Emergence of IncFIA Plasmid-Carrying bla NDM-1 Among Klebsiella pneumoniae and Enterobacter cloacae Isolates in a Tertiary Referral Hospital in Mexico

Abstract

The emergence of New Delhi metallo-β-lactamase 1 on carbapenemase-producing bacteria has raised a major worldwide public health concern. This study reports the dissemination of bla_NDM-1 in carbapenem-resistant isolates that caused nosocomial infections in a tertiary hospital in Mexico City. Seven Enterobacter cloacae and three Klebsiella pneumoniae nosocomial isolates from the same time period harbored the bla_NDM-1 gene. The resistance phenotype and the bla_NDM-1 gene were transferred through conjugative plasmids belonging to the incompatibility group IncFIA of 85, 101, and 195 kb in E. cloacae and 95 and 101 kb in K. pneumoniae isolates. Restriction fragment length polymorphism analysis showed that bla_NDM-1 was carried in similar plasmids with molecular sizes of 101 and 85 kb, each one in three isolates of E. cloacae and one of 101 kb on two isolates of K. pneumoniae. During a 9-month period, six of the seven isolates of E. cloacae analyzed harbored bla_NDM-1 and belonged to clone E1. Similarly, over a 5-month period, two of the three K. pneumoniae isolates that harbored bla_NDM-1 belonged to clone K1. These results demonstrate the horizontal transfer of bla_NDM-1 between different bacterial species, dissemination of clones with high levels of resistance to carbapenems, and underscore the need for heightened measures to control their further spread.

Introduction

New Delhi metallo-β-lactamase 1 (NDM-1) is one of the most recently discovered class B β-lactamases. Unlike class A, C, and D β-lactamases, NDM-1 has zinc ions in its active site and its greatest clinical significance lies in its ability to hydrolyze all β-lactam antimicrobials, except for monobactams.¹ NDM-1 was first described in a clinical isolate of Klebsiella pneumoniae in a 59-year-old male patient who returned to Sweden from India where he was hospitalized in 2008. This patient was colonized simultaneously with an NDM-1 strain of Escherichia coli in stools.²

The bla_NDM-1 genes are usually found in plasmids (55–500 kb) and are rarely integrated into the chromosome.³ They have a wide range of hosts and are easily transmitted by conjugation, which favors interspecies dispersion.^1,4 Evolution of NDM currently shows the identification of 19 variants of this enzyme in bacteria of food animal origin.^5,6 NDM-1 is found predominantly in Enterobacteriaceae and less frequently in Acinetobacter spp., Pseudomonas spp., Stenotrophomonas spp., Aeromonas spp., and Vibrio cholerae. This distribution reflects the association of bla_NDM-1 with promiscuous plasmids.^1,7

There are several reports from Mexico regarding the presence of NDM-1 in carbapenem-resistant clinical Enterobacteriaceae isolates, each one in different geographical areas of the country and only one in Mexico City.^8–13 The objective of this study was to investigate the occurrence of carbapenem-resistant K. pneumoniae and Enterobacter cloacae isolates in a tertiary care hospital in Mexico City and to characterize the genetic nature of carbapenem resistance.

Materials and Methods

Bacterial collection

Single nosocomial infection isolates of K. pneumoniae and E. cloacae were collected between February 2015 and January 2016 at Hospital Regional Gral. Ignacio Zaragoza of the Instituto de Seguridad y Servicios Sociales de los Trabajadores del Estado (ISSSTE) in Mexico City, a 360-bed tertiary referral hospital.

Susceptibility testing

Identification and antimicrobial susceptibility were carried out using the VITEK^® 2 system (Healthcare; BIOMÉRIEUX). Colistin susceptibility tests were performed by the broth microdilution method following guidelines of the Clinical and Laboratory Standards Institute (CLSI) and the European Committee on Antimicrobial Susceptibility Testing (EUCAST).^14,15 Metallo-β-lactamase (MBL) production in carbapenem-intermediate or -resistant isolates was determined by the disk diffusion test on agar using meropenem and imipenem with or without EDTA.¹⁶

Detection of genetic determinants of antimicrobial resistance

Using the Primer3 program, specific oligonucleotides were designed to determine, by means of PCR, the presence of bla_IMP, bla_VIM, bla_KPC, bla_OXA-40-like, and bla_NDM-1 genes (Table 1). Amplification of PCR products was carried out using the GoTaq^® Green Master Mix Kit (Promega, Madison, WI). The amplification conditions were as follows: one cycle at 95°C for 5 min, 35 cycles at 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min, and a final extension step at 72°C for 15 min. Amplification reactions were carried out using an iCycler (Bio-Rad^®, Hercules, CA) thermocycler and the resulting products were resolved by electrophoresis in 1% agarose gels at 120 V using a Power Station 300 chamber (Labnet International, Inc.). The mcr-1 gene was screened by PCR with the primers CLR5-F 5′-CGGTCAGTCCGTTTGTTC-3′ and CLR5-R 5′-CTTGGTCGGTCTGTAGGG-3′ described previously.¹⁷ Amplified fragments were purified and subjected to nucleotide sequencing at the Instituto de Biotecnología, Universidad Nacional Autónoma de México. Nucleotide sequence analysis was performed using the BLAST program of the National Center for Biotechnology Information.a

Table 1.

Primers Designed in This Study to Detect Carbapenem Resistance Genes

Primer	Sequence (5′→3′)	Gene	Amplicon size (bp)
IMP-FW	GCATTGCTACCGCAGCAGAGTCTTTG	bla _IMP	647
IMP-RV	GCTCTAATGTAAGTTTCAAGAGTGATGC	bla _IMP	647
VIM-FW	ATGTTAAAAGTTATTAGTAGTTTATTGG	bla _VIM	801
VIM-RV	CTACTCGGCGACTGAGCGATTTTTGTG	bla _VIM	801
KPC-Fw	CATCTCGGAAAAATATCTGACAACAGG	bla _KPC	504
KPC-Rv	CTCGCTGTACTTGTCATCCTTGTTAGG	bla _KPC	504
OXA-40-like-Fw	ATGAAAAAATTTATACTTCCTATATTCAGC	bla _OXA	827
OXA-40-like-Rv	TTAAATGATTCCAAGATTTTCTAGCGAC	bla _OXA	827
NDM-FW	AATGTCTGGCAGCACACTTCCTAT	bla _NDM	518
NDM-RV	GTAGTGCTCAGTGTCGGCATCACC	bla _NDM	518

bp, base pairs.

Plasmid analysis and conjugation assays

To identify whether the strains were carrying bla_NDM-1 in plasmids, the electrophoretic pattern of plasmids was determined using the Eckhardt technique.¹⁸ The bacterial artificial chromosomes of 67, 86, 101, 122, 145, and 195 Kb were used as molecular weight markers.¹⁹ The conjugation assays for horizontal transfer of carbapenem resistance were performed following the method described by Miller²⁰ using the rifampicin-resistant E. coli strain J53-2 as the recipient strain. Transconjugant strains were selected on Luria-Bertani agar supplemented with rifampicin (200 μg/mL) and imipenem (16 μg/mL) or meropenem (16 μg/mL) and tested for antimicrobial susceptibility. Plasmids of transconjugant strains were purified using the QIAGEN Plasmid Midi Kit (Qiagen, Hilden, Germany), following the manufacturer's specifications, and analyzed by restriction fragment length polymorphism (RFLP)²¹ with the restriction enzymes EcoRI and BglII. The percentage of similarity restriction profile was calculated using the Dice coefficient.²² Transconjugant plasmids with a Dice similarity coefficient >85% were considered as having the same restriction profile.

The incompatibility groups were determined using a PCR-based replicon typing method²³ on transconjugants with a single plasmid encoding bla_NDM-1.

Southern hybridization was performed in bla_NDM-1-positive isolates and its transconjugants using electrophoretic profiles of Eckhardt plasmids transferred to a nylon membrane and a nonradioactive probe of bla_NDM-1 (ECL direct nucleic acid labeling and detection system; GE Healthcare, Piscataway, NJ).

Pulsed-field gel electrophoresis

To evaluate clonality between bla_NDM-1-positive strains, genotyping of each of the isolates was carried out using pulsed-field gel electrophoresis (PFGE).²⁴ Chromosomal DNA of each strain was prepared as previously reported²⁵ and digested with Xba I restriction endonuclease (New England Biolabs, Beverly, MA). Restriction fragment was resolved in a GenePath System (Bio-Rad^®, Hercules, CA). The classification of isolates in clones was based on Tenover criteria.²⁶ The percentage of similarity profile was calculated using the Dice coefficient.²² Isolates with a Dice similarity coefficient >85% were considered as belonging to the same clone.

Results

Clinical isolates and antibiotic susceptibility

During the study period, we recovered a total of 27 K. pneumoniae and 12 E. cloacae isolates from nosocomial infections that caused mainly bacteremia, pneumonia, and wound infections. The majority of these isolates were multidrug resistant (Table 2).

Table 2.

Minimum Inhibitory Concentration Data of Antibiotics for Klebsiella pneumoniae and Enterobacter cloacae Isolates Investigated in This Study

Antibiotic	K. pneumoniae (n = 27)			E. cloacae (n = 12)			MIC range (μg/mL) Vitek
Antibiotic	MIC₅₀ (μg/mL)	MIC₉₀ (μg/mL)	R, %	MIC₅₀ (μg/mL)	MIC₉₀ (μg/mL)	R, %	MIC range (μg/mL) Vitek
Aztreonam	32	>64	92.6	>64	>64	75.0	≤1 to ≥64
Imipenem	0.25	16	11.1	16	32	75.0	≤1 to ≥4
Meropenem	0.06	16	11.1	16	32	58.3	≤1 to ≥4
Ceftriaxone	>64	>64	92.6	>64	>64	75.0	≤1 to ≥64
Cefepime	>64	>64	92.6	>64	>64	58.3	≤1 to ≥64
Ampicillin/sulbactam	>32	>32	92.3	N/D	N/D	IR	2/1 to 32/16
Piperacillin/tazobactam	32	>128	37	>128	>128	83.3	≤4/4 to ≥128/4
Gentamicin	>16	>16	51.6	<1	>16	50.0	≤1 to ≥16
Tobramycin	>16	>16	81.5	>16	>16	75.0	≤1 to ≥16
Amikacin	≤2	>64	14.8	16	>64	41.7	≤2 to ≥64
Ciprofloxacin	2	>4	44.4	>4	>4	58.3	≤0.25 to ≥4
Trimethoprim/sulfamethoxazole	>320	>320	88.9	<20	>320	50.0	20 to 320
Nitrofurantoin	128	128	66.7	>256	>256	58.3	≤16 to ≥512
Tigecycline	1	6	11.1	2	2	8.3	≤0.5 to ≥8
Colistin	<0.5	<0.5	11.1	<0.5	<0.5	0.0	≤0.5 to ≥16

IR, intermediate resistant; MIC, minimum inhibitory concentration; N/D, not determined; R, resistant.

Susceptibility results showed that 3/27 (11%) of K. pneumoniae and 7/12 (58%) of E. cloacae isolates were carbapenem resistant. Colistin resistance was observed only 3/42 (7%) K. pneumoniae. Three K. pneumoniae isolates and seven E. cloacae isolates were bla_NDM-1 positive, all of them were resistant to most antibiotics, including β-lactams (penicillin, carbapenems, cephalosporins, and monobactams), β-lactam combination agents, aminoglycosides, fluoroquinolones, sulfonamides, and trimethoprim (Table 3). Resistance to tigecycline was observed in 2/3 and 1/7 K. pneumoniae and E. cloacae bla_NDM-1-positive isolates, respectively. All bla_NDM-1-positive K. pneumoniae isolates were colistin resistant, while all bla_NDM-1-positive E. cloacae isolates were susceptible to it. The transconjugants that were obtained from K. pneumoniae expressed resistance to β-lactams and aminoglycosides, although at lower levels than the clinical isolates. As for E. cloacae transconjugants, five of the seven expressed resistance to β-lactams and aminoglycosides, while two were only β-lactam resistant.

Table 3.

Antimicrobial Susceptibility Patterns of Klebsiella pneumoniae and Enterobacter cloacae Positive for bla_NDM-1 and Their Transconjugants

Isolate	IPM	MEM	AMS	PTZ	CRO	CFZ	FEP	AZT	AMK	GEN	TOB	CIP	TGC	NIT	SXT	CL
Kpn 13	32	16	≥32	≥128	≥64	≥64	≥64	≥64	≥64	≥16	≥16	0.5	2	128	≥320	4
TcKpn 13	4	16	≥32	≥128	≥64	≥64	8	≤1	≥64	≥16	≥16	≤0.25	≤0.5	≤16	≤20	1
Kpn 182	32	16	≥32	≥128	≥64	≥64	≥64	≥64	≥64	≥16	≥16	≥4	≥8	128	≥320	4
TcKpn 182	4	16	≥32	≥128	≥64	≥64	16	≤1	≥64	≥16	≥16	≤0.25	≤0.5	≤16	≤20	1
Kpn 303	16	16	≥32	≥128	≥64	≥64	≥64	≥64	≥64	≥16	≥16	≥4	≥8	256	≥320	4
TcKpn 303	4	16	≥32	≥128	≥64	≥64	16	≤1	≥64	≥16	≥16	≤0.25	≤0.5	≤16	≤20	1
Ecl 48	32	32	ND	≥128	≥64	ND	≥64	≥64	≥64	≥16	≥16	≥4	2	256	≥320	1
TcEcl 48	4	16	ND	≥128	≥64	ND	32	≥64	≥64	≥16	≥16	≤0.25	2	≤16	≤20	0.5
Ecl 64	16	16	ND	≥128	≥64	ND	≥64	≥64	≥64	≥16	≥16	≥4	2	128	≥320	1
TcEcl 64	4	16	ND	≥128	≥64	ND	16	32	≥64	≥16	≥16	≤0.25	≤0.5	≤16	≤20	1
Ecl 123	32	32	ND	≥128	≥64	ND	≥64	≥64	≥64	≥16	≥16	≥4	2	256	≥320	1
TcEcl 123	4	16	ND	≥128	≥64	ND	≥64	≥64	≥64	≥16	≥16	2	≤0.5	≤16	≥320	1
Ecl 181	32	32	ND	≥128	≥64	ND	≥64	≥64	≥64	≥16	≥16	≥4	1	256	≥320	0.5
TcEcl 181	4	16	ND	≥128	≥64	ND	≥64	≥64	≥64	≥16	≥16	≤0.25	≤0.5	≤16	≤20	0.5
Ecl 234	16	32	ND	≥128	≥64	ND	≥64	≥64	≥64	≥16	≥16	≥4	2	128	≥320	1
TcEcl 234	4	16	ND	≥128	≥64	ND	16	32	≥64	≥16	≥16	≤0.25	≤0.5	≤16	≤20	1
Ecl 268	16	16	ND	≥128	≥64	ND	32	≥64	8	≥16	≥16	≥4	2	256	≤20	2
TcEcl 268	4	16	ND	≥128	≥64	ND	32	32	≤2	≤1	≤1	≤0.25	≤0.5	≤16	≤20	1
Ecl 338	32	32	ND	≥128	≥64	ND	≥64	≥64	≥64	≥16	≥16	≥4	2	256	≥320	2
TcEcl 338	4	16	ND	≥128	≥64	ND	16	32	≤2	≤1	≤1	≤0.25	≤0.5	≤16	≤20	1

AMK, amikacin; AMS, ampicillin–sulbactam; AZT, aztreonam; CRO, ceftriaxone; CFZ, cefazolin; CL, colistin; CIP, ciprofloxacin; Ecl, E. cloacae; FEP, cefepime; GEN, gentamicin; IPM, imipenem; Kpn, K. pneumoniae; MEM, meropenem; ND, not determined; NIT, nitrofurantoin; PTZ, piperacillin–tazobactam; Tc, transconjugant; TGC, tigecycline; SXT, trimethoprim–sulfamethoxazole; TOB, tobramycin.

The majority of bla_NDM-1-positive isolates were obtained in patients who were admitted in general surgery and orthopedic wards with four isolates from each ward, followed by the intensive care unit (ICU) with two isolates (Table 4).

Table 4.

Characteristics of bla_NDM-1-Producing Klebsiella pneumoniae and Enterobacter cloacae Isolates

Strain	Isolate date	Floor/Bed	Ward	Source isolation	Clone	Plasmid (kb)	Conjugant plasmid (kb)	Incompatibility group (Inc)
K. pneumoniae 13	February 6, 2015	8th/832	Surgical ward	Blood	K1	101, 180	101	IncFIA
K. pneumoniae 182	July 9, 2015	11th/1139	Orthopedic	Pleural fluid	K1	101, 180	101	IncFIA
K. pneumoniae 303	November 11, 2015	2nd/204	Intensive care unit	Blood	K2	95, >195	95	IncFIA
E. cloacae 48	March 13, 2015	2nd/205	Intensive care unit	Wound secretions	E1	101, 122	101	IncFIA
E. cloacae 64	March 23, 2015	7th/722	Surgical ward	Blood	E1	85, 122	85	IncFIA
E. cloacae 123	May 12, 2015	11th/1107	Orthopedic	Wound secretions	E2	195	195	IncFIA
E. cloacae 181	June 24, 2015	7th/733	Surgical ward	Catheter	E1	101, 122	101	IncFIA
E. cloacae 234	September 19, 2015	11th/1138	Orthopedic	Wound secretions	E1	40, 101, 122	101	IncFIA
E. cloacae 268	November 5, 2015	9th/916	Surgical ward	Blood	E1	85, 122, 145	85	IncFIA
E. cloacae 338	December 23, 2015	10th/1037	Orthopedic	Secretions	E3	85, 122, 145	85	IncFIA

Determination of carbapenemase and mcr-1 genes

PCR screening detected the bla_NDM-1 gene in all carbapenem-resistant K. pneumoniae and E. cloacae strains, three and seven, respectively. The bla_IMP, bla_VIM, bla_KPC, and bla_OXA-40-like genes were not detected by PCR in any of these strains. None of the three bla_NDM-1-positive and colistin-resistant K. pneumoniae isolates harbored mcr-1.

Plasmid analysis and conjugative experiments

The plasmid profiles of three K. pneumoniae and seven E. cloacae isolates that were positive for bla_NDM-1 harbored between one and three plasmids with sizes of 40, 85, 95, 101, 122, 145, 180, 195, and >195 kb, respectively (Table 4). Plasmids harboring bla_NDM-1 from all K. pneumoniae and E. cloacae isolates were successfully transferred to E. coli J53, transconjugants received only one plasmid (Fig. 1A upper, B upper, and Table 4). Acquisition of the bla_NDM-1 gene in all transconjugants was detected by PCR and corroborated by nucleotide sequencing. Phenotypic testing of transconjugants exhibited resistance to β-lactams and aminoglycosides (Table 3). Southern hybridization analysis with a bla_NDM-1-specific probe confirmed the location of bla_NDM-1 in the plasmid transferred by conjugation in all transconjugants (Fig. 1A lower, B lower). The plasmid incompatibility groups were identified in all transconjugants with bla_NDM-1-carrying plasmids and corresponded to the IncFIA group (Table 4).

FIG. 1.

Detection of bla_NDM-1 in conjugative plasmids of Klebsiella pneumoniae and Enterobacter cloacae isolates. (A) Upper: Electrophoretic patterns of plasmids from bla_NDM-1-producing K. pneumoniae (Kpn) and their transconjugants (TcKpn). (B) Upper: Electrophoretic patterns of plasmids from bla_NDM-1-producing E. cloacae (Ecl) and their transconjugants (TcEcl). (A, B) Lower: Corresponding southern hybridization with a bla_NDM-1-specific probe. BAC, bacterial artificial chromosomes.

RFLP profiles of the 10 conjugative plasmids that carry bla_NDM-1 revealed three different restriction profiles. Figure 2 shows the restriction profiles obtained from EcoRI-digested transconjugant plasmids. The restriction profile P1 contained five clusters; in this profile, two transconjugant plasmids with different sizes were grouped: 101 kb (TcEcl 48, TcEcl 181, TcEcl 234, TcKpn 182, TcKpn 13) and 85 kb (TcEcl 268, TcEcl 338, TcEcl 64). Unique profiles (P2 and P3) were also obtained from the transconjugant plasmids of 95 kb (TcKpn 303) and 195 kb (TcEcl 123), respectively (Fig. 2).

FIG. 2.

Dendrogram of EcoRI restriction patterns of IncFIA plasmid carrying bla_NDM-1 from 10 transconjugants. Three restriction profiles were identified (P1–P3). The dashed line represents the 85% similarity level used in cluster designation. TcKpn, transconjugant of K. pneumoniae; TcEcl, transconjugant of E. cloacae.

Genotyping

PFGE was performed with bla_NDM-1-positive strains. Isolates 13 and 182 of K. pneumoniae belonged to clone K1 (Fig. 3) and were isolated within a 5-month period from the general surgery and orthopedic wards, respectively (Table 4). Strain 303 of K. pneumoniae belonged to clone K2, which was obtained from the ICU. In the case of E. cloacae, five strains that belonged to clone E1 were isolated during a period of 9 months in the ICU, general surgery and orthopedic wards (Fig. 3 and Table 4).

FIG. 3.

Dendrogram represents the Dice similarity index of PFGE XbaI profiles for (A) NDM-1-producing K. pneumoniae isolates, clones K1 and K2, and (B) NDM-1-producing E. cloacae isolates, clones E1, E2, and E3. NDM-1, New Delhi metallo-β-lactamase 1; PFGE, pulsed-field gel electrophoresis.

Discussion

The emergence and global spread of multidrug-resistant Gram-negative bacteria constitute a serious threat to global public health. In particular, carbapenem-resistant Enterobacteriaceae isolates have been associated mainly with increased morbidity and mortality.²⁷ Transmissible carbapenem resistance in Enterobacteriaceae has been recognized for the last two decades and has recently been associated with NDM-type MBL.²⁷

Previous studies have identified bla_NDM-1 among clinical isolates of multidrug-resistant Enterobacteriaceae in Mexico City and in three states from distinct geographic regions in Mexico (Nuevo León, Jalisco, and Morelos).^8–13 In this study, we report the identification of NDM-1 in three K. pneumoniae isolates and seven E. cloacae isolates that caused nosocomial infections from patients in a Mexico City hospital. These isolates carried only carbapenemase-type bla_NDM-1 and did not contain the carbapenemase genes, bla_IMP, bla_VIM, bla_KPC, and bla_OXA-40-like. Although the presence of 19 NDM variants has been previously identified in different regions of the world,^5,6 in Mexico, only NDM-1-producing bacteria have been reported.^8–13

The antimicrobial susceptibility results of the first K. pneumoniae isolate carrying the bla_NDM-1 gene are indicative of multidrug resistance since it showed resistance to all β-lactams, aminoglycosides, nitrofurantoin, trimethoprim/sulfamethoxazole, and colistin and was susceptible only to tigecycline and ciprofloxacin (Table 3). The two isolates that were subsequently isolated were pandrug resistant. This pattern of pandrug resistance in Mexico has been recently reported by the SENTRY Antimicrobial Surveillance Program²⁸ and by Bocanegra-Ibarias.¹¹ Colistin resistance observed in this study is in keeping with the increased use of colistin for management of carbapenem-resistant, Gram-negative bacterial infections, which have been reported in several countries worldwide, including Mexico where two studies have reported the emergence of colistin-resistant K. pneumoniae.^11,29,30 The mutations in chromosomally mediated, two-component regulatory systems¹⁷ must be responsible for expression of the colistin resistance phenotype; for this reason, bla_NDM-1-positive colistin-resistant K. pneumoniae does not carry the mcr-1 gene, which is responsible for colistin resistance mediated by plasmids.

Transconjugants of K. pneumoniae acquired resistance to β-lactams and aminoglycosides, which indicates that the conjugative plasmids carrying bla_NDM-1 must carry genes of acetyltransferases (AAC), phosphotransferases (APH), or nucleotidyl transferases (ANT) that confer resistance to aminoglycosides and have been reported to be encoded in plasmids.^31,32 These results strongly suggest that resistance to the rest of the antibiotics, including resistance to colistin, is encoded in chromosomes.¹⁷ We observed resistance to β-lactams and aminoglycosides in five of the seven E. cloacae transconjugants and only to β-lactam in the other two isolates, which suggests that resistance to aminoglycosides could be localized at the chromosomes associated with methyltransferase ArmA or RmtB.^32,33

We found it noteworthy that K. pneumoniae and E. cloacae were harboring two to three large plasmids with great plasticity (one of them carrying bla_NDM-1), which allowed them to be transferred by conjugation. In Mexico, the genetic transfer of NDM-1 in K. pneumoniae and E. cloacae has been reported in conjugative plasmids from 101 to 150 kb.^9–11 In the present study, the transfer of NDM-1 was also carried out in plasmids of similar size; 95 and 101 kb in K. pneumoniae and 85 and 195 kb in E. cloacae.

Restriction analysis revealed that plasmids of 101 kb in two isolates of K. pneumoniae (13 and 182) and three E. cloacae isolates (48, 181, and 234) and the 85 kb plasmids in three E. cloacae isolates (64, 268, and 338) are strongly related since they showed the same restriction pattern P1, which can be considered as a single epidemic plasmid involved in the NDM-1 gene dissemination between K. pneumoniae and E. cloacae isolates. It is important to note that all these P1 plasmids as well as the plasmids with restriction patterns P2 and P3 belonged to the same incompatibility group IncFIA. IncFIA is a new plasmid incompatibility group identified among NDM-1-carrying Enterobacteriaceae in Mexico.^8–11

The temporal analysis on detection and distribution of the three NDM-1-producing K. pneumoniae isolates identified one of each isolate in a different hospital ward during a 10-month period. The first isolate (Kpn 13) was detected in February 2015 and the second (Kpn 182) in July 2015 and both belonged to the same clone K1. The antimicrobial susceptibility analysis showed that the first isolate was susceptible to ciprofloxacin and tigecycline, while the second was resistant to both antibiotics (Table 3). These results suggest that during the time that the bacteria persisted in the hospital, mechanisms of chromosomal resistance (mutations in gyrA and parC that confer resistance to quinolones^34,35 were activated and the mutation in the ramR repressor of the acrAB efflux pump that confers tigecycline resistance³⁶) occurred, which allowed it to become a pandrug-resistant strain. In addition, these two isolates harbored a similar conjugative plasmid P1.

With regard to NDM-1-producing E. cloacae isolates, the first isolate was detected in March 2015, 1 month after identifying the first isolation of NDM-1-producing K. pneumoniae. Five of the seven E. cloacae isolates corresponding to clone E1 were recovered from the ICU (one isolate), orthopedic service (one isolate), and surgical ward (three isolates), these last ones during a period of 9 months (Table 4). E. cloacae isolates 48, 181, and 234 belonged to the same E1 clone, carried a conjugative plasmid of similar size (101 kb), and had a similar enzyme restriction pattern P1. Although isolates 64 and 268 belonged to clone E1 and isolate 338 to clone E3, all harbored a conjugative plasmid of 85 kb, which showed a restriction pattern similar to P1. Isolate 123 was the only one of clone E2 in addition to carrying a large 195 kb conjugative plasmid with a P3 restriction pattern different from that of the other plasmids. These results indicate that (i) these clones can survive for long periods of time in the hospital environment, allowing the horizontal transfer of bla_NDM-1 to other bacteria that act as efficient donors and recipients,³⁷ and (ii) the transfer of bla_NDM-1 is carried out using similar or different plasmids.

The similarity between plasmids of 101 kb in the two isolates of K. pneumoniae 13 and 182 is consistent since both isolates also belong to the similar clone. Likewise, five E. cloacae isolates belonging to the same clone E1 had the identical restriction pattern of plasmid P1, three of them showed the same plasmid size of 101 kb, and two other isolates harbored a plasmid of 85 kb.

In our study, it was not possible to establish the direct epidemiological relationship between the patient–patient contacts to explain the direct transmission of NDM-1 carrier isolates, nor was a reservoir detected that could allow persistence of these strains for a long time in the hospital environment. However, we definitely documented the emergence, persistence, and dissemination of bla_NDM-1 carried in IncFIA plasmids among K. pneumoniae and E. cloacae isolates in this hospital environment in a relatively short period of time. These observations are of great concern not only because of the therapeutic implications of pandrug-resistant bacteria but also because they indicate a growing dispersion of these plasmids in Mexico. They also underscore the urgent need for implementing closer epidemiological surveillance and preventive measures among health personnel in this hospital to prevent dissemination of pandrug-resistant bacteria harboring bla_NDM-1.

Footnotes

Acknowledgments

This work was supported by Consejo Nacional de Ciencia y Tecnología, México, grant number PDCPN 247489 and Programa de Apoyo a Proyectos de Investigación e Innovación Tecnológica (PAPIIT) grant number IN221617 to María Dolores Alcántar Curiel. The authors are grateful to Ing. Omar Agni García from the Universidad Nacional Autónoma de México, Ciudad de México, for assistance with the graphic design.

Disclosure Statement

No competing financial interests exist.

References

Nordmann

, Poirel

, Walsh

T.R.

, and Livermore

D.M.

. 2011. The emerging NDM carbapenemases. Trends Microbiol. 19:588–595.

Yong

, Toleman

M.A.

, Giske

C.G.

, Cho

H.S.

, Sundman

, Lee

, and Walsh

T.R.

. 2009. Characterization of a new metallo-beta-lactamase gene, bla_NDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 53:5046–5054.

Kumarasamy

K.K.

, Toleman

M.A.

, Walsh

T.R.

, Bagaria

, Butt

, Balakrishnan

, Chaudhary

, Doumith

, Giske

C.G.

, Irfan

, Krishnan

, Kumar

A.V.

, Maharjan

, Mushtaq

, Noorie

, Paterson

D.L.

, Pearson

, Perry

, Pike

, Rao

, Ray

, Sarma

J.B.

, Sharma

, Sheridan

, Thirunarayan

M.A.

, Turton

, Upadhyay

, Warner

, Welfare

, Livermore

D.M.

, and Woodford

. 2010. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 10:597–602.

Kulkova

, Babalova

, Sokolova

, and Krcmery

. 2015. First report of New Delhi metallo-beta-lactamase-1-producing strains in Slovakia. Microb Drug Resist. 21:117–120.

Liu

, Li

, Wang

, Liu

, Ke

, Wang

, and Shen

. 2018. Novel variant of New Delhi metallo-beta-lactamase, NDM-20, in Escherichia coli. Front Microbiol. 9:248.

Ahmad

, Khalid

, Ali

S.M.

, and Khan

A.U.

. 2018. Occurrence of bla_NDM variants among Enterobacteriaceae from a neonatal intensive care unit in a Northern India Hospital. Front Microbiol. 9:407.

Walsh

T.R.

, Weeks

, Livermore

D.M.

, and Toleman

M.A.

. 2011. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis. 11:355–362.

Barrios

, Garza-Ramos

, Reyna-Flores

, Sanchez-Perez

, Rojas-Moreno

, Garza-Gonzalez

, Llaca-Diaz

J.M.

, Camacho-Ortiz

, Guzman-Lopez

, and Silva-Sanchez

. 2013. Isolation of carbapenem-resistant NDM-1-positive Providencia rettgeri in Mexico. J Antimicrob Chemother. 68:1934–1936.

Barrios

, Silva-Sanchez

, Reyna-Flores

, Sanchez-Perez

, Sanchez-Francia

, Aguirre-Torres

J.A.

, Sanchez-Rogel

, and Garza-Ramos

. 2014. Detection of a NDM-1-producing Klebsiella pneumoniae (ST22) clinical isolate at a pediatric hospital in Mexico. Pediatr Infect Dis J. 33:335.

10.

Torres-Gonzalez

, Bobadilla-Del Valle

, Tovar-Calderon

, Leal-Vega

, Hernandez-Cruz

, Martinez-Gamboa

, Niembro-Ortega

M.D.

, Sifuentes-Osornio

, and Ponce-de-Leon

. 2015. Outbreak caused by Enterobacteriaceae harboring NDM-1 metallo-beta-lactamase carried in an IncFII plasmid in a tertiary care hospital in Mexico City. Antimicrob Agents Chemother. 59:7080–7083.

11.

Bocanegra-Ibarias

, Garza-Gonzalez

, Morfin-Otero

, Barrios

, Villarreal-Trevino

, Rodriguez-Noriega

, Garza-Ramos

, Petersen-Morfin

, and Silva-Sanchez

. 2017. Molecular and microbiological report of a hospital outbreak of NDM-1-carrying Enterobacteriaceae in Mexico. PLoS One. 12:e0179651.

12.

Petersen-Morfin

, Bocanegra-Ibarias

, Morfin-Otero

, Garza-Gonzalez

, Perez-Gomez

H.R.

, Gonzalez-Diaz

, Esparza-Ahumada

, Leon-Garnica

, Amezcua-Salazar

, and Rodriguez-Noriega

. 2017. New Delhi metallo-beta-lactamase (NDM-1)-producing Klebsiella pneumoniae isolated from a burned patient. Am J Case Rep. 18:805–809.

13.

Aquino-Andrade

, Merida-Vieyra

, Arias de la Garza

, Arzate-Barbosa

, and De Colsa Ranero

. 2018. Carbapenemase-producing Enterobacteriaceae in Mexico: report of seven non-clonal cases in a pediatric hospital. BMC Microbiol. 18:38.

14.

CLSI. 2016. Performance Standards for Antimicrobial Susceptibility Twentieth Informational Supplement M100-S20. CLSI, Wayne, PA.

15.

EUCAST. 2017. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. Version, 71, pp. Available at www.eucast.org

16.

Alcantar-Curiel

M.D.

, Garcia-Torres

L.F.

, Gonzalez-Chavez

M.I.

, Morfin-Otero

, Gayosso-Vazquez

, Jarillo-Quijada

M.D.

, Fernandez-Vazquez

J.L.

, Giono-Cerezo

, Rodriguez-Noriega

, and Santos-Preciado

J.I.

. 2014. Molecular mechanisms associated with nosocomial carbapenem-resistant Acinetobacter baumannii in Mexico. Arch Med Res. 45:553–560.

17.

Liu

Y.Y.

, Wang

, Walsh

T.R.

, Yi

L.X.

, Zhang

, Spencer

, Doi

, Tian

, Dong

, Huang

, Yu

L.F.

, Gu

, Ren

, Chen

, Lv

, He

, Zhou

, Liang

, Liu

J.H.

, and Shen

. 2016. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 16:161–168.

18.

Eckhardt

1978. A rapid method for the identification of plasmid desoxyribonucleic acid in bacteria. Plasmid. 1:584–588.

19.

Gonzalez

, Santamaria

R.I.

, Bustos

, Hernandez-Gonzalez

, Medrano-Soto

, Moreno-Hagelsieb

, Janga

S.C.

, Ramirez

M.A.

, Jimenez-Jacinto

, Collado-Vides

, and Dávila

. 2006. The partitioned Rhizobium etli genome: genetic and metabolic redundancy in seven interacting replicons. Proc Natl Acad Sci U S A. 103:3834–3839.

20.

Miller

1992. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Cold Spring Harbor, New, York, pp. 82–85.

21.

P.L.

, Li

, Lo

W.U.

, Cheung

Y.Y.

, Lin

C.H.

, Sham

P.C.

, Cheng

V.C.

, Ng

T.K.

, Que

T.L.

, and Chow

K.H.

. 2012. Identification and characterization of a novel incompatibility group X3 plasmid carrying bla_NDM-1 in Enterobacteriaceae isolates with epidemiological links to multiple geographical areas in China. Emerg Microbes Infect. 1:e39.

22.

Dice

L.R.

1945. Measures of the amount of ecologic association between species. Ecology. 26:297–302.

23.

Carattoli

, Bertini

, Villa

, Falbo

, Hopkins

K.L.

, and Threlfall

E.J.

. 2005. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 63:219–228.

24.

Naas

, Levy

, Hirschauer

, Marchandin

, and Nordmann

. 2005. Outbreak of carbapenem-resistant Acinetobacter baumannii producing the carbapenemase OXA-23 in a tertiary care hospital of Papeete, French Polynesia. J Clin Microbiol. 43:4826–4829.

25.

Miranda

, Kelly

, Solorzano

, Leanos

, Coria

, and Patterson

J.E.

. 1996. Use of pulsed-field gel electrophoresis typing to study an outbreak of infection due to Serratia marcescens in a neonatal intensive care unit. J Clin Microbiol. 34:3138–3141.

26.

Tenover

F.C.

, Arbeit

R.D.

, Goering

R.V.

, Mickelsen

P.A.

, Murray

B.E.

, Persing

D.H.

, and Swaminathan

. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 33:2233–2239.

27.

Logan

L.K.

, and Weinstein

R.A.

. 2017. The epidemiology of carbapenem-resistant Enterobacteriaceae: the impact and evolution of a global menace. J Infect Dis. 215:S28–S36.

28.

Sader

H.S.

, Castanheira

, Farrell

D.J.

, Flamm

R.K.

, Mendes

R.E.

, and Jones

R.N.

. 2016. Tigecycline antimicrobial activity tested against clinical bacteria from Latin American Medical Centres: results from SENTRY Antimicrobial Surveillance Program (2011–2014). Int J Antimicrob Agents. 48:144–150.

29.

Y.M.

, Kim

A.J.

, and Lee

J.Y.

. 2014. Colistin resistance in Klebsiella pneumoniae. Int J Antimicrob Agents. 44:8–15.

30.

Garza-Ramos

, Barrios

, Reyna-Flores

, Sanchez-Perez

, Tamayo-Legorreta

, Ibarra-Pacheco

, Salazar-Salinas

, Nunez-Ceballos

, and Silva-Sanchez

. 2014. Characteristics of KPC-2-producing Klebsiella pneumoniae (ST258) clinical isolates from outbreaks in 2 Mexican medical centers. Diagn Microbiol Infect Dis. 79:483–485.

31.

, Xu

, Yang

, Liu

, Yang

, Wang

, Shen

, Zhou

, and Ma

. 2013. A high throughput multiplex PCR assay for simultaneous detection of seven aminoglycoside-resistance genes in Enterobacteriaceae. BMC Microbiol. 13:58.

32.

Ramirez

M.S.

, and Tolmasky

M.E.

. 2010. Aminoglycoside modifying enzymes. Drug Resist Updat. 13:151–171.

33.

Huang

, Dai

, Sun

, Zhang

, and Zhang

. 2012. Prevalence of plasmid-mediated quinolone resistance and aminoglycoside resistance determinants among carbapeneme non-susceptible Enterobacter cloacae. PLoS One. 7:e47636.

34.

Hooper

D.C.

, and Jacoby

G.A.

. 2015. Mechanisms of drug resistance: quinolone resistance. Ann N Y Acad Sci. 1354:12–31.

35.

Aldred

K.J.

, Kerns

R.J.

, and Osheroff

. 2014. Mechanism of quinolone action and resistance. Biochemistry. 53:1565–1574.

36.

, Ding

, Qian

, Xu

, Jiang

, Huang

, Ou

, Hu

, and Wang

. 2017. In vivo development of tigecycline resistance in Klebsiella pneumoniae owing to deletion of the ramR ribosomal binding site. Int J Antimicrob Agents. 50:523–528.

37.

Mathers

A.J.

, Peirano

, and Pitout

J.D.

. 2015. The role of epidemic resistance plasmids and international high-risk clones in the spread of multidrug-resistant Enterobacteriaceae. Clin Microbiol Rev. 28:565–591.