Plasmid-Mediated Colistin Resistance in Escherichia coli O157:H7 Cattle and Sheep Isolates and Whole-Genome Sequence of a Colistin-Resistant Sorbitol Fermentative Escherichia coli O157:H7

Abstract

The aims of this study were to investigate the plasmid-mediated colistin resistance genes (mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5), phenotypic colistin resistance in Escherichia coli O157:H7⁺/H7⁻ strains isolated from cattle and sheep, and whole-genome sequence (WGS) analysis of colistin-resistant sorbitol fermentative E. coli O157:H7. According to the results, 5 of the 49 isolates were found to harbor mcr-2 and/or mcr-3 genes. Three isolates, including a sorbitol fermentative E. coli O157:H7, were found phenotypically resistant to colistin with a minimum inhibitory concentration value of 128 μg/mL. The genome of sorbitol fermentative E. coli O157:H7 did not show 100% similarity to any of the other genome sequences found in the universal genome database. It has also been determined that this isolate carried 62 different antimicrobial resistance genes. This is the first report of plasmid-mediated mcr-2 and mcr-3 genes carrying E. coli O157:H7 from cattle and sheep isolates and WGS of a colistin-resistant sorbitol fermentative E. coli O157:H7. Findings of this study indicate that cattle and sheep can be an important source of colistin resistance in E. coli O157:H7, and slaughterhouse wastewater might be a significant route for dissemination of the plasmid-mediated colistin genes. Therefore, the use of colistin in veterinary medicine should be restricted to reduce the development of resistance. Also it may be necessary to review the non-sorbitol fermentation-based isolation protocol for not missing the sorbitol fermentative E. coli O157:H7 in epidemiological studies.

Introduction

Colistin is one of the last-lines of defense against gram-negative bacteria which belong to the class of polymyxins originates from Paenibacillus polymyxa.¹ It shows its mechanism of action by deterioration of lipopolysaccharides molecules in the bacterial membranes.^2,3 Although colistin was not a preferred treatment option in human medicine because of its kidney toxicity, it has become a last resort antibiotic in the past decade due to the increase of multidrug-resistant gram-negative bacteria such as Pseudomonas aeruginosa, Acinetobacter baumannii, and Enterobacteriaceae.^4,5 Commercial colistin consisting antibiotics are commonly used in veterinary medicine particularly to treat gastrointestinal infections in cattle, sheep, and poultry worldwide and in Turkey.⁶

Ruminants are considered to be the most important reservoir of Escherichia coli O157:H7, which is still a big concern for human health in many countries by causing hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS).⁷ The use of antibiotics for the treatment of E. coli O157:H7 infections in humans is controversial due to their potential of promoting Shiga-like toxin (Stx) release, which may result in serious kidney failure. However, Percivalle et al. reported that colistin protects the Vero (African green monkey kidney) cells from E. coli O157:H7 by inhibiting cytotoxin release and binding endotoxins.⁸ Therefore, colistin can be a significant alternative for the treatment of E. coli O157:H7 infections.

Since the first plasmid-mediated colistin resistance gene (mcr-1) in E. coli was identified in 2015⁹ in E. coli, four more mcr genes (mcr-2, mcr-3, mcr-4, and mcr-5) were discovered in E. coli strains obtained from animals.^10–13 These reports clearly indicate that colistin resistance E. coli is increasing and there is an urgent need to reevaluate the use of colistin globally for the protection of this last resort antibiotic. In this study, investigation of plasmid-mediated colistin resistance genes (mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5), phenotypic colistin resistance in E. coli O157:H7⁺/H7⁻ strains isolated from cattle and sheep and whole-genome sequence (WGS) analysis of colistin-resistant sorbitol fermentative E. coli O157:H7 were reported.

Materials and Methods

Isolates

Forty-nine E. coli O157 isolates were included in the study. The isolates were part of a collection obtained from 720 cattle (240 rectoanal mucosal swap [RAMS], 240 carcass sponge [CS], 240 bile), 200 sheep (100 RAMS, 100 CS), and 24 slaughterhouse wastewater samples. Among these 49 isolates, 39 were E. coli O157:H7⁺ and 10 were E. coli O157:H7⁻. One of 39 E. coli O157:H7⁺ and 3 of 10 E. coli O157:H7⁻ were sorbitol fermentative.^14,15

Screening of mcr genes

DNA extraction was performed as described before.¹⁶ The presence of mcr-1,⁹ mcr-2,¹⁰ mcr-3,¹¹ mcr-4,¹² and mcr-5⁴ genes was screened by PCR (Table 1).

Table 1.

Primers Used for Screening mcr Genes

Gene	Primer	bp	References
mcr-1	F: CGGTCAGTCCGTTTGTTC	309	⁹
mcr-1	R: CTTGGTCGGTCTGTAGGG	309	⁹
mcr-2	F: TGTTGCTTGTGCCGATTGGA	567	¹⁰
mcr-2	R: AGATGGTATTGTTGGTTGCTG	567	¹⁰
mcr-3	F: TTGGCACTGTATTTTGCATTT	542	¹¹
mcr-3	R: TTAACGAAATTGGCTGGAACA	542	¹¹
mcr-4	F: ATTGGGATAGTCGCCTTTTT	487	¹²
mcr-4	R: TTACAGCCAGAATCATTATCA	487	¹²
mcr-5	F: ATGCGGTTGTCTGCATTTATC	1,644	⁴
mcr-5	R: CATTGTGGTTGTCCTTTTCTG	1,644	⁴

Phenotypic colistin resistance profile

Minimum inhibitory concentrations (MIC) of the isolates were determined by broth microdilution method using the FRCOL (Sensititre FRCOL; Thermo Scientific, West Sussex, United Kingdom) following the manufacturer's instructions. The range of colistin in the test was between 0.12 and 128 μg/mL and the results were interpreted according to the The European Committee on Antimicrobial Susceptibility Testing (Table 2). MIC values higher than 2 μg/mL were defined as resistant.

Table 2.

Colistin Resistance Profile of Escherichia coli O157 Isolates

Isolate code	mcr-1	mcr-2	mcr-3	mcr-4	mcr-5	MIC (μg/mL)
210KB^a	−	−	+	−	−	1.0
25KA^b	−	−	−	−	−	128
34GA^c	−	−	+	−	−	0.5
44GA^c	−	+	+	−	−	0.25
44KA^c	−	−	−	−	−	>128
68GA^c	−	+	+	−	−	0.5
168KA^c	−	+	+	−	−	128
Other 42 isolates	−	−	−	−	−	≥0.5

E. coli O157:H7⁻.

Sorbitol fermentative E. coli O157:H7⁺.

Non-sorbitol fermentative E. coli O157:H7⁺.

MIC, minimum inhibitory concentrations.

Whole-genome sequencing of strain 25KA

DNA isolation

Sorbitol fermentative E. coli O157:H7 strain 25KA colonies were suspended in 25 μL of buffer (200 mM Tris-HCl, pH 8.0; 20 mM ethylenediaminetetraaceticacid; 10% Triton X-100) and 10 μL of lysozyme (200 μg/μL) and incubated at 37°C for 15 min. Then, 250 μL of lysis buffer (0.5 μg/μL) proteinase K, 5% Tween 20, 3 M guanidiniumthiocyanate, and 20 mM Tris-HCl (pH 8.0) were added to the sample. After incubation at 70°C for 15 min and then at 95°C for 5 min, 250 μL of isopropanol was added and centrifuged through silica columns. DNAs bound to the silica column were washed twice with buffer (20 mM NaCl, 2 mM Tris-HCl pH 7.5, and 80% v/v ethanol). The DNA elution was carried out with 50 μL of 100 mM Tris-HCl (pH 8.0) and the DNA stored at −20°C until use. DNA's amount and purity were determined by spectrophotometric measurements at 260 and 280 nm.

Genome sequencing with next-generation sequencing

Sequencing libraries were prepared using the TruSeq Nano DNA Low Throughput Library Prep Kit (Cat. no. 20015964; Illumina). Quality control in terms of size distribution and quantity of the libraries was performed by 2100 Bioanalyzer (Agilent Technologies). For normalization, the DNA buffer was diluted to 10 nM using dilution buffer (Tris-HCl 10 mM, pH 8.5, 0.1% Tween 20). The cBot 2 system (Illumina) was used to construct clusters with bridge amplification, and the IlluminaHiSeq 2500 platform was used for sequencing.

The comparison of the obtained genome sequence with the other genome sequences in the gene bank was performed with “MicrobialGenomeBlast” (www.ncbi.nlm.nih.gov) tool. CVTree3 program was used for phylogenetic dendrogram with similar genomes (tlife.fudan.edu.cn/cvtree/). Finally, analysis of antibiotic resistance and secondary metabolite gene clusters was completed using the antiSMASH (antismash.secondarymetabolites.org) database and program. In addition, antibiotic resistance genes were analyzed using the Antibiotic Resistance Genes Database and the search tool with the BLAST algorithm.

Dataset accession

Individual data sequence is available at GenBank under BioProject accession number ID PRJNA503568. Review link to the data: https://ncbi.nlm.nih.gov/nuccore/CP033605.1

Results

Among 49 E. coli O157 isolates 5 (10.2%; 5/49) of them harbored at least one mcr gene. Two were positive only for mcr-3, one of them was E. coli O157:H7⁻ (210KB), and the other was E. coli O157:H7⁺ (34GA). In three of the E. coli O157:H7 isolates (44GA, 68GA, and 168KA) both mcr-2 and mcr-3 genes were detected (Table 2). None of the sorbitol fermentative isolates harbored any of the mcr genes. However, one sorbitol fermentative E. coli O157:H7 isolate (25KA) was found to be resistant to colistin with an MIC value of 128 μg/mL.

According to the microdilution test results, all of the isolates were susceptible to colistin except three E. coli O157:H7 strains. The MIC values of susceptible isolates were ≤1.0 μg/mL. Despite the absence of mcr genes in 25KA and 44KA strains, they showed resistance to colistin with 128 and >128 μg/mL, respectively. Only strain 168KA was found to be resistant to colistin and harbored mcr-2 and mcr-3 genes at the same time (Table 2).

In this study, the WGS of the sorbitol fermentative E. coli O157:H7 25KA was analyzed (Fig. 1). The reasons for choosing this strain were (i) the sorbitol fermentative character along with being phenotypically resistant to colistin, and (ii) the absence of any of the mcr genes. The obtained sequence was compared with all other genome sequences found in the universal genome database. It was certainly determined that the genome belonged to the E. coli species.

FIG. 1.

Circular representation of the complete genome sequence of sorbitol-positive Escherichia coli O157:H7 strain 25KA.

As this is the first report of a sorbitol fermentative E. coli O157:H7, the genome of 25KA does not show 100% similarity to any of the other genome sequences found in the universal genome database (Fig. 2). The highest similarity was found with E. coli O157:H7 strain EC4115 with 99%. In addition, it has been determined that this isolate carries 62 different antimicrobial resistance genes, which makes it a superbug with resistance to several antibiotic groups, including β-lactams, aminoglycosides, fluoroquinolones, tetracyclines, macrolides, phenicols, and penams (or penicillins, which are a subclass of the broader β-lactam family of antibiotics and related compounds) (Table 3).

FIG. 2.

Phylogenetic dendrogram of the genomes of E. coli O157:H7 strain 25KA and other E. coli species.

Table 3.

Antibiotic Resistance Genes of Escherichia coli O157:H7 str. TR01 According to the Antibiotic Resistance Genes Database

ARO term	Detection criteria	AMR gene family	Drug class	Resistance mechanism
evgA	Protein homolog model	Major facilitator superfamily (MFS) antibiotic efflux pump, resistance-nodulation-cell division (RND) antibiotic efflux pump	Tetracyclines, macrolides, fluoroquinolones, penams	Antibiotic efflux
mdtH	Protein homolog model	MFS antibiotic efflux pump	Fluoroquinolones	Antibiotic efflux
emrK	Protein homolog model	MFS antibiotic efflux pump	Tetracyclines	Antibiotic efflux
msbA	Protein homolog model	ATP-binding cassette (ABC) antibiotic efflux pump	Nitroimidazole	Antibiotic efflux
emrB	Protein homolog model	MFS antibiotic efflux pump	Fluoroquinolones	Antibiotic efflux
Escherichia coli acrA	Protein homolog model	RND antibiotic efflux pump	Rifamycin, glycylcycline, tetracyclines, fluoroquinolones, cephalosporin, triclosan, phenicols, penam	Antibiotic efflux
mdtG	Protein homolog model	MFS antibiotic efflux pump	Fosfomycin	Antibiotic efflux
baeR	Protein homolog model	RND antibiotic efflux pump	Aminoglycosides, aminocoumarin antibiotic	Antibiotic efflux
emrR	Protein homolog model	MFS antibiotic efflux pump	Fluoroquinolones	Antibiotic efflux
marA	Protein homolog model	RND antibiotic efflux pump, general bacterial porin with reduced permeability to beta-lactams	Rifamycin, monobactam, tetracyclines, fluoroquinolones, cephalosporin, cephamycin, carbapenem, glycylcycline, phenicols, penem, triclosan, penam	Reduced permeability to antibiotic, antibiotic efflux
mdtN	Protein homolog model	MFS antibiotic efflux pump	Acridine dye, nucleoside	Antibiotic efflux
mdtE	Protein homolog model	RND antibiotic efflux pump	Fluoroquinolones, penam, macrolides	Antibiotic efflux
PmrF	Protein homolog model	pmr phosphoethanolamine transferase	Peptide antibiotic	Antibiotic target alteration
bacA	Protein homolog model	Undecaprenyl pyrophosphate related proteins	Peptide antibiotic	Antibiotic target alteration
Escherichia coli marR mutant conferring antibiotic resistance	Protein overexpression model	RND antibiotic efflux pump	Rifamycin, glycylcycline, tetracyclines, fluoroquinolones, cephalosporin, triclosan, phenicols, penam	Antibiotic target alteration, antibiotic efflux
CRP	Protein homolog model	RND antibiotic efflux pump	Penam, fluoroquinolones, macrolides	Antibiotic efflux
emrA	Protein homolog model	MFS antibiotic efflux pump	Fluoroquinolones	Antibiotic efflux
acrD	Protein homolog model	RND antibiotic efflux pump	Aminoglycoside antibiotic	Antibiotic efflux
mdtB	Protein homolog model	RND antibiotic efflux pump	Aminocoumarin antibiotic	Antibiotic efflux
evgS	Protein homolog model	MFS antibiotic efflux pump, RND antibiotic efflux pump	Tetracyclines, macrolides, fluoroquinolones, penam	Antibiotic efflux
Escherichia coli acrR with mutation conferring multidrug antibiotic resistance	Protein overexpression model	RND antibiotic efflux pump	Rifamycin, glycylcycline, tetracyclines, fluoroquinolones, cephalosporin, triclosan, phenicols, penam	Antibiotic target alteration, antibiotic efflux
Haemophilus influenzae PBP3 conferring resistance to beta-lactam antibiotics	Protein variant model	Penicillin-binding protein mutations conferring resistance to beta-lactam antibiotics	Monobactam, cephalosporin, carbapenem, cephamycin, penam	Antibiotic target alteration
mdtM	Protein homolog model	MFS antibiotic efflux pump	Lincosamide, phenicol, acridine dye, fluoroquinolones, nucleoside antibiotic	Antibiotic efflux
mdtF	Protein homolog model	RND antibiotic efflux pump	Fluoroquinolones, penam, macrolides	Antibiotic efflux
kdpE	Protein homolog model	kdpDE	Aminoglycoside antibiotic	Antibiotic efflux
H-NS	Protein homolog model	MFS antibiotic efflux pump, RND antibiotic efflux pump	Tetracyclines, macrolides, fluoroquinolones, penam, cephalosporin, cephamycin	Antibiotic efflux
mdtP	Protein homolog model	MFS antibiotic efflux pump	Acridine dye, nucleoside antibiotic	Antibiotic efflux
evgS	Protein homolog model	MFS antibiotic efflux pump, RND antibiotic efflux pump	Tetracyclines, macrolides, fluoroquinolones, penam	Antibiotic efflux
cpxA	Protein homolog model	RND antibiotic efflux pump	Aminoglycoside, aminocoumarin antibiotic	Antibiotic efflux
ugd	Protein homolog model	pmr phosphoethanolamine transferase	Peptide antibiotic	Antibiotic target alteration
Escherichia coli ampC beta-lactamase	Protein homolog model	ampC-type beta-lactamase	Cephalosporin, penam	Antibiotic inactivation
AcrF	Protein homolog model	RND antibiotic efflux pump	Cephalosporin, penam, cephamycin, fluoroquinolones	Antibiotic efflux
mdtO	Protein homolog model	MFS antibiotic efflux pump	Acridine dye, nucleoside antibiotic	Antibiotic efflux
mdtC	Protein homolog model	RND antibiotic efflux pump	Aminocoumarin antibiotic	Antibiotic efflux
mdtC	Protein homolog model	RND antibiotic efflux pump	Aminocoumarin antibiotic	Antibiotic efflux
acrD	Protein homolog model	RND antibiotic efflux pump	Aminoglycoside antibiotic	Antibiotic efflux
mdtM	Protein homolog model	MFS antibiotic efflux pump	Lincosamide, phenicol, acridine dye, fluoroquinolones, nucleoside antibiotic	Antibiotic efflux
acrD	Protein homolog model	RND antibiotic efflux pump	Aminoglycoside antibiotic	Antibiotic efflux
Escherichia coli emrE	Protein homolog model	small multidrug resistance (SMR) antibiotic efflux pump	Macrolides	Antibiotic efflux
mdtO	Protein homolog model	MFS antibiotic efflux pump	Acridine dye, nucleoside antibiotic	Antibiotic efflux
emrY	Protein homolog model	MFS antibiotic efflux pump	Tetracyclines	Antibiotic efflux
AcrE	Protein homolog model	RND antibiotic efflux pump	Cephalosporin, penam, cephamycin, fluoroquinolones	Antibiotic efflux
Escherichia coli soxR with mutation conferring antibiotic resistance	Protein overexpression model	RND antibiotic efflux pump, MFS antibiotic efflux pump, ATP-binding cassette (ABC) antibiotic efflux pump	Rifamycin, tetracyclines, glycylcycline, cephalosporin, fluoroquinolones, phenicol, triclosan, penam	Antibiotic target alteration, antibiotic efflux
Escherichia coli GlpT with mutation conferring resistance to fosfomycin	Protein variant model	GlpT	Fosfomycin	Antibiotic target alteration
AcrS	Protein homolog model	RND antibiotic efflux pump	Rifamycin, glycylcycline, tetracyclines, phenicol, fluoroquinolones, cephalosporin, triclosan, cephamycin, penam	Antibiotic efflux
Escherichia coli soxS with mutation conferring antibiotic resistance	Protein overexpression model	General bacterial porin with reduced permeability to beta-lactams, RND antibiotic efflux pump, MFS antibiotic efflux pump, ABC antibiotic efflux pump	Rifamycin, monobactam, tetracyclines, glycylcycline, cephalosporin, cephamycin, fluoroquinolones, carbapenem, phenicol, penem, triclosan, penam	Reduced permeability to antibiotic, antibiotic target alteration, antibiotic efflux
TolC	Protein homolog model	RND antibiotic efflux pump, MFS antibiotic efflux pump, ABC antibiotic efflux pump	Rifamycin, tetracyclines, aminocoumarin antibiotic, glycylcycline, cephalosporin, cephamycin, fluoroquinolones, macrolides, phenicol, triclosan, penam	Antibiotic efflux
gadX	Protein homolog model	RND antibiotic efflux pump	Penam, fluoroquinolones, macrolides	Antibiotic efflux
Escherichia coli mdfA	Protein homolog model	MFS antibiotic efflux pump	Rhodamine, tetracyclines, benzalkonium chloride	Antibiotic efflux
mdtF	Protein homolog model	RND antibiotic efflux pump	Fluoroquinolones, penam, macrolides	Antibiotic efflux
Escherichia coli EF-Tu mutants conferring resistance to Pulvomycin	Protein variant model	Elfamycin resistant EF-Tu	Elfamycin antibiotic	Antibiotic target alteration
acrB	Protein homolog model	RND antibiotic efflux pump	Rifamycin, glycylcycline, tetracyclines, fluoroquinolones, cephalosporin, triclosan, phenicol, penam	Antibiotic efflux
YojI	Protein homolog model	ABC antibiotic efflux pump	Peptide antibiotic	Antibiotic efflux
patA	Protein homolog model	ABC antibiotic efflux pump	Fluoroquinolones	Antibiotic efflux
mdtA	Protein homolog model	RND antibiotic efflux pump	Aminocoumarin antibiotic	Antibiotic efflux
mdtB	Protein homolog model	RND antibiotic efflux pump	Aminocoumarin antibiotic	Antibiotic efflux
eptA	Protein homolog model	pmr phosphoethanolamine transferase	Peptide antibiotic	Antibiotic target alteration
mdtC	Protein homolog model	RND antibiotic efflux pump	Aminocoumarin antibiotic	Antibiotic efflux
gadW	Protein homolog model	RND antibiotic efflux pump	Penam, fluoroquinolones, macrolides	Antibiotic efflux
AcrF	Protein homolog model	RND antibiotic efflux pump	Cephalosporin, penam, cephamycin, fluoroquinolones	Antibiotic efflux
Escherichia coli emrE	Protein homolog model	Small multidrug resistance (SMR) antibiotic efflux pump	Macrolides	Antibiotic efflux
Escherichia coli nfsA mutations conferring resistance to nitrofurantoin	Protein variant model	Antibiotic resistant nfsA	Nitrofuran antibiotic	Antibiotic target alteration

Source: https://card.mcmaster.ca

ARO, antibiotic resistance ontology; AMR, antimicrobial resistance.

Discussion

In the study, 10.2% (5/49) of the isolates were found to be mcr carriers harboring mcr-2 and/or mcr-3. According to the results, two of the isolates (4.1%) were positive for only mcr-3. The presence of mcr-3 in E. coli isolates has been also reported by Hernández et al.¹⁷ in cattle and by Yin et al.¹¹ and Fukuda et al.¹⁸ in pigs. Notably, reports for the presence of mcr-2 are limited: 11/53 of porcine colistin-resistant E. coli isolates¹⁰; 21% of extended-spectrum beta-lactamase-producing E. coli isolates collected from calves.¹⁹ This contrast was summarized by Sun et al. with the fact that the mcr-2 gene is carried by a rare plasmid (IncX4-type).²⁰ Although mcr-1 has been the most prevalent gene in animals so far,^9,17,19,21 none of our isolates was found to harbor this gene as well as mcr-4 and mcr-5.

Co-occurrence of mcr genes has been found in several studies.^{5,13,17,18,22} Importantly, we found co-occurrence of mcr-2 and mcr-3 genes, which has not been reported to our knowledge. Our results are in contrast to the data obtained where the mcr-2 gene was not detected in 186 enterotoxigenic E. coli and Shiga toxigenic E. coli (STEC) isolates of pig feces,¹³ and in 152 E. coli isolates of cattle feces both conducted in Spain.¹⁷

According to the International Organization for Standardization and bacteriological analytical manual's conventional cultivation methods, E. coli O157:H7 is isolated by its sorbitol negative phenotypic character.^23,24 In recent years, some sorbitol-positive E. coli O157 isolates were detected from different sources such as human, food of animal origin, and food-producing animals in different geographical areas. However, these isolates were generally reported as H7 negative and some of them were negative for any of the stx genes.^25–27 To the best of our knowledge, only Sallam et al. reported a sorbitol-fermenting E. coli O157, which harbored fliC_H7 gene, isolated from retail beef, similar to our sorbitol-fermenting E. coli O157:H7 isolate.²⁸ These new isolates may necessitate modifications of conventional isolation methods, because sorbitol fermenting E. coli O157:H7 naturally cannot be recovered from Sorbitol MacConkey Agar and also from CHROMagar by non-sorbitol fermentation-based cultivation protocoles according to the previous studies.²⁹

Based on the WGS analysis, our sorbitol-fermenting E. coli O157:H7 isolate (25KA) carries srlA, srlE, and srlR genes, which are encoding phosphotransferase system glucitol/sorbitol transporter subunits and sorbitol 6-phosphate dehydrogenase (S6PDH), respectively. Especially, S6PDH has been reported to be an essential in sorbitol synthesis.³⁰ In the present study, the chromosomal sequencing data of 25KA isolate also showed that in addition to the Shiga toxin subunit A and B, this strain is also carrying eaeA encoding gamma intimin and E. coli HlyD family type I secretion periplasmic adaptor subunit. This data showed that 25KA has the potential to cause a typical enterohemorrhagic E. coli (EHEC) infection in humans such as HUS and HC. Other important virulence factors of this isolate can be seen by searching dataset accession (PRJNA503568). This knowledge will be important for public health because both sorbitol- and H7-positive strain-related infections have not yet been reported.

The use of antibiotics in the treatment of STEC infections is not recommended.³¹ Although the treatment options with antibiotics are limited, studies on the subject are carried out and the different types of antimicrobial resistance of E. coli O157:H7 is also important according to the study results.³² In some cases, Bauwens et al. stated that only rifaximin and azithromycin might be considered as an option of an antibiotic therapy of EHEC infections in humans.³³ On the contrary, Percivalle et al. remarked that colistin has a protecting effect on Vero cells from E. coli O157:H7 by inhibiting Shiga toxin releasing and binding endotoxin.⁸ This result indicated that in some cases colistin might be a unique treatment option for EHEC infections.

Even if the use of colistin as a treatment option for EHEC is on the agenda, our results show that different isolates have already been developed resistance (Table 2). All isolates except 25KA, which were phenotypically showed colistin resistance, were determined to have different plasmid-mediated colistin resistance genes. These results coincide with the results of colistin resistance and other studies conducted to determine the mechanism. Because colistin resistance was reported to occur by two different chemical modification mechanisms on the bacterial lipid A that are encoded in the plasmid and chromosomes.^9,34–36 Our plasmid-mediated mcr (mobilized colistin resistance) carrying isolates might be explained by this mechanism. Nevertheless, chromosomal-mediated colistin resistance needs a two sets of bacterial two-component systems (pmrAB and phoPQ) and the regulator mgrB.^34,35 Although these systems have been well studied in Enterobacteriaceae (like Klebsiella pneumoniae and Salmonella), to the best of our knowledge, our finding will be the first report for E. coli O157:H7. WGS analysis showed that isolate 25KA harbored both of the systems with regulator mgrB in the chromosome. In addition, 25KA is carrying eptA gene encoding phosphoethanolamine transferase, which catalysis the addition of phosphoethanolamine moiety to the lipid A and basR for the positively autoregulation. As a result of this modification, the bacterium is able to acquire colistin resistance. In addition, the bacterium can be defined as a superbug because it has been determined by WGS analysis that it carries 62 different antimicrobial resistance genes.

This is the first report of plasmid-mediated mcr-2 and mcr-3 genes carrying E. coli O157:H7 cattle and sheep isolates and WGS of a colistin-resistant sorbitol fermentative E. coli O157:H7. Findings of this study indicate that cattle and sheep are important sources for colistin resistance E. coli O157:H7, and slaughterhouse wastewater is a significant route for dissemination of the plasmid-mediated colistin resistance genes. Therefore, the use of colistin in veterinary medicine may be considered to be banned to reduce the development of resistance. Also, sorbitol fermentative E. coli O157:H7 strain 25KA, which cannot be isolated with sorbitol fermentation-based standard isolation methods, was found to be colistin-resistant phenotypically. This finding can be considered as the non-sorbitol fermentation-based isolation protocol that needs to be reviewed if the prevalence of bacteria with this character will be found to be epidemiologically important in future studies. In addition, other mechanisms that cause colistin resistance should be investigated when taking into consideration the presence of phenotypically colistin-resistant isolates that did not carry any of the mcr genes.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Poirel

, Jayol

, and Nordmann

2017. Polymyxins: antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 30:557–596.

Falagas

M.E.

, and Rafailidis

P.I.

2008. Re-emergence of colistin in today's world of multidrug-resistant organisms: personal perspectives. Expert Opin. Investig. Drugs, 17:973–981.

Rhouma

, Beaudry

, Thériault

, and Letellier

2016. Colistin in pig production: chemistry, mechanism of antibacterial action, microbial resistance emergence, and one health perspectives. Front. Microbiol. 7:1789.

Borowiak

, Fischer

, Hammerl

J.A

, Hendriksen

R.S

, Szabo

, and Malorny

2017. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi. B. J. Antimicrob. Chemother. 72:3317–3324.

Rebelo

A.R.

, Bortolaia

, Kjeldgaard

J.S

, Pedersen

S.K

, Leekitcharoenphon

, Hansen

I.M

, Guerra

, Malorny

, Borowiak

, Hammerl

J.A

, Battisti

, Franco

, Alba

, Perrin-Guyomard

, Granier

S.A

, De Frutos Escobar

, Malhotra-Kumar

, Villa

, Carattoli

, and Hendriksen

R.S.

2018. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro Surveill., 23; [Epub ahead of print]; DOI: 10.2807/1560-7917.ES.2018.23.6.17-00672.

European Medicines Agency (EMA). 2016. Updated Advice on the Use of Colistin Products in Animals within the European Union: Development of Resistance and Possible Impact on Human and Animal Health. EMA/231573/2016. European Medicines Agency, London, UK.

Doyle

M.E.

, Archer

, Kaspar

C.W.

, and Weiss

2006. FRI briefings: human illness caused by E. coli O157:H7 from food and non-food sources. Available at https://fri.wisc.edu/files/Briefs_File/FRIBrief_EcoliO157H7humanillness.pdf (accessed November 7, 2018).

Percivalle

, Monzillo

, Pauletto

, Marone

, and Imberti

2016. Colistin inhibits E. coli O157:H7 Shiga-like toxin release, binds endotoxins and protects Vero cells. New Microbiol., 39:119–123.

Liu

Y.Y.

, Wang

, Walsh

T.R

, Yi

L.X

, Zhang

, Spencer

, Doi

, Tian

, Dong

, Huang

, Yu

L.-F

, Gu

, Ren

, Chen

, Lv

, He

, Zhou

, Liang

, Liu

J.-H

, and Shen

2016. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect. Dis., 16:161–168.

10.

Xavier

B.B.

, Lammens

, Ruhal

, Kumar-Singh

, Butaye

, Goossens

, and Malhotra-Kumar

2016. Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Euro Surveill. 21:30280.

11.

Yin

, Li

, Shen

, Liu

, Wang

, Shen

, Zhang

, Walsh

T.R

, Shen

, and Wang

2017. Novel plasmid-mediated colistin resistance gene mcr-3 in Escherichia coli. MBio, 8:e00543–17.

12.

Carattoli

, Villa

, Feudi

, Curcio

, Orsini

, Luppi

, Pezzotti

, and Magistrali

C.F.

2017. Novel plasmid-mediated colistin resistance mcr-4 gene in Salmonella and Escherichia coli, Italy 2013, Spain and Belgium, 2015 to 2016. Euro Surveill. 22:30589.

13.

Garcia

, Garcia-Menino

, Mora

, Flament-Simon

S.C

, Diaz-Jimenez

, Blanco

J.E

, Pilar Alonso

, and Blanco

2018. Co-occurrence of mcr-1, mcr-4 and mcr-5 genes in multidrug-resistant ST10 Enterotoxigenic and Shiga toxin-producing Escherichia coli in Spain (2006–2017). Int. J. Antimicrob. Agents, 52:104–108.

14.

Ayaz

N.D.

, Gencay

Y.E

, and Erol

2014. Prevalence and molecular characterization of sorbitol fermenting and non-fermenting Escherichia coli O157:H7+/H7− isolated from cattle at slaughterhouse and slaughterhouse wastewater. Int. J. Food Microbiol. 174:31–38.

15.

Gencay

Y.E.

2014. Sheep as an important source of E. coli O157/O157:H7 in Turkey. Vet. Microbiol., 172:590–595.

16.

Ayaz

N.D.

, and Erol

2010. Relation between serotype distribution and antibiotic resistance profiles of Listeria monocytogenes isolated from ground turkey. J. Food Prot. 73:967–972.

17.

Hernández

, Iglesias

M.R

, Rodríguez-Lázaro

, Gallardo

, Quijada

, Miguela-Villoldo

, Campos

M.J

, Piriz

, Lopez-Orozco

, de Frutos

, Saez

J.L

, Ugarte-Ruiz

, Dominguez

, and Queseda

2017. Co-occurrence of colistin-resistance genes mcr-1 and mcr-3 among multidrug-resistant Escherichia coli isolated from cattle, Spain, September 2015. Euro Surveill., 22:30586.

18.

Fukuda

, Sato

, Shinagawa

, Takahashi

, Asai

, Yokota

S.I

, Usui

, and Tamura

2018. High prevalence of mcr-1, mcr-3 and mcr-5 in Escherichia coli derived from diseased pigs in Japan. Int. J. Antimicrob. Agents, 51:163–164.

19.

Haenni

, Beyrouthy

, Lupo

, Chatre

, Madec

J.Y

, and Bonnet

2018. Epidemic spread of Escherichia coli ST744 isolates carrying mcr-3 and bla_CTX-M-55 in cattle in France. J. Antimicrob. Chemother. 73:533–536.

20.

Sun

, Zhang

, Liu

Y-H

, and Feng

2018. Towards understanding MCR-like colistin resistance. Trends Microbiol. 26:794–808.

21.

Hasman

, Hammerum

, Hansen

, Hendriksen

, Olesen

, Agersø

, Zankari

, Leekitcharoenphon

, Stegger

, Kaas

, Cavaco

, Hansen

, Aarestrup

, and Skov

2015. Detection of mcr-1 encoding plasmid-mediated colistin-resistant Escherichia coli isolates from human bloodstream infection and imported chicken meat, Denmark 2015. Euro Surveill., 20; [Epub ahead of print]; . DOI: 10.2807/1560-7917.ES.2015.20.49.30085.

22.

Liu

, Feng

, Zhang

, McNally

, and Zonga

2017. New variant of mcr-3 in an extensively drug-resistant Escherichia coli clinical isolate carrying mcr-1 and bla_NDM-5. Antimicrob. Agents Chemother. 61:pii:e01757-17.

23.

International Organization for Standardization (ISO).. 2018. Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Detection of Escherichia coli O157. 16654:2001.

24.

Feng

, Weagent

S.D

, and Jinneman

2018. U.S. Food and Drug Administration-bacteriological analytical manual chapter 4A diarrheagenic Escherichia coli. Available at https://fda.gov/food/foodscienceresearch/laboratorymethods/ucm070080.htm (accessed January 29, 2018).

25.

Kossow

, Zhang

, Bielaszewska

, Rhode

, Hansen

, Fruth

, Rüter

, Karch

, and Mellmann

Molecular characterization of human atypical sorbitol-fermenting Escherichia coli O157 reveals high diversity. J. Clin. Microbiol., 54:1357–1363.

26.

Jaakkonen

, Salmenlinna

, Rimhanen-Finne

, Lundström

, Heinikainen

, Hakkinen

, and Hallanvuo

2017. Severe outbreak of sorbitol-fermenting Escherichia coli O157 via unpasteurized milk and farm visits, Finland 2012. Zoonoses Public Health, 64:468–475.

27.

Vygen-Bonnet

, Rosner

, Wilking

, Fruth

, Prager

, Kossow

, Lang

, Simon

, Seidel

, Faber

, Schielke

, Michaelis

, Holzer

, Kamphausen

, Kalhofer

, Thole

, Mellmann

, Flieger

, and Stark

2017. Ongoing haemolytic uraemic syndrome (HUS) outbreak caused by sorbitol-fermenting (SF) Shiga toxin producing Escherichia coli (STEC) O157, Germany, December 2016 to May 2017. Euro Surveill., 22:30541.

28.

Sallam

K.I.

, Mohammed

M.A

, Ahdy

A.M

, and Tamura

2013. Prevalence, genetic characterization and virulence genes of sorbitol-fermenting Escherichia coli O157:H^_ and E. coli O157:H7 isolated from retail beef. Int. J. Food Microbiol. 165:295–301.

29.

Hirvonen

J.J.

, Siitonen

, and Kaukoranta

S.S.

2012. Usability and performance of CHROMagar STEC medium in detection of Shiga toxin-producing Escherichia coli strains. J. Clin. Microbiol. 50:3586–3590.

30.

Fratamico

P.M.

, Buchanan

R.L

, and Cooke

P.H.

1993. Virulence of an Escherichia coli O157:H7 sorbitol-positive mutant. Appl. Environ. Microbiol. 59:4245–4252.

31.

Freedman

S.B.

, Xie

, Neufeld

M.S

, Hamilton

W.L

, Hartling

, and Tarr for the Alberta Provincial Pediatric Enteric Infection Team P.I (APPETITE). 2016. Shiga toxin-producing E. coli infection, antibiotics, and risk of developing hemolytic uremic syndrome: a meta-analysis. Clin. Infect. Dis., 62:1251–1258.

32.

Goncuoglu

, Ormanci

F.S.B

, Ayaz

N.D

, and Erol

2010. Antibiotic resistance of Escherichia coli O157:H7 isolated from cattle and sheep. Ann. Microbiol. 60:489–494.

33.

Bauwens

, Kunsmann

, Karch

, Mellmann

, and Bielaszewska

2017. Antibiotic mediated modulations of outer membrane vesicles in enterohemorrhagic Escherichia coli O104:H4 and O157:H7. Antimicrob. Agents Chemother. 61:e00937–17.

34.

Gunn

J.S.

2008. The Salmonella PmrAB regulon: lipopolysaccharide modifications, antimicrobial peptide resistance and more. Trends Microbiol. 16:284–290.

35.

Cannatelli

, D'Andrea

M.M

, Giani

, Di Pilato

, Arena

, Ambretti

, Gaibani

, and Rossolini

G.M.

2013. In vivo emergence of colistin resistance in Klebsiella pneumoniae producing KPC-type carbapenemases mediated by insertional inactivation of the PhoQ/PhoP mgrB regulator. Antimicrob. Agents Chemother. 57:5521–5526.

36.

Baron

, Hadjadj

, Rolain

J.M

, and Olaitan

A.O.

2016. Molecular mechanism of polymixin resistance: knowns and unknowns. Int. J. Antimicrob. Agents, 48:583–591.