Characterization of Plasmid-Mediated Quinolone Resistance in Gram-Negative Bacterial Strains from Animals and Humans in China

Abstract

The aim of this study was to determine the molecular epidemiology of plasmid-mediated quinolone resistance (PMQR) determinants in Escherichia coli, Salmonella enterica (Salmonella spp.), Klebsiella pneumoniae, and Proteus mirabilis. Four hundred seventy-two nonrepetitive isolates were collected from different sources in China and screened for the presence of PMQR genes (PMQRs). Then, 49 PMQR producers were selected to study the coexistence of PMQRs and other resistance genes using whole-genome sequencing (WGS). High rates of resistance to tetracycline (93.4%), nalidixic acid (81.5%), and norfloxacin (65.8%) were observed. The predominant PMQRs were aac(6′)-Ib-cr (28.6%) and oqxAB (21.4%). The prevalence of PMQR determinants was significantly higher (p < 0.05) in E. coli from stockmen (55.9%, 19/34), pigs (51.1%, 70/137), and laying hens (43.1%, 28/65) than that from wild animals (21.7%, 5/23) and dairy cattle (20.1%, 5/24). WGS results showed that 89.8% of the PMQR-positive isolates co-harbored β-lactamase genes, with bla_CTX-M being the dominant β-lactamase gene. In K. pneumoniae, the coexistence rate of oqxAB and qnrB with fosA, bla_DHA-1, and bla_SHV was significantly higher than that in P. mirabilis and E. coli. In contrast, the coexistence of qnrD and bla_OXA-1 was more prominent (p < 0.001) in P. mirabilis than in the other two species. Particularly, oqxAB and mcr-1 had an obvious preference for E. coli than K. pneumonia and P. mirabilis (p < 0.001), which had not been reported in previous studies on the prevalence of PMQRs.

Introduction

Having broad-spectrum antimicrobial activity, fluoroquinolones were introduced into clinical practice for treating bacterial infections in the final two decades of the last century. However, with the increasing use of fluoroquinolones in clinical practice, quinolone resistance has reached disquieting dimensions worldwide.¹ It had been believed that quinolone resistance could only be brought about by chromosomal mutations, until a plasmid-mediated quinolone-resistant strain of Klebsiella pneumoniae was identified in 1998.² From then on, three plasmid-mediated quinolone resistance (PMQR) mechanisms have been described: (1) the Qnr proteins, including QnrA, QnrB, QnrS, QnrC, QnrD, and QnrVC (indicated in chronological order of their identification), which can protect the quinolone targets^1,3–6; (2) the aac(6′)-Ib-cr enzyme, which can acetylate aminoglycosides, ciprofloxacin, and norfloxacin^6,7; and (3) the plasmid-mediated efflux pumps OqxAB and QepA, related to reductions in fluoroquinolone susceptibility.^1,8–10 The expression of these PMQR genes (PMQRs) associated with chromosomal resistance mechanisms contributes to the increased level of quinolone resistance (high-level resistance) as well as the selection of resistant clones in Enterobacteriaceae.^6,11,12

To date, many investigations of the molecular epidemiology of PMQRs have been reported worldwide. Azargun et al. determined the prevalence of PMQRs in Enterobacteriaceae isolated from urinary tract infections, with the most common PMQR being aac(6′)-Ib-cr.¹³ Albornoz et al. conducted an analysis of the prevalence of PMQRs in 1,058 clinical Enterobacteriaceae strains, which showed an overall detection rate of 8.1% (4.6% for aac(6′)-Ib-cr; 3.9% for qnr genes; and 0.4% for oqxAB).¹⁴ However, few studies have been performed to investigate the coexistence of PMQRs with other resistance genes in the single isolates using next-generation sequencing. In addition, reports about PMQRs in different species and sources are rare, especially in wild animals. In our study, a total of 472 nonrepetitive isolates including four species of bacteria were collected from pigs, laying hens, dairy cattle, wild animals, and humans from 2008 to 2017 and screened for the presence of the PMQRs. Whole-genome sequencing of 49 PMQR-positive isolates was performed to have a better understanding of the coexistence and dissemination of drug-resistance genes.

Materials and Methods

Bacterial strains and DNA extraction

Four hundred seventy-two nonrepetitive isolates (283 Escherichia coli, 40 Salmonella spp., 52 Klebsiella pneumoniae, and 97 Proteus mirabilis) isolated from animals (pigs, laying hens, dairy cattle, and wild animals) and humans (stockmen of pig farms) were collected from 2008 to 2017 in China (Table 1). All the isolates were presumptively identified through phenotypic methods, including colony morphology on MacConkey Agar or Eosin-Methylene Blue Agar, and Gram staining. And the identification of these isolates was later confirmed with BD Phoenix-100 diagnostic systems (Sparks, MD). The genomic DNA of all strains was extracted with bacterial genomic DNA kit (CWBIO, China) and stored at −20°C.

Table 1.

Bacterial Strains Isolated from 2008 to 2017

Source	Species ^a	No. of strains	Note
Humans	Escherichia coli	34	Fecal sample of healthy stockmen of pigs.
Humans	Salmonella sp.	8	Fecal sample of healthy stockmen of pigs.
Pigs	E. coli	137	Fecal sample, liver, lung, or small intestine of healthy pigs from 98 pig farms in 23 different provinces of China.
	Salmonella sp.	12
	Klebsiella pneumoniae	52
	Proteus mirabilis	43
Laying hens	E. coli	65	Fecal sample, liver, lung, or small intestine of healthy laying hens from 15 laying hen farms in 12 different provinces of China.
	Salmonella sp.	16
	P. mirabilis	54
Wild animals	E. coli	23	Fecal samples of 10 kinds of healthy wild animals in Sichuan provinces of China.^b
Wild animals	Salmonella sp.	4
Dairy cattle	E. coli	24	Mastitis or milk samples of healthy dairy cattle from Sichuan provinces of China.

All the isolates were presumptively identified through phenotypic methods, including colony morphology on MacConkey Agar or Eosin-Methylene Blue Agar, and Gram staining. And, the identification of these isolates was later confirmed with BD Phoenix-100 diagnostic systems (Sparks, MD).

These wild animals are giant pandas, tigers, black bears, giraffes, spotted deer, wolfs, Rhinopithecus roxellana, red slender loris, elephants, and wild boars.

Antimicrobial susceptibility tests

The susceptibility of all the isolates to 17 antimicrobials was determined through the standard Kirby–Bauer disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines.¹⁵ The following antimicrobial disks from Oxoid Ltd. (Basingstoke, United Kingdom) were used: cefazolin (30 μg), cefoxitin (30 μg), ceftazidime (30 μg), ceftriaxone (30 μg), cefotaxime (30 μg), imipenem (10 μg), aztreonam (30 μg), cefepime (30 μg), tetracycline (30 μg), nalidixic acid (30 μg), norfloxacin (10 μg), ciprofloxacin (5 μg), ofloxacin (5 μg), levofloxacin (5 μg), enrofloxacin (5 μg), gentamicin (10 μg), and amikacin (30 μg). E. coli ATCC25922 and K. pneumoniae ATCC700603 were used as quality control strains.

PCR amplification and sequencing

All isolates were screened for eight PMQRs (qnrA, qnrB, qnrS, qnrC, qnrD, qepA, oqxAB, and aac(6′)-Ib-cr) by PCR with the gene-specific primers listed in Table 2.^1,16–18 All PCR experiments were performed at least twice, and all PCR amplicons were sequenced by Shanghai Sangon Bioengineering Co., Ltd.

Table 2.

Primers Used in the Study

Target genes	Primers sequence 5′→3′	References
qnrA1-6	Forward: ACGCCAGGATTTGAGTGAC	Peymani et al.¹⁷
qnrA1-6	Reverse: CCAGGCACAGATCTTGAC	Peymani et al.¹⁷
qnrB1-3,5,6,8	Forward: GGCACTGAATTTATCGGC	Peymani et al.¹⁷
qnrB1-3,5,6,8	Reverse: TCCGAATTGGTCAGATCG	Peymani et al.¹⁷
qnrB4	Forward: AGTTGTGATCTCTCCATGGC	Peymani et al.¹⁷
qnrB4	Reverse: CGGATATCTAAATCGCCCAG	Peymani et al.¹⁷
qnrS1-2	Forward: CCTACAATCATACATATCGGC	Peymani et al.¹⁷
qnrS1-2	Reverse: GCTTCGAGAATCAGTTCTTGC	Peymani et al.¹⁷
aac(6′)-Ib-cr	Forward: TTGCGATGCTCTATGAGTGGCTA	Park et al.¹⁶
aac(6′)-Ib-cr	Reverse: CTCGAATGCCTGGCGTGTTT	Park et al.¹⁶
qepA	Forward: CGTGTTGCTGGAGTTCTTC	Yu et al.¹⁸
qepA	Reverse: CTGCAGGTACTGCGTCATG	Yu et al.¹⁸
qnrD	Forward: CGAGATCAATTTACGGGGAATA	Yu et al.¹⁸
qnrD	Reverse: AACAAGCTGAAGCGCCTG	Yu et al.¹⁸
qnrC	Forward: GGGTTGTACATTTATTGAATCG	Rodriguez-Martinez et al.¹
qnrC	Reverse: CACCTACCCATTTATTTTCA	Rodriguez-Martinez et al.¹
oqxAB	Forward: GACGACAAAGCGGTACTGAC	Rodriguez-Martinez et al.¹
oqxAB	Reverse: GTCTCGGCAATCACTTTCGG	Rodriguez-Martinez et al.¹

Next-generation sequencing and corresponding analyses

To determine the coexistence of PMQRs and other resistance genes in single isolates, next-generation sequencing on Illumina^® HiSeq high-throughput sequencing platform at the Gene Bang Technology Co., Ltd. (Chengdu, China) was randomly performed on 49 PMQR-positive isolates (15 E. coli, 17 P. mirabilis, and 17 K. pneumoniae). The 2 × 150 bp paired-end DNA library was prepared with an average fragment length of 400 bp. After sequencing, raw sequences were processed to remove low-quality reads and adapters using the program FASTX-trimmer and trimmomatic version 0.32. Clean reads were preassembled using Velvet (Version 1.2.07). The antibiotic resistance genes were identified by ResFinder. (Given the low PMQR-positive rates in Salmonella spp., species was not selected for next-generation sequencing and subsequent analysis.)

Statistical analysis

Differences in proportions were compared through χ² tests. All tests of significance were two-tailed, and a value of p < 0.05 was considered statistically significant. The relationship between antibiotic resistance genes and species was assessed with PAST version 1.3.6.26. Statistical analysis was performed on SPSS version 19.0.

Results

Antimicrobial susceptibility

Resistance rates to 17 antimicrobials of all 472 isolates from 5 different sources can be seen in Table 3. High resistance rates to tetracycline (93.4%), nalidixic acid (81.5%), and norfloxacin (65.8%) were detected, and low resistance rates to aztreonam (17.2%), ceftriaxone (17.5%), and amikacin (19.1%) were observed. Statistics showed that, except ceftriaxone, there was no significant difference in the resistance rates of human strains and pig strains to other 16 antibiotics. In addition, the average resistance rates in isolates from human, pigs, laying hens, wild animals, and dairy cattle were 58.6%, 53.1%, 41.03%, 14.6%, and 24.5%, respectively. More importantly, the resistance rates to quinolone antibiotics of isolates from stockmen, pigs and laying hens range from 44.4% to 95.2%, whereas it was 3.7% to 58.3% for isolates from wild animals and dairy cattle.

Table 3.

Rates of Resistance to Antimicrobial Agents of All the Isolates

Antimicrobial agent	Humans (n = 42), %	Pigs (n = 244), %	Laying hens (n = 135), %	Wild animals (n = 27), %	Dairy cattle (n = 24), %	Total (n = 472), %
Aztreonam (30 μg)	31.0	22.1	8.1	3.7	8.3	17.19
Ceftriaxone (30 μg)	40.5	17.4	15.6	0.0	8.3	17.54
Amikacin (30 μg)	33.3	24.1	10.4	0.0	12.5	19.11
Imipenem (10 μg)	33.3	31.8	11.1	3.7	4.2	23.03
Cefepime (30 μg)	38.1	40.5	14.1	7.4	16.7	29.74
Ceftazidime (30 μg)	45.2	36.4	5.9	0.0	4.2	24.77
Cefoxitin (30 μg)	47.6	35.4	20.7	11.1	12.5	29.81
Ciprofloxacin (5 μg)	52.4	59.5	50.4	3.7	4.2	50.29
Cefotaxime (30 μg)	52.4	44.6	34.8	7.4	8.3	38.57
Levofloxacin (5 μg)	66.7	70.8	47.4	14.8	20.8	58.13
Enrofloxacin (5 μg)	69.0	72.8	44.4	7.4	12.5	57.61
Gentamicin (10 μg)	66.7	50.8	31.9	18.5	25.0	43.81
Norfloxacin (10 μg)	71.4	69.2	73.3	22.2	25.0	65.79
Ofloxacin (5 μg)	71.4	63.6	45.2	11.1	16.7	53.75
Cefazolin (30 μg)	47.6	47.7	51.1	25.9	37.5	47.14
Nalidixic acid (30 μg)	95.2	81.5	88.9	37.0	58.3	81.48
Tetracycline (30 μg)	97.6	96.4	95.6	44.4	87.5	93.41
Total	58.59	53.1	41.03	14.59	24.54

Prevalence of PMQR determinants

The prevalence of PMQRs in this study is given in Table 4. In 472 isolates, the total detection rate of PMQRs was 41.5% (196/472), and they were isolated from E. coli (44.9%, 127/283), K. pneumoniae (46.2%, 24/52), P. mirabilis (41.2%, 40/97), and Salmonella spp. (12.5%, 5/40). In total, the most prevalent PMQR gene was aac(6′)-Ib-cr (28.6%, 135/472), which included 87 (30.7%) E. coli, 27 (27.8%) P. mirabilis, 16 (30.8%) K. pneumoniae, and 5 (12.5%) Salmonella spp. isolates.

Table 4.

Prevalence of Plasmid-Mediated Quinolone Resistance Genes in Isolates from Different Species and in Escherichia coli from Different Sources

Bacterial strains	No. (%) of isolates with detected PMQR gene							Total in every species, n (%)
Bacterial strains	qnrA	qnrB	qnrS	qnrD	qepA	oqxAB	aac(6′)-Ib-cr	Total in every species, n (%)
Escherichia coli (n = 283)	17 (6.0)	33 (11.7)	26 (9.2)	34 (12.0)	7 (2.5)	82 (28.3)	87 (30.7)	127 (44.9)
Klebsiella pneumoniae (n = 52)	2 (3.8)	21 (40.4)	3 (5.8)	0 (0.0	1 (1.9)	18 (34.6)	16 (30.8)	24 (46.2)
Salmonella spp. (n = 40)	0 (0.0)	2 (5.0)	1 (2.5)	0 (0.0)	0 (0.0)	1 (2.5)	5 (12.5)	5 (12.5)
Proteus mirabilis (n = 90)	1 (1.0)	4 (4.1)	2 (2.1)	22 (22.7)	0 (0.0)	0 (0.0)	27 (27.8)	40 (41.2)
Total (n = 472)	20 (4.2)	60 (12.7)	32 (6.8)	56 (11.8)	8 (1.7)	101 (21.4)	135 (28.6)	196 (41.5)

E. coli strains from different sources	qnrA	qnrB	qnrS	qnrD	qepA	oqxAB	aac(6′)-Ib-cr	Total in every sources
Humans (n = 34)	3 (8.8)	5 (14.7)	4 (11.8)	8 (23.5)	1 (2.9)	8 (23.5)	17 (40.5)	19 (55.9)
Pigs (n = 137)	10 (7.6)	17 (13.0)	14 (10.7)	18 (13.7)	4 (3.1)	48 (36.6)	48 (36.6)	70 (51.1)
Laying hens (n = 65)	3 (4.2)	9 (12.7)	6 (8.5)	5 (7.0)	2 (2.8)	22 (31.0)	15 (21.1)	28 (43.1)
Wild animals (n = 23)	1 (4.3)	2 (8.7)	1 (4.3)	2 (8.7)	0 (0.0)	2 (8.7)	4 (17.4)	5 (21.7)
Dairy cattle (n = 24)	0 (0.0)	0 (0.0	1 (4.2)	1 (4.2)	0 (0.0)	2 (8.3)	3 (12.5)	5 (20.1)
Total (n = 283)	17 (6.0)	33 (11.7)	26 (9.2)	34 (12.0)	7 (2.5)	82 (29.0)	87 (30.7)	127 (44.9)

PMQR, plasmid-mediated quinolone resistance.

The predominant PMQRs in 283 E. coli were aac(6′)-Ib-cr (30.7%) and oqxAB (28.3%). While in P. mirabilis, aac(6′)-Ib-cr (27.8%) and qnrD (22.7%) were more prevalent than in the two other species. In K. pneumoniae, qnrB (40.4%), oqxAB (34.6%) and aac(6′)-Ib-cr (30.8%) were more prevalent than in P. mirabilis and E. coli. The qnrA, qnrB, and qepA genes were absent in Salmonella spp., and neither qepA nor oqxAB was detected in P. mirabilis. In addition, the qnrD gene, which has just emerged in E. coli and P. mirabilis, showed detection rates of 12.0% and 22.7%, respectively. About 21.4% of the 472 isolates possessed a PMQR determinant in the form of oqxAB, which was mostly carried by E. coli and K. pneumoniae. Compared with the other three species, the detection rate of PMQRs was lower in Salmonella spp.

The detection rates of PMQR determinants in E. coli isolates from stockmen, pigs, laying hens, wild animals, and dairy cattle were 55.9%, 51.1%, 43.1%, 21.7%, and 20.1%, respectively. There were significantly more prevalent PMQRs (p < 0.05) in E. coli from human, pigs, and laying hens than that from wild animals and dairy cattle. The prevalence of PMQRs in E. coli from different sources indicated that aac(6′)-Ib-cr, oqxAB, and qnrD genes were more prevalent in humans, whereas aac(6′)-Ib-cr and oqxAB were more prevalent in pigs.

Genomic characterization of PMQR-producing isolates

All the 49 sequenced PMQR-positive isolates carried genes that conferred showing resistance to at least 10 antimicrobial agents, except for 1 E. coli isolate that only carried qnrS1 and catA2 genes. In general, the detection rate of genes encoding phenicol (95.9%, 47/49) was the highest, followed by tetracycline resistance genes (93.9%, 46/49), sulfonamide resistance genes (93.9%, 46/49), and aminoglycoside-encoding genes (91.8%, 45/49).

The coexistence of PMQRs and other genes in different species is shown in Fig. 1. In total, the coexistence of extended-spectrum β-lactamases (ESBLs) and PMQRs was identified in 44 isolates, which were widely distributed among different species and sources. Data showed that the PMQR-positive isolates, with a detection rate of 89.8%, also harbored β-lactamase genes (bla_OXA-1, bla_CTX-M, bla_TEM, bla_SHV-1B, and bla_DHA-1). In particular, all qnrB-positive isolates harbored bla_SHV-1B and/or bla_DHA-1 genes. The presence of the PMQRs showed a strong correlation with the prevalence of β-lactamase genes. In addition, the coexistence of PMQRs and other resistance genes varies significantly in different species. In K. pneumoniae, oqxAB and qnrB coexisted more with fosA, bla_DHA-1, and bla_SHV-1B than in the other two species (p < 0.001). It is also showed that most qnrB-positive isolates harbored bla_DHA-1 (76.5%, 13/17), bla_CTX-M (47.1%, 8/17), bla_TEM-1B (58.8%, 10/17), and fosA (94.1%, 16/17) genes. In particular, compared with K. pneumonia and P. mirabilis, oqxAB and mcr-1 have an obvious preference for E. coli (p < 0.001), where 8 of 11 isolates harbored the mcr-1 gene. The co-occurrence of qnrD and bla_OXA-1 in P. mirabilis was significantly greater than in the other two species (p < 0.001). The co-occurrence of these genes may lead to the persistence and co-selection of PMQRs under selective pressure imposed by the use of colistin, β-lactam, or fosfomycin.

FIG. 1.

The relationship between antibiotic resistance genes and species. As shown in this figure, the genes msr(E), bla_DHA-1,bla_SHV, bla_TEM, fosA, qnrB, and oqxAB have an obvious preference for Klebsiella pneumonia (p < 0.001), genes mcr-1 and bla_CTX-M are coexisted in Escherichia coli (p < 0.001), and bla_OXA and qnrD are preferred to Proteus mirabilis than the other two species(p < 0.001). At the same time, genes aac(6′)-Ib-cr, ARR-3, aph(3′)-Ia, and drfA had no significant difference among the strains because the distribution was relatively uniform; and genes floR, qnrA1, qepA, sul, and tet had no significant difference among the isolates in terms of the low distribution.

Discussion

To understand the antibiotic susceptibility of these specific isolates, the antibiotic susceptibility phenotypes of a collection of K. pneumoniae, E. coli, Salmonella spp., and P. mirabilis recovered from five different origins were also evaluated. Antimicrobial susceptibility testing in this study confirmed that the occurrence of resistance was significantly lower in isolates from wild animals than that from humans and food-producing animals (p < 0.05). Although the resistance rate in wild animals in our study is considerably low as in previous reports,¹⁹ it can still be a serious problem when particular living environments and daily medications are taken into account.

Although PMQR determinants were generally considered to confer low-level resistance,^11,12 the prevalence of PMQRs in food-producing animal isolates increased over time.²⁰ Our study showed that the prevalence of PMQR determinants in 472 isolates was 41.5%, at a medium and high level in similar articles. For example, research showed that of the 2,297 E. coli isolates randomly collected from animals, food, and humans from 2004 to 2011, 43.6% harbored at least one PMQR gene.²⁰ And, Chen et al. showed PMQRs were present in 281 isolates (27.5%).²¹ In our study, the overall prevalence of PMQRs was significantly higher (p < 0.001) in K. pneumoniae (46.2%, 24/52), E. coli (44.9%, 127/283), and P. mirabilis (41.2%, 40/97) than that in Salmonella spp. (12.5%, 5/40). The results are in stark contrast to the report by Veldman et al., which identified PMQR determinants in 59% of the Salmonella isolates and 15% of the E. coli isolates selected.²² The contrasting results of the two studies may be due to differences in the living environments and geographical regions where the studies were conducted.²³

The PMQR-positive E. coli isolated from different sources showed that the overall prevalence of PMQR determinants was high in stockmen (55.9%, 19/34) and pigs (51.1%, 70/137), followed by laying hens (43.1%, 28/65), and relatively low prevalence of PMQRs was found in isolates from wild animals (21.7%, 5/23) and dairy cattle (20.1%, 5/24). The high detection rate of PMQRs in humans found in our research is contrary to previous studies, in which detection rates were 14.3% and 14.0% in humans (healthy volunteers or patients).^20,21 This may be explained by two factors: pig farms represent a repository of resistant genes due to the widespread use of antimicrobial agents in animal feed, resulting in the high prevalence of PMQRs in pigs²⁴; the exposure of stockmen to the pig farm environment that harbors many resistant bacteria. The data in our study support the above hypothesis because the detection rates of PMQRs in pigs and humans are similar. Although norfloxacin and ofloxacin were forbidden in food animal since 2015 by the Ministry of Agriculture of China (MOA), ciprofloxacin is still used as human and veterinary medicine and enrofloxacin is also used in veterinary,²⁵ which may be the reason why the prevalence of PMQRs in isolates from humans, pigs, and laying hens are high. The prevalence of PMQRs in isolates (51.1%) from pigs is higher than that from laying hens (43.1%), which can be explained from the fact that pig feeds had higher content of antimicrobial than chicken feeds.²⁶ What is more, the presence of PMQRs in laying hens and pigs were higher than that in dairy cattle (Table 4). Considering the lower breeding density and longer marketing period of dairy cattle, this may be caused by the lower usage of antibiotics in dairy cattle farms than that in poultry and pig farms.^27,28

The most frequently found gene in this study was aac(6′)-Ib-cr (135/472, 28.6%), which is different from previous reports. Studies over the past few years showed that the qnrB gene with multiple subtypes has replaced aac(6′)-Ib-cr as the major PMQR gene.²⁹ There are also reports that oqxAB is the dominant PMQR gene in E. coli,³⁰ while in our study, oqxAB gene (101/472, 21.4%) was found to be widely distributed in both K. pneumoniae and E. coli. This can be interpreted in two aspects. First, with the spread of drug resistance genes among strains, there are regional differences in the prevalence of PMQRs and nonuniform distribution of the genes.²³ Second, the low-adaptive cost of oqxAB-positive strains allows the gene to be transferred and spread in gram-negative bacteria, especially in K. pneumoniae, making this organism as a potential reservoir. It is well documented that there was a high prevalence of the OqxAB efflux pump in ESBL-producing K. pneumoniae (usually 70% or more).³¹

About 89.8% of the sequenced PMQR-positive isolates co-harbored β-lactamase genes. The dominant β-lactamase gene in this study was bla_CTX-M gene (61.4%, 27/44) (especially bla_CTX-M-65). In contrast to other studies, the coexistence of oqxAB, qnrB, and bla_SHV were the most widely distributed resistance genotypes. Li et al. showed the occurrence of the coexistence of bla_CTX-M, qnrS, and aac(6′)-Ib-cr and the coexistence of bla_TEM-1, qnrS, and aac(6′)-Ib-cr.³² It has been documented that the most frequently detected resistance genotype was bla_TEM-1, bla_CTX-M-3, qnrS1, and oqxAB, which was observed in 23 E. coli isolates.³³ However, the coexistence of PMQRs and other resistance genes varied significantly in different species. In particular, oqxAB and mcr-1 had an obvious preference for E. coli, with simultaneous detection rates being higher in E. coli than in K. pneumonia and P. mirabilis, which has not been reported in previous studies on the prevalence of PMQRs (p < 0.001).

In all 11 oqxAB-positive E. coli isolates, 8 isolates harbored the mcr-1 gene. The presence of oqxAB, bla_CTX-M, and mcr-1 together in E. coli was significantly more frequent than in the two other species (p < 0.001). It is well known that the bacteria carrying mcr-1 gene are resistant to polymyxin, and this gene was found to be colocalized with other antibiotic resistance genes, raising the possibility of the emergence of superbugs with pan-drug resistance.³⁴ Thus, the phenomenon of oqxAB, mcr-1, and bla_CTX-M colocating in the same E. coli isolate is a particularly serious problem, which may bring about a severe economic crisis and pose a threat to human health because these genes are prone to transfer to human pathogens through the food chain. In addition, a K. pneumoniae carrying 44 drug resistance genes was isolated from pigs in this study. All these serve as a warning for the prudent use of antibiotics and the need for more attention on quinolone resistance.

Footnotes

Acknowledgments

This work was supported by the National Key Research and Development Program of China (2016YFD0501608), the general program of the National Natural Science Foundation of China (31572547 and 31572548), Special Fund for Agro-scientific Research in the Public Interest of China (grant 201403054), and Project supported by Science and Technology Support Program of Sichuan Province, China (2018JY0572 and 2018HH0027).

Disclosure Statement

No competing financial interests exist.

References

Rodriguez-Martinez

J.M.

, Machuca

, Cano

M.E.

, Calvo

, Martinez-Martinez

, and Pascual

. 2016. Plasmid-mediated quinolone resistance: two decades on. Drug Resist. Updat. 29:13–29.

Martinez-Martinez

, Pascual

, and Jacoby

G.A.

. 1998. Quinolone resistance from a transferable plasmid. Lancet, 351:797–799.

Hata

, Suzuki

, Matsumoto

, Takahashi

, Sato

, Ibe

, and Sakae

. 2005. Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother. 49:801–803.

Jacoby

G.A.

, Walsh

K.E.

, Mills

D.M.

, Walker

V.J.

, Oh

, Robicsek

, and Hooper

D.C.

. 2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother. 50:1178–1182.

Wang

, Guo

, Xu

, Wang

, Ye

, Wu

, Hooper

D.C.

, and Wang

. 2009. New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother. 53:1892–1897.

Jacoby

G.A.

2018. Study of plasmid-mediated quinolone resistance in bacteria. Methods Mol. Biol. 1703:317–325.

Robicsek

, Strahilevitz

, Jacoby

G.A.

, Macielag

, Abbanat

, Park

C.H.

, Bush

, and Hooper

D.C.

. 2006. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 12:83–88.

Yamane

, Wachino

, Suzuki

, Kimura

, Shibata

, Kato

, Shibayama

, Konda

, and Arakawa

. 2007. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob. Agents Chemother. 51:3354–3360.

Bialek-Davenet

, Lavigne

J.P.

, Guyot

, Mayer

, Tournebize

, Brisse

, Leflon-Guibout

, and Nicolas-Chanoine

M.H.

. 2015. Differential contribution of AcrAB and OqxAB efflux pumps to multidrug resistance and virulence in Klebsiella pneumoniae. J. Antimicrob. Chemother. 70:81–88.

10.

Brooks

L.E.

, Ul-Hasan

, Chan

B.K.

, and Sistrom

M.J.

. 2018. Quantifying the evolutionary conservation of genes encoding multidrug efflux pumps in the ESKAPE pathogens to identify antimicrobial drug targets. mSystems, 3:pii: e00024-18.

11.

Ferreira

J.C.

, Penha Filho

R.A.C.

, Kuaye

A.P.Y.

, Andrade

L.N.

, Berchieri Junior

, and Darini

. 2018. Identification and characterization of plasmid-mediated quinolone resistance determinants in Enterobacteriaceae isolated from healthy poultry in Brazil. Infect. Genet. Evol. 60:66–70.

12.

Poirel

, Cattoir

, and Nordmann

. 2012. Plasmid-mediated quinolone resistance; interactions between human, animal, and environmental ecologies. Front. Microbiol. 3:24.

13.

Azargun

, Sadeghi

M.R.

, Soroush Barhaghi

M.H.

, Samadi Kafil

, Yeganeh

, Ahangar Oskouee

, and Ghotaslou

. 2018. The prevalence of plasmid-mediated quinolone resistance and ESBL-production in Enterobacteriaceae isolated from urinary tract infections. Infect. Drug Resist. 11:1007–1014.

14.

Albornoz

, Lucero

, Romero

, Quiroga

M.P.

, Rapoport

, Guerriero

, Andres

, Rodriguez

, Galas

, Centron

, Corso

, and Petroni

. 2017. Prevalence of plasmid-mediated quinolone resistance genes in clinical Enterobacteria from Argentina. Microb. Drug Resist. 23:177–187.

15.

Clinical and Laboratory Standards Institute (CLSI). 2010. Performance Standards for Antimicrobial Susceptibility Testing: Twentieth Informational Supplement. M100-S20 CLSI, Wayne, PA.

16.

Park

C.H.

, Robicsek

, Jacoby

G.A.

, Sahm

, and Hooper

D.C.

. 2006. Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother. 50:3953–3955.

17.

Peymani

, Farivar

T.N.

, Najafipour

, and Mansouri

. 2016. High prevalence of plasmid-mediated quinolone resistance determinants in Enterobacter cloacae isolated from hospitals of the Qazvin, Alborz, and Tehran provinces, Iran. Rev. Soc. Bras. Med. Trop. 49:286–291.

18.

, Jiang

, Fu

, Liu

, Xu

, Ji

, and Zhou

. 2015. Detection of extended-spectrum beta-lactamase and plasmid-mediated quinolone resistance determinants in Escherichia coli isolates from retail meat in China. J. Food Sci. 80:M1039–M1043.

19.

Seinige

, Von Altrock

, and Kehrenberg

. 2017. Genetic diversity and antibiotic susceptibility of Staphylococcus aureus isolates from wild boars. Comp. Immunol. Microbiol. Infect. Dis. 54:7–12.

20.

Yang

, Zeng

, Rao

, Chen

, He

, Lv

, Wang

, Zeng

, Feng

, and Liu

J.H.

. 2014. The association between occurrence of plasmid-mediated quinolone resistance and ciprofloxacin resistance in Escherichia coli isolates of different origins. Vet. Microbiol. 170:89–96.

21.

Chen

, Zhang

, Pan

, Yin

, Pan

, Gao

, and Jiao

. 2012. Prevalence of qnr, aac(6′)-Ib-cr, qepA, and oqxAB in Escherichia coli isolates from humans, animals, and the environment. Antimicrob. Agents Chemother. 56:3423–3427.

22.

Veldman

, Cavaco

L.M.

, Mevius

, Battisti

, Franco

, Botteldoorn

, Bruneau

, Perrin-Guyomard

, Cerny

, De Frutos Escobar

, Guerra

, Schroeter

, Gutierrez

, Hopkins

, Myllyniemi

A.L.

, Sunde

, Wasyl

, and Aarestrup

F.M.

. 2011. International collaborative study on the occurrence of plasmid-mediated quinolone resistance in Salmonella enterica and Escherichia coli isolated from animals, humans, food and the environment in 13 European countries. J. Antimicrob. Chemother. 66:1278–1286.

23.

Yanat

, Rodriguez-Martinez

J.M.

, and Touati

. 2017. Plasmid-mediated quinolone resistance in Enterobacteriaceae: a systematic review with a focus on Mediterranean countries. Eur. J. Clin. Microbiol. Infect. Dis. 36:421–435.

24.

Shi

, and Wang

. 2018. [Antibiotic resistance in environment of animal farms]. Sheng Wu Gong Cheng Xue Bao, 34:1234–1245. [In Chinese.]

25.

Zhang

, Zhang

, Zou

, Yang

, Li

, Wang

, Yu

, and Zhang

. 2017. Occurrence, distribution and ecological risks of fluoroquinolone antibiotics in the Dongjiang River and the Beijiang River, Pearl River Delta, South China. Bull. Environ. Contam. Toxicol. 99:46–53.

26.

Nhung

N.T.

, Cuong

N.V.

, Thwaites

, and Carrique-Mas

. 2016. Antimicrobial usage and antimicrobial resistance in animal production in Southeast Asia: a review. Antibiotics (Basel) 5. pii:E37.

27.

Qian

, Gu

, Sun

, Wang

X.J.

, Su

J.Q.

, and Stedfeld

. 2018. Diversity, abundance, and persistence of antibiotic resistance genes in various types of animal manure following industrial composting. J. Hazard. Mater. 344:716–722.

28.

Wang

, Guo

, Yan

, Wang

, Chen

, Ge

, and Ye

. 2016. A Comprehensive analysis on spread and distribution characteristic of antibiotic resistance genes in livestock farms of Southeastern China. PLoS One, 11:e0156889.

29.

Das

, Natarajan

, and Mandal

. 2016. The emergence of quinolone resistant Shigella sonnei, Pondicherry, India. PLoS One, 11:e0160290.

30.

Liu

B.T.

, Liao

X.P.

, Yang

S.S.

, Wang

X.M.

, Li

L.L.

, Sun

, Yang

Y.R.

, Fang

L.X.

, Li

, Zhao

D.H.

, and Liu

Y.H.

. 2012. Detection of mutations in the gyrA and parC genes in Escherichia coli isolates carrying plasmid-mediated quinolone resistance genes from diseased food-producing animals. J. Med. Microbiol. 61,(Pt 11)::1591–1599.

31.

Rodriguez-Martinez

J.M.

, Diaz de Alba

, Briales

, Machuca

, Lossa

, Fernandez-Cuenca

, Rodriguez Bano

, Martinez-Martinez

, and Pascual

. 2013. Contribution of OqxAB efflux pumps to quinolone resistance in extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae. J. Antimicrob. Chemother. 68:68–73.

32.

, Wang

, Feng

, Li

, Wu

, Wang

, Ruan

, and Zeng

. 2014. Prevalence and characteristics of extended-spectrum beta-lactamase and plasmid-mediated fluoroquinolone resistance genes in Escherichia coli isolated from chickens in Anhui province, China. PLoS One, 9:e104356.

33.

Wang

, He

, Han

, Wang

, Foley

S.L.

, Yang

, Wan

, Shen

, and Wu

. 2012. Prevalence of ESBLs and PMQR genes in fecal Escherichia coli isolated from the non-human primates in six zoos in China. Vet. Microbiol. 159:53–59.

34.

Zhang

, Seward

C.H.

, Wu

, Ye

, and Feng

. 2016. Genomic insights into the ESBL and MCR-1-producing ST648 Escherichia coli with multi-drug resistance. Sci. Bull. 61:875–878.