimicrobial susceptibility patterns of Enterobacteriaceae against aminoglycosides, finding out the genetic determinants involved in methylation of aminoglycosides, and characterizing the correlation between phenotypic resistance and the presence of 16S rRNA genes.

Materials and Methods

Bacterial isolates

From February to August 2014, 307 nonduplicate Enterobacteriaceae isolates were collected from five hospitals in two cities in Azerbaijan, northwest Iran: Tabriz (180 samples) and Ormiah (127 samples). The clinical isolates were identified using conventional biochemical tests in the Department of Microbiology, Tabriz University of Medical Sciences, Iran. The bacteria were isolated from urine (n = 219), blood (n = 43), burn (n = 13), wound (n = 11), trachea (n = 7), sputum (n = 5), feces (n = 4), peritoneal (n = 3), and cerebrospinal fluid (n = 2). The samples were obtained from various wards including internal (n = 181), surgery (n = 55), ICU (n = 37), pediatric (n = 19), and the burn (n = 15) units.

Antimicrobial susceptibility testing

The disk diffusion method was used to determine the susceptibility of isolates to the following aminoglycosides: streptomycin (10 μg), gentamicin (10 μg), tobramycin (10 μg), kanamycin (30 μg), and amikacin (30 μg) (Mast; Chemical Co, England). The minimum inhibitory concentrations (MICs) for gentamicin, tobramycin, kanamycin, and amikacin (Sigma-Aldrich) were determined by the agar dilution method in accordance with the Clinical and Laboratory Standards Institute (CLSI).⁸ Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as quality control strains for antimicrobial susceptibility testing according to CLSI guideline.

Screening of 16S rRNA methylase genes

The isolates that were phenotypically resistant to at least one aminoglycoside were screened for the 16S rRNA methylase genes. The DNA was extracted by the boiling method as described previously.⁹ The PCR assay was performed using primers specific to armA, rmtA, rmtB, rmtC, rmtD, and npmA genes (Table 1). The PCR products were sequenced to confirm the presence of 16S rRNA methylase genes.

Table 1.

The Primers Used in This Study for Amplification of 16S rRNA Methylase Genes

Gene	Forward sequence [5′-3′]	Reverse sequence [5′-3′]	Amplicon size [bp]	Reference
armA	ATTTTAGATTTTGGTTGTGGC	ATCTCAGCTCTATCAATATCG	101	¹⁰
rmtA	AAACTATTCCGCATGGTTC	TCATGTACACAAGCTCTTTCC	88	¹⁰
rmtB	ACTTTTACAATCCCTCAATAC	AAGTATATAAGTTCTGTTCCG	171	^10,11
rmtC	CAGGGGTTCCAACAAGT	AGAGTATATAGCTTGAACATAAGTAGA	246	^10,11
rmtD	GGAAAAGGACGTGGACA	TCCATCGATTCCACAGG	171	^10,11
npmA	GGGCTATCTAATGTGGTG	TTTTTATTTCCGCTTCTTCGT	229	^10,11

Data analysis

The results were analyzed using the SPSS software for Windows (version 20; SPSS, Inc., Chicago, IL). The χ² test was used to examine the association of aminoglycosides resistance with genes encoding 16S rRNA methylase, and p ≤ 0.05 was considered the significance level.

Results

Bacterial isolates

Based on biochemical tests, the isolates were identified as E. coli (219 isolates), Klebsiella pneumoniae (57 isolates), Enterobacter cloacae (14 isolates), Proteus mirabilis (5 isolates), Klebsiella oxytoca (2 isolates), Morganella morgananii (2 isolates), Proteus vulgaris (2 isolates), Shigella flexneri (2 isolates), Shigella sonnei (2 isolates), Serratia marcescens (1 isolate), and Citrobacter freundii (1 isolate).

Antimicrobial susceptibility patterns

Of 307 Enterobacteriaceae isolates, 220 isolates (71.7%) were resistant to at least 1 aminoglycoside antibiotic. The resistance rates to streptomycin, gentamicin, tobramycin, kanamycin, and amikacin were 43%, 35.8%, 32.9%, 19.2%, and 4.2%, respectively. Twelve isolates (5.4%) were concomitantly resistant to all of the studied antibiotics. The agar dilution method results showed that 27 and 7 isolates were highly resistant (MIC ≥ 512 μg/mL) to kanamycin and amikacin, respectively. Furthermore, MIC ≥128 μg/mL was observed to tobramycin (three isolates) and gentamicin (two isolates). We found similar antibiotic resistance patterns in Tabriz and Ormiah.

The prevalence of 16S rRNA methylase genes

Amplification reactions were carried out in a Master gradient thermal cycler (Eppendorf), with the following cycling conditions: 5 min at 94°C for initial denaturation; 35 cycles of 30 sec at 94°C, 30 sec at the specific annealing temperature of each gene, and 30 sec at 72°C; and then a final extension for 5 min at 72°C. According to the RCR results, 40 isolates (18.2%, 40/220) were positive for 16S rRNA methylase genes. As shown in Table 2, armA and rmtC were the most prevalent 16S rRNA methylase genes. In our study, the rmtD gene was not found. Thirty-four isolates had one methylase gene and six isolates had two methylase genes among the gene-positive isolates. Only one combination pattern (armA+npmA) was recognized in six E. coli isolates. The methylase genes were detected only in E. coli [armA (n = 21), npmA (n = 8), rmtA (n = 2), rmtC (n = 2), and rmtB (n = 1)] and Klebsiella strains [rmtC (n = 8) and rmtB (n = 4)]. The frequency of armA, npmA, rmtA, rmtB, and rmtC genes in Tabriz and Ormiah cities was 15, 4, 1, 4, and 9 and 6, 4, 1, 1, and 1, respectively.

Table 2.

The Results of Susceptibility Testing in Positive 16S rRNA Methylase Gene Among Enterobacteriaceae Isolates

Genotype (n)	MIC (μg/mL)													G (n)		A (n)		T (n)		K (n)
Genotype (n)		0.5≥	1	2	4	8	16	32	64	128	256	512	≥1,024	S	NS	S	NS	S	NS	S	NS
armA (21)	Gm	—	1	7	6	4	3	—	—	—	—	—	—	16	5	19	2	12	9	16	5
	Amk	—	—	9	5	3	2	2	—	—	—	—	—
	Tob	3	6	—	1	8	2	1	—	—		—	—
	Km	—	—	1	8	5	1	—	3	1	2	—	2
rmtA (2)	Gm	—	—	1	—	1	—	—	—	—	—	—	—	1	1	2	—	1	1	1	1
	Amk	—	—	1	1	—	—	—	—	—	—	—	—
	Tob	1	—	—	—	1	—	—	—	—		—
	Km	1	—	—	—	—	—	—	1	—	—	—	—
rmtB (5)	Gm	—	—	1	2	—	2	—	—	—	—	—	—	2	3	5	—	2	3	1	4
	Amk	—	—	2	—	1	—	—	—	—	—	—	2
	Tob	1	—	—	—	2	2	—	—	—		—	—
	Km	—	—	—	—	—	1	—	1	—	—	—	3
rmtC (10)	Gm	—	—	—	—	—	6	1	2	—	1	—	—	—	10	5	5	2	8	2	8
	Amk	—	—	—	1	1	1	—	1	—	—	—	6
	Tob	—	—	—	—	2	3	2	1	2		—	—
	Km	—	—	—	—	—	—	—	2	—	—	1	7
npmA (8)	Gm	—	—	4	—	1	3	—	—	—	—	—	—	6	2	8	—	6	2	8	—
	Amk	—	—	5	3	—	—	—	1	—	—	—	—
	Tob	2	3	1	—	2	—	—	—	—	—	—	—
	Km	—	—	—	6	1	1	—	—	—	—	—	—

Gm, gentamicin; Amk, amikacin; Tob, tobramycin; Km, kanamycin; n, number of isolates; S, susceptible; NS, nonsusceptible. Break points according to CLSIs guidelines: amikacin and kanamycin [sensitive ≤16, intermediate 32, and resistance ≥64 μg/mL] and Gm and Tob [sensitive ≤4, intermediate 8, and resistance ≥16 μg/mL].

CLSI, Clinical and Laboratory Standards Institute; MIC, minimum inhibitory concentration.

Sixty percent of the isolates were positive for methylase genes and showed a high-level resistance to aminoglycosides. The high-level resistance was observed in the isolates with rmtC, rmtB, or armA genes. The highest rate of resistance was observed in amikacin and kanamycin (MIC ≥512 μg/mL). The rmtB gene had a statistically significant association with amikacin and kanamycin resistance individually (p < 0.01). The association between the presence of rmtC and resistance to gentamicin, tobramycin, kanamycin, or amikacin was also significant (p < 0.01). The distribution of methylase genes was different among the various wards and we found a statistically significant difference between rmtA and rmtB genes and wards (p ≤ 0.05). The majority of methylase genes were detected in urine and blood samples. Interestingly, Enterobacteriaceae isolated from cerebrospinal fluid, sputum, and feces samples were negative for methylase genes in this study (Table 3).

Table 3.

The Frequency of 16S rRNA Methylase Genes According to the Source of Infections and Different Wards

Sample/wards (n)	armA n (%)	rmtA n (%)	rmtB n (%)	rmtC n (%)	npmA n (%)
Urine (33)	17 (51.5)	1 (3.03)	2 (6.1)	7 (21.2)	6 (18.2)
Blood (7)	3 (42.8)	—	2 (28.6)	1 (14.3)	1 (14.3)
Peritonea (2)	1 (50)	—	1 (50)	—	—
Burn (2)	—	—	—	1 (50)	1 (50)
Trachea (1)	—	1 (100)	—	—	—
Internal (31)	15 (48.4)	—	3 (9.7)	6 (19.3)	7 (22.6)
Surgery (6)	3 (50)	1 (3.3)	—	2 (6.7)	—
Pediatric (4)	2 (50)	1 (25)	1 (25)	—	—
ICU (3)	1 (33.3)	—	1 (33.3)	1 (33.3)	—
Burn (2)	—	—	—	1 (50)	1 (50)

n, number and percentage of positive gene isolates.

Discussion

In our study, the occurrence of different 16S rRNA methylases genes and their correlation with aminoglycoside resistance in Enterobacteriaceae isolates were investigated.

Since aminoglycoside antibiotics are widely used for the treatment of life-threatening infections, resistance to these antibiotics is considered an important clinical problem.^12,13 The prevalence of aminoglycoside resistance in Enterobacteriaceae has changed in the past decades.¹⁴ In this study, approximately three-quarters (71.7%) of the isolates were resistant to aminoglycosides and 12.3% of isolates showed a high-level resistance phenotype. This resistance rate is much higher than the findings of a study in Australia.¹⁵ Based on the results, streptomycin showed the highest resistance rate (52.4%) and amikacin had the least resistance level (6.2%). Similar observations have also been observed in Spain.¹⁴

The high resistance levels to aminoglycosides encoded by 16S rRNA methylase genes on plasmids have been reported since 2003.^16,17 The 16S rRNA methylase genes have been found in Enterobacteriaceae, Acinetobacter baumannii, and P. aeruginosa around the world.¹ These genes are mainly located on plasmids and other mobile genetic elements such as transposon; thus, they may spread among Gram-negative bacteria through horizontal gene transfer.^1,18 In our study, 18.2% of the resistant isolates to aminoglycoside were positive for 16S rRNA methylase genes and six methylases' distribution patterns were identified with different levels of aminoglycoside resistance. We found the coexistence of two different methylase genes in six isolates. Similar observations with different gene combinations have also been reported in China.¹ The 16S rRNA methylase-producing isolates exhibit high-level resistance to all aminoglycosides through methylation of the aminoglycoside-binding site.¹⁸ Based on the results of 40 isolates that were positive for methylase genes, 24 isolates displayed high-level resistance to amikacin (8 isolates, MIC = 1,024 μg/mL), kanamycin (12 isolates, MIC ≥512 μg/mL), and gentamicin and tobramycin (4 isolates, MIC ≥128 μg/mL). Our results in comparison with a study conducted in Belgium⁹ indicate low resistance rates to gentamicin, tobramycin, and amikacin. In Belgium, 18 of 19 16S rRNA methylase-producing isolates showed high-level resistance to aminoglycoside and all of the isolates were resistant to gentamicin, tobramycin, and amikacin. In this study, a high-level resistance was observed in the isolates that harbored rmtC, rmtB, or armA genes. However, our findings showed a significant association between the increase of MIC and the presence of methylase genes, and similar observations have also been found in Belgium⁹ and Australia.¹⁵ In our study, the rmtA and npmA genes were detected in isolates with low-level resistance to aminoglycosides, MIC 16 ≥ and 8 ≥ , respectively. A possible explanation is that there is no relationship between an increased MIC and the presence of these genes, and/or the suboptimal expression of these genes depends on the distance from the promoter.

Among the 16S rRNA methylase family, ArmA and RmtB are dominant, which seems to be related to geographical conditions.^10,19 The armA and rmtC genes were the most prevalent in our study, which is similar to previous studies in Iraq and Iran.^20,21 The armA gene has been found in many species of Gram-negative bacteria in China, Japan, Korea, and Taiwan.¹ In this study, 9.5% of isolates were armA gene carriers. The rate of armA gene in our study is higher than the findings in France (1.3%),²² Belgium (0.12%),⁹ and China surveys (1.6%) and (0.9%),^1,23 and lower than another report from Iran (13.6%).²¹ This gene was detected in 0.9%, 2.3%, 2.3%, 4.1%, and 7.3% of isolates that were resistant to amikacin, gentamicin, kanamycin, tobramycin, and streptomycin, respectively. Similar to our study, armA was reported the most prevalent methylase gene in Massachusetts,¹⁹ Australia,¹⁵ Taiwan,²⁴ and Iran.²¹ The rmtB was the most prevalent methylase gene in China, whereas armA^6,23,25 and rmtA, rmtC, and rmtD genes were not detected in China. In contrast to previous reports,^19,20 no isolate was positive for the rmtD gene in our study. Also, compared with this study and the report from Iraq,²⁰ rmtC and npmA genes were not detected in Massachusetts and China studies. These differences may be due to geographical factors.

Even though we observed similar antibiotic resistance patterns in Tabriz and Ormiah, there were significant differences in the distribution patterns of 16S rRNA methylase genes between the two cities. The most prevalent methylase genes in Tabriz was armA and rmtC, and in Ormiah they were armA and npmA.

In this study, >50% of gene-positive isolates displayed high-level resistance to aminoglycosides. High-level resistance to aminoglycosides is clinically important. Similar to a previous study,¹⁴ we observed incompatibility (81.8%) between phenotype and genotype results that may refer to other resistance mechanisms such as AMEs reported previously²⁶: alteration in permeability, efflux pumps, and rare types of 16S rRNA.

Results showed that the prevalence of resistance to aminoglycosides is high in Iran, and 16S rRNA methylase genes are found among Enterobacteriaceae isolates. The high level of amikacin and kanamycin resistance in the isolates with rmtC and rmtB genes is remarkable.

Footnotes

Acknowledgment

This study (ID: 93-08) was financially supported by Infectious and Tropical Diseases Research Center, Tabriz University of Medical Sciences.

Disclosure Statement

No competing financial interests exist.

References

, Wang

, Pan

, Yao

, Chen

, Zhu

, Lou

, Hu

, Wu

, Zhang

, and Chen

2009. Prevalence of 16S rRNA methylase genes in Klebsiella pneumoniae isolates from a Chinese teaching hospital: coexistence of rmtB and armA genes in the same isolate. Diagn. Microbiol. Infect. Dis. 64:57–63.

Galimand

, Sabtcheva

, Courvalin

, and Lambert

2005. Worldwide disseminated armA aminoglycoside resistance methylase gene is borne by composite transposon Tn1548. Antimicrob. Agents Chemother. 49:2949–2953.

Aghazadeh

, Rezaee

M.A

, Nahaei

M.R

, Mahdian

, Pajand

, Saffari

, Hassan

, and Hojabri

2013. Dissemination of aminoglycoside-modifying enzymes and 16S rRNA methylases among Acinetobacter baumannii and Pseudomonas aeruginosa isolates. Microb Drug Resist. 19:282–288.

Gonzalez-Zorn

, Catalan

, Escudero

J.A

, Domínguez

, Teshager

, Porrero

, and Moreno

M.A.

2005. Genetic basis for dissemination of armA. J. Antimicrob. Chemother. 56:583–585.

Zacharczuk

, Piekarska

, Szych

, Zawidzka

, Sulikowska

, Wardak

, Jagielski

, and Gierczyński

2011. Emergence of Klebsiella pneumoniae coproducing KPC-2 and 16S rRNA methylase ArmA in Poland. Antimicrob. Agents Chemother. 55:443–446.

Yang

, Ye

, Wang

, Luo

, Zhang

, and Han

2011. Diverse prevalence of 16S rRNA methylase genes armA and rmtB amongst clinical multidrug-resistant Escherichia coli and Klebsiella pneumoniae isolates. Int. J. Antimicrob. Agents. 38:348–351.

Jafari

, Fallah

, Borhan

R.S

, Navidinia

, Karimi

, Tabatabaei

S.R

, and Hashemi

2013. The first report of CMY, aac (6′)-Ib and 16S rRNA methylase genes among Pseudomonas aeruginosa isolates from Iran. Arch. Pediatr. Infect. Dis. 1:109–112.

Clinical and Laboratory Standards Institute. 2014. Performance Standards for Antimicrobial Susceptibility Testing: Twentiethin Formational Supplement M100-S24. Vol 34. N 1. CLSI, Wayne, PA.

Bogaerts

, Galimand

, Bauraing

, Deplano

, Vanhoof

, De Mendonca

, Rodriguez-Villalobos

, Struelens

, and Glupczynski

2007. Emergence of ArmA and RmtB aminoglycoside resistance 16S rRNA methylases in Belgium. J. Antimicrob. Chemother. 59:459–464.

10.

Berçot

, Poirel

, and Nordmann

2011. Updated multiplex polymerase chain reaction for detection of 16S rRNA methylases: high prevalence among NDM-1 producers. Diagn. Microbiol. Infect. Dis. 71:442–445.

11.

Charfi-Kessis

, Mansour

, Khalifa

A.B

, Mastouri

, Nordmann

, Aouni

, and Poirel

2014. Multidrug-resistant Acinetobacter baumannii strains carrying the bla OXA-23 and the bla GES-11 genes in a neonatology center in Tunisia. Microb. Pathog. 74:20–24.

12.

Medboua-Benbalagh

, Touati

, Kermas

, Gharout-Sait

, Brasme

, Mezhoud

, Touati

, Guillard

, and de Champs

2017. Fecal carriage of extended-spectrum β-lactamase-producing Enterobacteriaceae strains is associated with worse outcome in patients hospitalized in the pediatric oncology unit of Beni-Messous Hospital in Algiers, Algeria. Microb. Drug Resist. 23:757–763.

13.

Chaudhary

, and Payasi

2014. Resistance patterns and prevalence of the aminoglycoside modifying enzymes in clinical isolates of gram negative pathogens. Global J. Pharmacol. 8:73–79.

14.

Miró

, Grünbaum

, Gómez

, Rivera

, Mirelis

, Coll

, and Navarro

2013. Characterization of aminoglycoside-modifying enzymes in Enterobacteriaceae clinical strains and characterization of the plasmids implicated in their diffusion. Microb. Drug Resist. 19:94–99.

15.

Guo

, Dillon

B.B

, Ginn

A.N

, Wiklendt

A.M

, Partridge

S.R

, and Iredell

J.R.

2014. Simple multiplex real-time PCR for rapid detection of common 16S rRNA methyltransferase genes. Diagn. Microbiol. Infect. Dis. 80:29–31.

16.

Galimand

, Courvalin

, and Lambert

2003. Plasmid-mediated high-level resistance to aminoglycosides in Enterobacteriaceae due to 16S rRNA methylation. Antimicrob. Agents Chemother. 47:2565–2571.

17.

Yokoyama

, Doi

, Yamane

, Kurokawa

, Shibata

, Shibayama

, Yagi

, Kato

, and Arakawa

2003. Acquisition of 16S r RNA methylase gene in Pseudomonas aeruginosa. Lancet. 362:1888–1893.

18.

Doi

, and Arakawa

2007. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin. Infect. Dis. 45:88–94.

19.

Fritsche

T.R.

, Castanheira

, Miller

G.H

, Jones

R.N

, and Armstrong

E.S.

2008. Detection of methyltransferases conferring high-level resistance to aminoglycosides in Enterobacteriaceae from Europe, North America, and Latin America. Antimicrob. Agents Chemother. 52:1843–1845.

20.

Al-kadmy

I.M.

, and Al-jubori

S.S.

2013. Distribution of aminoglycoside resistance mediated by 16S rRNA Methylation among IraqI Isolates of Escherichia coli and Pseudomonas aeruginosa. J. Biol. Agric. Healthc. l3:113–126.

21.

Ashrafian

, Fallah

, Hashemi

, Erfanimanesh

, Amraei

, and Tarashi

2015. First detection of 16S rRNA methylase and blaCTX-M-15 genes among Klebsiella pneumoniae strains isolated from hospitalized patients in Iran. Res. Mol. Med. 3:28–34.

22.

Berçot

, Poirel

, and Nordmann

2008. Plasmid-mediated 16S rRNA methylases among extended-spectrum β-lactamase-producing Enterobacteriaceae isolates. Antimicrob. Agents Chemother. 52:4526–4527.

23.

, Zhang

, Han

, Sun

, and Ni

2009. Plasmid-mediated 16S rRNA methylases in aminoglycoside-resistant Enterobacteriaceae isolates in Shanghai, China. Antimicrob. Agents Chemother. 53:271–272.

24.

Yan

J.J.

, Wu

J.J

, Ko

W.C

, Tsai

S.H

, Chuang

C.L

, Wu

H.M

, Lu

Y.J

, and Li

J.D.

2004. Plasmid-mediated 16S rRNA methylases conferring high-level aminoglycoside resistance in Escherichia coli and Klebsiella pneumoniae isolates from two Taiwanese hospitals. J. Antimicrob. Chemother. 54:1007–1012.

25.

Nordmann

, Poirel

, Toleman

M.A

, and Walsh

T.R.

2011. Does broad-spectrum β-lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria?. J. Antimicrob. Chemother. 66:689–692.

26.

Ghotaslou

, Yeganeh Sefidan

, Akhi

M.T

, Asgharzadeh

, and Mohammadzadeh Asl

2017. Dissemination of genes encoding aminoglycoside-modifying enzymes and armA among Enterobacteriaceae isolates in Northwest Iran. Microb. Drug Resist. 23:826–832.