Dissemination of Multidrug-Resistant and mcr-1 Gram-Negative Bacilli in Broilers,Farm Workers,and the Surrounding Environment in Lebanon

Abstract

Poultry are currently regarded as reservoirs from which multidrug resistance can be readily transferred to the surrounding ecosystem. The aim of this study was to explore the prevalence of extended spectrum beta-lactamases (ESBLs) and ampC and mcr-1 Gram-negative bacilli in chicken, farmers, and environment in Lebanon. In May 2017, we revisited the farm where the first mcr-1 was detected in 2015 in Lebanon. Overall 200 chicken fecal swabs, 6 farmers' fecal samples, and 41 environmental samples were collected. Real time (RT)-PCR was performed for beta-lactamases and mcr genes' screening using newly designed primers/probes. Multilocus sequence typing (MLST) was also performed. ESBL/ampCs were found in 118 samples from chicken, 4 from workers, and all environmental ones. mcr-1 was detected in all chicken and farmers' samples from which 314 and 7 strains were isolated, respectively. Three mcr-1 Escherichia coli strains were isolated from litter and feed. Compared to 2015, the prevalence of ESBL/ampC producers, TEM and CTX-M genes increased significantly in 2017. Main spectra profiles dendrogram of isolated E. coli strains in 2015/2017 and MLST revealed the presence of different clones and sequence types. The evolution of resistance appears to be multi-clonal and related to the diffusion of plasmids carrying ESBL and mcr-1 genes. More work is needed to quantify the magnitude of this emerging problem in Lebanon.

Introduction

Gram-negative bacilli (GNB) are among the most common causative agents of hospital and community-acquired infections.¹ Among other organisms, resistance in Gram-negative bacteria has become a major concern in the last decade.^2,3 This is due to their rapidly evolving and disseminating mechanisms of resistance against commonly prescribed antibiotics in human medicine that is, cephalosporins.^4,5 Extended spectrum beta-lactamases (ESBLs), ampC beta lactamases, and carbapenemases are the main mediators of resistance encountered currently in GNB.^6,7 Recently, the emergence of colistin resistance worsened the situation.

Colistin is a polymyxin antibiotic that has previously been discontinued in clinical settings, but has recently been reintroduced due to the wide dissemination of multidrug-resistant Gram-negative bacteria, notably the carbapenem resistant ones.⁸ Colistin resistance is mediated either through chromosomal mutations that mediates the modification of the lipid A moiety of the lipopolysaccharides chain,⁹ or via plasmidic acquisition of a phosphoenolamine transferase gene that is, mcr-1,¹⁰ mcr-2,¹¹ mcr-3,¹² mcr-4,¹³ and mcr-5.¹⁴

Previously, the epidemiology of resistant GNB was thought to be restricted to the hospital setting. However, nowadays, evidence has shown the presence of an external reservoir of resistance in “livestock.”¹⁵ Many studies reported a high prevalence of ESBLs and colistin-resistant GNB in farm animals.^16,17 One possible cause for this abundance is the unregulated usage of antibiotics in veterinary medicine.¹⁸ The European Centre for Disease Prevention and Control/European Food Safety Authority/European Medicines Agency (ECDC/EFSA/EMA) report showed that in 2014, the average antibiotic consumption in animals (152 mg/kg) exceeded the level in humans (124 mg/kg).¹⁹

Univariate analysis showed a significant correlation between tetracycline and polymyxin consumption, and resistance in Escherichia coli in animals and between fluoroquinolones and E. coli in both human and animal sectors.¹⁹ Furthermore, a recent publication of the WHO guidelines on use of medically important antimicrobials in food producing animals recommended an overall reduction but also a complete restriction of use of all medically important antimicrobial classes for growth promotion and disease prevention in food producing animals.²⁰ According to the WHO CIA report, these antimicrobials include third, fourth, and fifth generation cephalosporins, glycopeptides, macrolides, ketolides, and polymyxins.²¹

The main concern about the spread of resistant organisms in animals is their potential zoonotic transmission to humans where they could be causative agents of infections with limited therapeutic options when multidrug resistance is encountered.²²

The increased carriage of ESBLs in humans with frequent contact with broilers,²³ sharing the same plasmids/ESBL genes,²⁴ sequence types (STs), virulence, and pulsed-field gel electrophoresis patterns²⁵ between humans and animals have all been considered evidence of transmission of antibiotic resistance between these two compartments. Although, direct contact with animals has been suggested to be the main player in this transmission, environmental routes in farm animals are increasingly being considered.²³ The latter includes transmission via air,²⁶ dust,²⁷ soil fertilized with animal manures,²⁸ and contaminated wastewaters.²⁹ The epidemiology of multidrug-resistant Gram-negative bacteria is thus complex at the human-animal-environment interface.³⁰

In Lebanon, our group reported a considerable nationwide prevalence of ESBL/ampC-producing GNB (20.6%) in poultry farms in 2015 and pigs (66.5%) in 2017.^31,32 Similarly, a study conducted in cattle revealed high abundance of CTX-M-15 producing E. coli over the Lebanese territory.³³ Other scattered reports described the detection of OXA-23/OXA-58-producing Acinetobacter baumannii, VIM-2-producing Pseudomonas aeruginosa and OXA-48 E. coli strains in livestock and fowl, respectively.^34,35 In addition, our group reported the first detection of one mcr-1-positive E. coli strain from chicken in Lebanon in 2015 in a farm in southern Lebanon.³⁶ This is in addition to the first detection of mcr-1-positive E. coli strains in swine farms in the south of Lebanon.³²

In this context, the purpose of this study was to return to the same farm where we found the first mcr-1-positive isolate 2 years ago and to do further investigations on the prevalence of ESBL and mcr-1-positive GNB, not only in chicken, but also in farm workers and the surrounding environment.

Materials and Methods

Ethics statement

The Ministry of Agriculture of Lebanon has agreed for the collection of fecal swabs from broilers in the south in accordance with national animal handling and sampling standards. Sampling was in accordance with international animal safety guidelines. The farm workers provided us with fecal samples with their complete satisfaction and without any obligation.

Collection of samples from broilers, environment, and workers

On May 15, 2017, 200 fecal swabs were collected from healthy broilers on the farm where the first mcr-1-positive E. coli strain was first isolated in 2015 in Saida, Southern Lebanon.³⁶ Collection of fecal samples was done from two herds of the same farm, containing each 5000 broiler Ross-308. Ten chicken feed samples, 10 poultry litter samples, and 21 soil samples surrounding the farm were also collected using sterile cups. Six fecal samples were also provided by the workers in this farm using sterile urine cups. All collected samples were put in a portable refrigerator and transported directly to the University laboratory where they were stored at −80°C for later use. In addition, the list of antibiotics used on this farm was recorded.

Screening of beta lactamase and colistin-resistant Gram-negative bacteria

MacConkey agar supplemented with cefotaxime (2 mg/L), ertapenem (1 mg/L), and colistin (4 mg/L) were used for the screening of ESBL, carbapenemase producers, and colistin-resistant Gram-negatives, respectively. The chicken fecal swabs were simply subcultured on different media. This also applies to the workers' fecal samples; however, for these, each fecal sample was first mixed using a swab and then this swab was used for subculture. The soil, feed, and litter samples were incubated in a 400 mL of sterile distilled water for 2 hours at room temperature. Thereafter, an initial vacuum pump filtration using filter papers (pores size 10–15 μm) to remove sediments was performed and the 400 mL filtered from each sample was divided into three sterile cups containing each 100 mL.

Then, using mixed ester cellulose filter papers with 0.45 μm pores size, each 100 mL was filtered again and put on separate selective media and incubated overnight at 37°C. Following incubation, colonies with different morphologies from each selective plate were taken separately and identified using matrix assisted laser desorption ionization-time of flight mass spectrometry with a score value ≥1.9 using the Microflex LT spectrometer (Bruker Daltonics, Bremen, Germany) for correct identification.^37,38 For each strain, the spectra obtained were stored and downloaded into a MALDI Biotyper 3.0 system for the construction of main spectra profiles (MSP) dendrogram. Following identification, the strains were conserved in 40% glycerol aliquots and preserved at −80°C for later testing.

Antibiotic susceptibility testing

Antibiotic susceptibility testing was performed using the Kirby-Bauer disk diffusion method. Sixteen antibiotics were used: ampicillin (10 μg), amoxicillin-clavulanic acid (20/10 μg), aztreonam (30 μg), ceftazidime (10 μg), cefotaxime (5 μg), cefepime (30 μg), cefoxitin (30 μg), piperacillin-tazobactam (30/6 μg), colistin (10 μg), meropenem (10 μg), ertapenem (10 μg), imipenem (10 μg), tigecycline (15 μg), ciprofloxacin (5 μg), gentamicin (10 μg), and trimethoprim-sulfamethoxazole (25 μg) (Bio-Rad, Marnes-la-Coquette, France). The inhibition zone diameters were interpreted according to European committee on antimicrobial susceptibility testing guidelines 2017.³⁹ Furthermore, colistin micro-dilution test was performed as previously described.³⁹

An isolate showing resistance to at least three different classes of antimicrobials was termed as being multidrug resistant.⁴⁰ Phenotypic detection of ESBL, ampC beta lactamases, and carbapenemases was performed using the double disk synergy test, ampC disk test, and Carba NP test, respectively.^41,42

Real-time PCR screening of beta lactamase and mcr genes

All strains having a colistin minimum inhibitory concentration (MIC) of >2 mg/L were subjected to real time-PCR for the screening of mcr colistin-resistant genes.^43,44 For a more rapid screening, new primers and probes were designed for the detection of mcr-3, mcr-4, and mcr-5 plasmid-mediated colistin resistance genes by real-time PCR (Table 1). Furthermore, isolates showing a keyhole effect or having cefoxitin resistance with nonsusceptibility to cefepime were screened for the presence of bla_CTX-M, bla_SHV, and bla_TEM genes.⁴⁵ Bacterial DNA was extracted using an EZ1 DNA extraction kit (Qiagen, Courtaboeuf, France) with an EZ1 Advanced XL biorobot.

Table 1.

Primers and Probes Used for the Detection of mcr Genes via RT-Polymerase Chain Reaction in This Study

Target gene	Primer/probe name	Sequence (5′ - 3′)	Amplicon size (bp)	Reference
mcr-1	PE_F1	GCAGCATACTTCTGTGTGGTAC	145	⁴³
	PE-R1	ACAAAGCCGAGATTGTCCGCG
	PE-Probe1	6 FAM–GACCGCGACCGCCAATCTTACC-TAMRA
mcr-2	mcr-2-RT-F	CTGTGCCGTGTATGTTCAGC	151	This study
	mcr-2-RT-R	TTATCCATCACGCCTTTTGAG
	mcr-2-VIC1	VIC-TGACCGCTTGGGTGTGGGTA-TAMRA
mcr-3	mcr-3-RT-F1	TGAATCACTGGGAGCATTAGGGC	144	This study
	mcr-3-RT-R1	TGCTGCAAACACGCCATATCAAC
	mcr-3-PE1	6 FAM-TGCACCGGATGATCAGACCCGT-TAMRA
mcr-4	mcr-4-RT-F1	GCCAACCAATGCTCATACCCAAAA	112	This study
	mcr-4-RT-R1	CCGCCCCATTCGTGAAAACATAC
	mcr-4-PE1	6 FAM-GCCACGGCGGTGTCTCTACCC-TAMRA
mcr-5	mcr-5-RT-F1	TATCCCGCAAGCTACCGACGC	126	This study
	mcr-5-RT-R1	ACGGGCAAGCACATGATCGGT
	mcr-5-PE1	6 FAM-TGCGACACCACCGATCTGGCCA-TAMRA

RT, real time.

Multilocus sequence typing

Colistin-resistant E. coli strains isolated from workers and environmental samples along with 15 selected isolates from chicken were subjected to multilocus sequence typing (MLST) based on their allelic profiles using 7 housekeeping genes: adk, fumC, gyrB, icd, mdh, purA, and recA.⁴⁶ For the selection of 15 chicken isolates, the spectra of colistin-resistant strains isolated from chicken and from workers and environment were plotted and an MSP dendrogram was constructed (Supplementary Fig. S1). Chicken isolates with nodes adjacent to the ones isolated from workers, feed, and litter samples were subjected to MLST. Furthermore, ESBL producers isolated from workers were also subjected to MLST. The ST of each strain was determined using the allelic profiles analyzed based on the Warwick MLST database.

Statistical analysis

The prevalence of multidrug-resistant GNB, resistance genes, and resistance patterns, were compared between the years 2015 and 2017 via Fisher Exact test using Epi Info™ version 7.2.⁴⁷ A p value ≤0.05 was considered statistically significant.

Results

Identification of isolated strains

Of the 200 rectal swabs collected from chicken, 181 E. coli strains were isolated on the medium supplemented with cefotaxime. The number of collected chicken fecal swab samples versus the number of isolates was not one strain per one sample, this is because for some samples more than one isolate was obtained. In farm workers and poultry litter, 4 and 17 E. coli strains were detected, respectively. In feed samples, three A. baumannii, three P. aeruginosa, one Achromobacter xylosoxidans, and one Serratia rubideae were isolated from eight samples. Similarly, in soil samples, four Pseudomonas putida, two Pseudomonas monteilii, four Acinetobacter genomospecies, four Stenotrophomonas maltophilia, four Enterobacter cloacae, five E. coli, and one Ochrobactrum haematophilium were found.

On the other hand, on the medium supplemented with colistin, 121 colistin-resistant E. coli strains, 30 Klebsiella pneumoniae, and 1 Enterobacter asburiae were isolated from chicken. All six workers carried colistin-resistant isolates: six E. coli and one K. pneumoniae. From feed samples, two colistin-resistant E. coli strains and one A. baumanii were detected. In poultry litter, a single colistin-resistant E. coli strain was isolated while in soil, no colistin-resistant bacteria were found.

Resistance phenotypes of isolated strains

The detailed antimicrobial susceptibility testing of GNB isolated in this study is summarized in Table 2. Overall, ESBL was the main mechanism of resistance found in all sources followed by ESBL/ampC and ampC production. In chicken, 163/181 (69%) ESBL/ampC strains were co-resistant to colistin.

Table 2.

Resistance Profiles of Gram-Negative Bacilli Isolated in This Study

Source	Species	Antibiotic susceptibility testing														Phenotype			Genotype
Source	Species	AMP	FOX	AZT	CTX	TZP	FEP	AMC	CAZ	CAR	COL^a	GNT	SXT	CIP	TGC	% of ESBL	% of ampC	% of ESBL/ampC	% of mcr-1	% of CTX-M	% of TEM	% of SHV
Chicken	Escherichia coli (n = 302)	298 (99)	175 (58)	177 (59)	144 (48)	35 (12)	101 (33)	158 (52)	165 (55)	0	284 (94)	237 (78)	250 (83)	285 (94)	12 (4)	33	18	9	94	55	91	18
Chicken	Klebsiella pneumoniae (n = 30)	30 (100)	12 (40)	1 (3)	1 (3)	4 (13)	1 (3)	18 (60)	1 (3)	0	30 (100)	29 (97)	30 (100)	30 (100)	0	3			100
Workers	E. coli (n = 10)	9 (90)	1 (10)	5 (50)	5 (50)	0	5 (50)	2 (20)	4 (40)	0	6 (60)	6 (60)	5 (50)	7 (70)	0	50	10		60	100	20
Workers	K. pneumoniae (n = 1)	1 (100)	0	0	0	0	0	0	0	0	1 (100)	1 (100)	1 (100)	1 (100)	0				100
Litter	E. coli (n = 18)	17 (94)	13 (72)	17 (94)	15 (83)	0	11 (61)	11 (61)	13 (72)	0	1 (6)	15 (83)	17 (94)	17 (94)	0	61		33	6	94	94
Feed	Acinetobacter baumannii^b (n = 3)	3 (100)	3 (100)	3 (100)	3 (100)	0	3 (100)	3 (100)	3 (100)	0	1 (33)	0	0	1 (33)	0	67		33		100	67
	Pseudomonas aeruginosa^b (n = 3)	3 (100)	2 (67)	1 (33)	1 (33)	0	1 (33)	2 (67)	0	0	0	1 (33)	3 (100)	1 (33)	1 (33)	100				100	67
	Serratia rubideae (n = 1)	1 (100)	1 (100)	0	1 (100)	0	0	1 (100)	0	0	0	0	1 (100)	0	1 (100)	100				100
	Achromobacter xylosoxidans (n = 1)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0	0	1 (100)	0	1 (100)	0	100				100
	E. coli (n = 2)	2 (100)	0	0	0	0	0	0	0	0	2 (100)	2 (100)	2 (100)	2 (100)	0				100
Soil	Pseudomonas putida^b (n = 4)	4 (100)	4 (100)	4 (100)	4 (100)	0	4 (100)	4 (100)	4 (100)	0	0	0	4 (100)	0	4 (100)	50	50			50	50
	Pseudomonas monteilii^b (n = 2)	2 (100)	2 (100)	2 (100)	2 (100)	0	2 (100)	2 (100)	1 (50)	0	0	0	2 (100)	2 (100)	2 (100)	100				100	50
	A. baumannii^b (n = 3)	3 (100)	3 (100)	3 (100)	3 (100)	2 (67)	3 (100)	3 (100)	3 (100)	0	0	2 (67)	2 (67)	2 (67)	2 (67)		33	67		67	33
	Stenotrophomonas maltophilia (n = 4)	4 (100)	4 (100)	4 (100)	4 (100)	1 (25)	2 (50)	4 (100)	1 (25)	0	0	0	4 (100)	1 (25)	3 (75)	50				50	50	25
	Enterobacter cloacae (n = 4)	4 (100)	4 (100)	4 (100)	4 (100)	2 (50)	4 (100)	4 (100)	3 (75)	0	0	3 (75)	3 (75)	3 (75)	0	50		50		25	75	25
	E. coli (n = 5)	5 (100)	4 (80)	5 (100)	4 (80)	0	3 (60)	4 (80)	5 (100)	0	0	2 (40)	5 (100)	4 (80)	3 (60)	100				80	100	20
	Ochrobactrum haematophilium (n = 1)	1 (100)	1 (100)	1 (100)	1 (100)	0	1 (100)	1 (100)	1 (100)	0	0	0	1 (100)	0	1 (100)	100

Resistance profiles are presented as number (percentage).

Colistin resistance was determined by colistin broth micro-dilution test.

Susceptibility to carbapenem was based on imipenem and meropenem.

%, percentage; AMC, amoxicillin-clavulanic acid; AMP, ampicillin; AZT, aztreonam; CAR, carbapenems that is, imipenem, meropenem, and ertapenem; CAZ, ceftazidime; CIP, ciprofloxacin; COL, colistin; CTX, cefotaxime; ESBL, extended spectrum beta-lactamase; FEP, cefepime; FOX, cefoxitin; GNT, gentamicin; n, number; SXT, trimethoprim-sulfamethoxazole; TGC, tigecycline; TZP, piperacillin-tazobactam.

Compared to 2015, the prevalence of antimicrobial resistance has increased significantly for all beta-lactams and non beta-lactams except cefepime, ciprofloxacin, and tigecycline (p ≤ 0.05) (Fig. 2A). As for colistin-resistant isolates grown on the media supplemented with colistin, broth micro-dilution testing revealed mainly colistin MICs ranging from 4 to 16 mg/L in E. coli strains isolated from chicken. Most of the K. pneumoniae isolates from chicken displayed colistin MICs reaching 256 mg/L. Furthermore, one E. asburiae with a colistin MIC of 256 mg/L was also detected. In workers, feed, and litter strains, colistin MICs ranged from 4 to 8 mg/L. From all sources, phenotypic test revealed that all strains grown on the media supplemented with colistin were non ESBL producers and were sensitive to the majority of the beta-lactams tested.

FIG. 2.

(A) Comparison of the antibiotic and resistance genes prevalence in ESBL Escherichia coli strains (n = 38) isolated from Saida region in 2015 and the ESBL strains E. coli strains (n = 181) isolated from chicken in 2017. (B) Comparison of gentamicin, ciprofloxacin, trimethoprim-sulfametoxazole, and colistin resistance prevalence in ESBL (n = 181) and non ESBL E. coli strains (n = 121) isolated in 2017. ^‡p Value ≤0.05. Color images are available online.

This is except for only five and one in chicken and workers, respectively, being ESBL producers. As depicted in Fig. 2B, gentamicin, ciprofloxacin, and trimethoprim-sulfamethoxazole resistance were significantly more prevalent in ESBL producers isolated from chicken compared to non ESBL-producing strains “mcr-1-positive isolates” (p ≤ 0.05).

Prevalence of ESBL/ampC and colistin-resistant isolates in all sources

As shown in Fig. 1, ESBL/ampC producing GNB were detected in all feed, soil, and litter samples; on the other hand, these latter were detected in 59% and 67% of collected chicken and farm workers' fecal samples, respectively. The abundance of colistin resistance was higher in chicken (73%) and farmers (100%) as compared to the environmental samples [litter (6%), feed (20%)]. In fact, the prevalence of ESBL/ampC producers detected in poultry in Saida region has significantly increased, from 27% in 2015 to 59% in 2017 (p ≤ 0.05).

FIG. 1.

Prevalence of colistin-resistant and ESBL/ampC-producing Gram-negative bacilli in chicken, farmers, and environment. Prevalence is expressed as “number of positive samples (percentage)” C, chicken; W, worker; S, soil; L, litter; F, feed; gray highlight, colistin resistance, white highlight, ESBL/ampC; ESBL, extended spectrum beta-lactamase.

Detection of beta lactamase and mcr genes

In chicken CTX-M, TEM, and SHV genes were detected in 70, 116, and 23 ESBL/ampC-positive E. coli strains, respectively. As shown in Fig. 2A, the prevalence of CTX-M and TEM beta lactamase genes has significantly increased in 2017 compared to 2015. All isolates obtained from farmer and feed samples harbored CTX-M with two and four of them co-harboring also the TEM gene, respectively. In poultry litter, CTX-M and TEM genes were detected in 16 strains. TEM encoding gene was found in 15 strains isolated from soil samples, CTX-M in 14, and SHV in 3 isolates.

Furthermore, of the 181 ESBL and/or ampC producers detected in 2017, 163 were also positive for the mcr-1 colistin resistance gene compared to one strain isolated mcr-1 strain in 2015. In 2017, all colistin-resistant E. coli and K. pneumoniae strains isolated from chicken, farm workers, poultry litter, and feed were positive for mcr-1. No other mcr variants were detected. One A. baumannii and one E. asburiae isolates from feed and chicken were negative for all mcr genes, respectively.

MSP dendrogram analysis and MLST

As shown in Fig. 3, no cluster formations were formed in the MSP dendrogram neither at the level of the geographical location in 2015 nor at the level of the resistance phenotype in 2017. Combining the spectra of ESBL E. coli strains isolated from Saida in 2015 with those isolated in 2017, shows that the latter do not form independent clusters.

FIG. 3.

MSP dendrogram of (A) Escherichia coli strains isolated from chicken in 2015, (B) negative ESBL positive mcr-1 isolates and ESBL E. coli strains isolated from chicken in 2017, and (C) E. coli strains isolated from chicken in Saida region in 2015 along with the ESBL and negative ESBL positive mcr-1 E. coli strains isolated from chicken in 2017. MSP, main spectra profiles. Color images are available online.

MLST of the colistin-resistant strains isolated from chicken revealed the presence of: ST101, ST746, ST1196, ST359, ST1140, ST2220, ST5687, and ST2481 in addition to unknown STs. The colistin-resistant E. coli strain isolated from litter was ST746, whereas the two E. coli isolates detected in feed samples were ST101 and ST3941. ST101 was shared by chicken and feed strains whereas ST746 was shared between litter and chicken isolates. Farm workers' isolates displayed with ST1011 and unknown STs for colistin-resistant E. coli; similarly, unknown STs in addition to ST10, ST59 were identified in ESBL-producing E. coli strains isolated from farmers.

Discussion

It is now becoming clear that the epidemiology of multidrug-resistant organisms has changed and is no longer confined to the hospital setting.¹⁵ ESBL, carbapenemase producers, and colistin-resistant GNB are frequently detected in livestock, pets, and wildlife animals.^7,48 The poultry production system is of special interest since it forms a complex and vulnerable ecosystem that can be easily hacked by resistant organisms. Indeed, once introduced, the latter can disseminate nationally and also globally due to the frequent import/export of broilers worldwide.⁴⁹

Moreover, it has been shown that resistant organisms in food producing animals can be readily transmitted to humans via direct or indirect contact²³ and via environmental routes.²⁷ In their study, Laube et al. reported the detection of ESBL/ampC-producing E. coli strains from broiler fecal samples (100%), dust samples (71%), litter (95%), and farmers' boot swabs (90%) in addition to 54% of different environmental samples, including swabs from scales, water, and feeding troughs.⁷

Following our first detection of the mcr-1-positive strain of E. coli in poultry in southern Lebanon in 2015^7,36 and in addition to the high abundance of ESBL/ampC producers detected at the national level in chicken farms during the same year,^7,31 we found it crucial to return to the same farm in southern Lebanon where we found the mcr-1 strain and explore the evolution of bacterial resistance in this farm. Our study shows that from 2015 to 2017, the prevalence of ESBL/ampC producers has significantly increased from 27% to 59% in Saida, Southern Lebanon. In addition, mcr-1-positive strains are highly prevalent in the chicken feces but also in feed, litter, and workers. The abundance of multidrug resistance in all sources and in farmers illustrates the complexity and multiplicity of transmission routes from poultry, farm workers. and environment.

It is important to mention that from 2015 to 2017 no infection control measures were taken in the chicken farm. Regarding environmental samples, some studies have even suggested air and dust as possible routes of resistance transmission within broiler farms.⁷ Moreover, the presence of multidrug resistance in feed samples is questionable and can have two plausible explanations: first that these resistant organisms are contaminated from the farm housing environment as some studies have suggested⁵⁰; or it can be due to the hidden use of antimicrobials as growth promoters in this farm. The role of poultry litter in the transmission chain is mainly exhibited when chicken flocks are renewed. Daehre et al. demonstrated the importance of housing environment contamination in the transfer of multidrug resistance to broilers via horizontal transmission.⁵¹

This is especially true when poor hygiene practices and waste management are applied within the farm. In this study, the application of chicken fecal materials as soil manures explains the resistance found in soil samples. Multidrug resistance in farming soils risks to be transmitted to human residential areas via waste and running water flows.²⁹ Moreover, as for antimicrobial use, gentamicin and colistin were often prescribed as treatment for gastrointestinal infections and doxycycline for respiratory infections.

The mcr-2, mcr-3, mcr-4, and mcr-5 colistin-resistant genes were not detected in any sample in this study. This finding is unlike what has been reported in livestock worldwide where mcr variants are frequently found, such as in Japan, Italy, and Spain.^52–54 Two recent studies conducted in China showed that mcr-2, mcr-3, mcr-4, and mcr-5 genes were more abundant in the nasal/oropharyngeal swabs than in the cloacal ones in both pigs and poultry.^55,56 This suggests that future studies in Lebanon should not only target the fecal carriage of colistin resistance in food producing animals but also the nasopharyngeal samples so that mcr variants might be detected. This also suggests that an mcr-1-positive plasmid has spread in this farm during the last 2 years.

In our investigation, we found that ESBL producers were more resistant to gentamicin compared to the non ESBL ones (mcr-1 strains). This suggests that ESBL-producing GNB are co-selected with the frequent use of gentamicin, while non ESBL mcr-1 strains are selected with colistin use in the chicken farm. Gentamicin was previously described as being among the most common antibiotic administered to livestock in Lebanon.³³ Rami et al. demonstrated a significant correlation between the use of gentamicin and tetracycline as growth promoters and the corresponding number of resistant E. coli strains in poultry farms.⁵⁷ Similarly, another study showed an association between the use of gentamicin as food additive and the number of gentamicin-resistant E. coli isolates.⁵⁸

As for the other non-beta lactam antibiotics, ESBL producers were significantly more resistant to ciprofloxacin and trimethoprim-sulfamethoxazole. These two antimicrobials are not used for therapeutic purposes in the visited farm in this study. In addition, their use in the Lebanese veterinary medicine is unknown and so their possible contribution to the selection and dissemination of multi-drug resistant organisms (MDROs) cannot be assumed. Strains exhibiting ESBL production and colistin resistance could have been disseminated by the double selection of gentamicin and colistin use in poultry.

Constructed MSP dendrogram (Fig. 3) reveals no cluster formation, at either the geographical location or at the phenotypic level. MLST analysis of mcr-1 E. coli strains also revealed the presence of different STs in chicken, workers, and environment, except the detection of two mcr-1 colistin-resistant E. coli strains sharing the same ST “ST101” and phenotype from chicken and feed. ST101 is an international ST described in broilers,⁵⁹ pigs,⁶⁰ and clinical settings.⁶¹ Many studies even associated ST101 to clinical E. coli strains harboring NDM-1 in Canada, Germany, U.K., Australia, and Pakistan.⁶¹ ST101 is thus a potent candidate for the zoonotic transmission to humans.

Furthermore, ST746 was shared between mcr-1 E. coli strains detected in chicken and poultry litter. Again, this ST has been reported in animals²⁷ and in OXA-48-producing E. coli strains isolated in clinical settings.⁶² The variety of STs detected together with the MSP dendrogram patterns observed suggest that the dissemination of bacterial resistance from 2015 to 2017 is multi-clonal and is related to the diffusion of plasmids carrying ESBL and mcr-1 genes.

This study has two main limitations. The first one is the lack of ampC genes detection. ampC producers are not nowadays frequently reported in the clinical settings nor in animals and the environment. Our concern is more to address rather, MDROs that are causing public health concerns in Lebanon. This is mainly illustrated by the wide dissemination of ESBL, carbapenem, and colistin resistance across all ecosystems.^35,63–67 The second limitation is the un-evaluation of resistance genes in terms of subgroups.

To summarize, this study reported a huge dissemination of mcr-1 E. coli strains in broilers, farmers, and the surrounding environment in Southern Lebanon. The overuse of antimicrobials appears to have played a key role in the massive spread of colistin resistance since the first detection of mcr-1 in 2015.³⁶ Interestingly, a study conducted in Great Britain found that the prevalence of mcr-1 E. coli strains was 76% in a pig farm. Twenty months later, upon the cessation of colistin use, no mcr-1-positive E. coli strains were detected in this same farm.⁶⁸ This suggest that colistin use cessation may help in reducing the dissemination of mcr-1 strains in livestock.⁶⁸

Moreover, the relatively high abundance of multidrug resistance in all sources emphasizes the hypothesis that when aiming to control the dissemination of resistant organisms, besides controlling antimicrobial use in veterinary medicine that is, colistin as well as other antibiotics used in the human medicine, environmental routes should be also targeted. Moreover, it is worth mentioning that this study is the first in Lebanon to report the isolation of mcr-1-positive E. coli strains from humans. Okdah et al. previously reported the detection of colistin-resistant K. pneumoniae strains isolated from patients in Beirut.⁶⁹ However, in these latter, the mechanism of colistin resistance was due to mutations in the phoP/Q, pmrA/B, and mgrB genes.⁶⁹

Therefore, our study points out that mcr-1 is present in the Lebanese farmers and might be introduced to the community and hospital settings if no strict infection control measures in animals and their surrounding environment are implemented. Further works are warranted to quantify the magnitude of this emerging problem in Lebanon.

Footnotes

Acknowledgment

We thank CookieTrad for English corrections.

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by the Lebanese Council for Research and the French Government under the “Investissements d'avenir” (Investments for the Future) program managed by the Agence Nationale de la Recherche (ANR, fr: National Agency for Research), (reference: Méditerranée Infection 10-IAHU-03).

Supplementary Material

References

Mehrad

, Clark

N.M

, Zhanel

G.G

, and Lynch

J.P

, 3rd. 2015. Antimicrobial resistance in hospital-acquired gram-negative bacterial infections. Chest, 147:1413–1421.

Exner

, Bhattacharya

, Christiansen

, Gebel

, Goroncy-Bermes

, Hartemann

, Heeg

, Ilschner

, Kramer

, Larson

, Merkens

, Mielke

, Oltmanns

, Ross

, Rotter

, Schmithausen

R.M

, Sonntag

H.-G

, and Trautmann

. 2017. Antibiotic resistance: what is so special about multidrug-resistant gram-negative bacteria? GMS Hyg. Infect. Control. 12:Doc05.

Schill

, Abdulmawjood

, Klein

, and Reich

. 2017. Prevalence and characterization of extended-spectrum beta-lactamase (ESBL) and AmpC beta-lactamase producing Enterobacteriaceae in fresh pork meat at processing level in Germany. Int. J. Food Microbiol. 257:58–66.

Karam

, Chastre

, Wilcox

M.H

, and Vincent

J.L.

. 2016. Antibiotic strategies in the era of multidrug resistance. Crit. Care. 20:136.

Samanta

, Joardar

S.N

, Das

P.K

, Das

, Sar

T.K

, Dutta

T.K

, Bandyopadhyay

, Batabyal

, and Isore

D.P.

. 2014. Virulence repertoire, characterization, and antibiotic resistance pattern analysis of Escherichia coli isolated from backyard layers and their environment in India. Avian Dis. 58:39–45.

Vasoo

, Barreto

J.N

, and Tosh

P.K.

. 2015. Emerging issues in gram-negative bacterial resistance: an update for the practicing clinician. Mayo Clin. Proc. 90:395–403.

Laube

, Friese

, von Salviati

, Guerra

, Kasbohrer

, Kreienbrock

, and Roesler

. 2013. Longitudinal monitoring of extended-spectrum-beta-lactamase/AmpC-producing Escherichia coli at German broiler chicken fattening farms. Appl. Environ. Microbiol. 79:4815–4820.

Olaitan

A.O.

, Morand

, and Rolain

J.M.

. 2014. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria. Front. Microbiol. 5:643.

Baron

, Hadjadj

, Rolain

J.M

, and Olaitan

A.O.

. 2016. Molecular mechanisms of polymyxin resistance: knowns and unknowns. Int. J. Antimicrob. Agents, 48:583–591.

10.

Liu

Y.Y.

, Wang

, Walsh

T.R

, Yi

L.X

, Zhang

, Spencer

, Doi

, Tian

, Dong

, Huang

, Yu

L.F

, Gu

, Ren

, Chen

, Lv

, He

, Zhou

, Liang

, Liu

J.H

, and Shen

. 2016. Emergence of plasmid-mediated colistin resistance mechanism mcr-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect. Dis. 16:161–168.

11.

Xavier

B.B.

, Lammens

, Ruhal

, Kumar-Singh

, Butaye

, Goossens

, and Malhotra-Kumar

. 2016. Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Euro. Surveill. 21. DOI: 10.2807/1560-7917.ES.2016.21.27.30280.

12.

Yin

, Li

, Shen

, Liu

, Wang

, Shen

, and Wang

. 2017. Novel plasmid-mediated colistin resistance gene mcr-3 in Escherichia coli. MBio, 8:pii:e00543-17.

13.

Carattoli

, Villa

, Feudi

, Curcio

, Orsini

, Luppi

, Pezzotti

, and Magistrali

C.F.

. 2017. Novel plasmid-mediated colistin resistance mcr-4 gene in salmonella and Escherichia coli, Italy 2013, Spain and Belgium, 2015 to 2016. Euro. Surveill. 22:pii:30589.

14.

Borowiak

, Fischer

, Hammerl

J.A

, Hendriksen

R.S

, Szabo

, and Malorny

. 2017. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar paratyphi B. J. Antimicrob. Chemother. 72:3317–3324.

15.

de Been

, Lanza

V.F

, de Toro

, Scharringa

, Dohmen

, Du

, Hu

, Lei

, Li

, Tooming-Klunderud

, Heederik

D.J

, Fluit

A.C

, Bonten

M.J

, Willems

R.J

, de la Cruz

, and van Schaik

. 2014. Dissemination of cephalosporin resistance genes between Escherichia coli. strains from farm animals and humans by specific plasmid lineages. PLoS Genet. 10: e100, 4776.

16.

Bui Thi Kim

, Bui Thi Mai

, Ueda

, Le Danh

, Yamamoto

, and Hirai

. 2017. Potential transmission opportunity of CTX-M-producing Escherichia coli in large-scale chicken farm in Vietnam. J. Glob. Antimicrob. Resist. 13:1–6.

17.

Grami

, Mansour

, Mehri

, Bouallegue

, Boujaafar

, Madec

J.Y

, and Haenni

. 2016. Impact of food animal trade on the spread of mcr-1-mediated colistin resistance, Tunisia, July 2015. Euro Surveill. 21:30144.

18.

Roess

A.A.

, Winch

P.J

, Akhter

, Afroz

, Ali

N.A

, Shah

, Begum

, Seraji

H.R

, El Arifeen

, Darmstadt

G.L

, and Baqui; Bangladesh Projahnmo Study Group

A.H.

. 2015. Household animal and human medicine use and animal husbandry practices in rural Bangladesh: risk factors for emerging zoonotic disease and antibiotic resistance. Zoonoses Public Health, 62:569–578.

19.

ECDC/EFSA/ second joint report on the integrated analysis of the consumption of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from humans

EMA

and animals

food-producing

. 2017. Sci. Rep. 15:e04872.

20.

WHO. 2017. Who Guidelines on Use of Medically Important Antimicrobials in Food-Producing Animals. World Health Organization, Geneva.

21.

CIA 2017

WHO

. 2017. WHO list of critically important antimicrobials for human medicine (WHO CIA list). Available at http://who.int/foodsafety/publications/antimicrobials-fifth/en (accessed January 15, 2018).

22.

Overdevest

, Willemsen

, Rijnsburger

, Eustace

, Xu

, Hawkey

, Heck

, Savelkoul

, Vandenbroucke-Grauls

, van der Zwaluw

, Huijsdens

, and Kluytmans

. 2011. Extended-spectrum beta-lactamase genes of Escherichia coli in chicken meat and humans, the Netherlands. Emerg. Infect. Dis. 17:1216–1222.

23.

Huijbers

P.M.

, Graat

E.A

, Haenen

A.P

, van Santen

M.G

, van Essen-Zandbergen

, Mevius

D.J

, van Duijkeren

, and van Hoek

A.H.

. 2014. Extended-spectrum and AmpC beta-lactamase-producing Escherichia coli in broilers and people living and/or working on broiler farms: prevalence, risk factors and molecular characteristics. J. Antimicrob. Chemother. 69:2669–2675.

24.

Leverstein-van Hall

M.A.

, Dierikx

C.M

, Cohen Stuart

, Voets

G.M

, van den Munckhof

M.P

, van Essen-Zandbergen

, Platteel

, Fluit

A.C

, van de Sande-Bruinsma

, Scharinga

, Bonten

M.J

, and Mevius

D.J.

; National ESBL Surveillance Group. 2011. Dutch patients, retail chicken meat and poultry share the same ESBL genes, plasmids and strains. Clin. Microbiol. Infect. 17:873–880.

25.

Olaitan

A.O.

, Thongmalayvong

, Akkhavong

, Somphavong

, Paboriboune

, Khounsy

, Morand

, and Rolain

J.M.

. 2015. Clonal transmission of a colistin-resistant Escherichia coli from a domesticated pig to a human in Laos. J. Antimicrob. Chemother. 70:3402–3404.

26.

von Salviati

, Laube

, Guerra

, Roesler

, and Friese

. 2015. Emission of ESBL/AmpC-producing Escherichia coli from pig fattening farms to surrounding areas. Vet. Microbiol. 175:77–84.

27.

Blaak

, van Hoek

A.H

, Hamidjaja

R.A

, van der Plaats

R.Q

, Kerkhof-de Heer

, de Roda Husman

A.M

, and Schets

F.M.

. 2015. Distribution, numbers, and diversity of ESBL-producing E. coli in the poultry farm environment. PLoS One, 10:e0135402.

28.

Laube

, Friese

, von Salviati

, Guerra

, and Rosler

. 2014. Transmission of ESBL/AmpC-producing Escherichia coli from broiler chicken farms to surrounding areas. Vet. Microbiol. 172:519–527.

29.

Guenther

, Ewers

, and Wieler

L.H.

. 2011. Extended-spectrum beta-lactamases producing E. coli in, wildlife, yet another form of environmental pollution? Front. Microbiol. 2:246.

30.

Purohit

M.R.

, Chandran

, Shah

, Diwan

, Tamhankar

A.J

, and Stalsby Lundborg

. 2017. Antibiotic resistance in an Indian rural community: a ‘one-health’ observational study on commensal coliform from humans, animals, and water. Int. J. Environ. Res. Public Health. 14:pii: E386.

31.

Dandachi

, Sokhn

E.S

, Dahdouh

E.A

, Azar

, El-Bazzal

, Rolain

J.M

, and Daoud

. 2018. Prevalence and characterization of multi-drug-resistant gram-negative bacilli isolated from Lebanese poultry: a nationwide study. Front. Microbiol. 9:550.

32.

Dandachi

, Fayad

, El-Bazzal

, Daoud

, and Rolain

J.M.

. 2018. Prevalence of extended-spectrum beta-lactamase-producing gram-negative bacilli and emergence of mcr-1 colistin resistance gene in Lebanese swine farms. Microb. Drug Resist. 25:233–240.

33.

Diab

, Hamze

, Madec

J.Y

, and Haenni

. 2016. High prevalence of non-ST131 CTX-M-15-producing Escherichia coli in healthy cattle in Lebanon. Microb. Drug Resist. 23:261–266.

34.

Al Bayssari

, Olaitan

A.O

, Dabboussi

, Hamze

, and Rolain

J.M.

. 2015. Emergence of OXA-48-producing Escherichia coli clone ST38 in fowl. Antimicrob. Agents Chemother. 59:745–746.

35.

Al Bayssari

, Dabboussi

, Hamze

, and Rolain

J.M.

. 2015. Emergence of carbapenemase-producing Pseudomonas aeruginosa and Acinetobacter baumannii in livestock animals in Lebanon. J. Antimicrob. Chemother. 70:950–951.

36.

Dandachi

, Leangapichart

, Daoud

, and Rolain

J.M.

. 2018. First detection of mcr-1 plasmid mediated colistin resistant E. coli in Lebanese poultry. J. Glob. Antimicrob. Resist. 12:137–138.

37.

Seng

, Rolain

J.M

, Fournier

P.E

, La Scola

, Drancourt

, and Raoult

. 2010. MALDI-TOF-mass spectrometry applications in clinical microbiology. Future Microbiol. 5:1733–1754.

38.

Singhal

, Kumar

, Kanaujia

P.K

, and Virdi

J.S.

. 2015. MALDI-TOF mass spectrometry: an emerging technology for microbial identification and diagnosis. Front. Microbiol. 6:791.

39.

European Commitee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters, version 7.1, 2017. Available at www.eucast.org fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_7.1_ Breakpoint_ Tables.pdf (accessed March 5, 2018).

40.

Magiorakos

A.P.

, Srinivasan

, Carey

R.B

, Carmeli

, Falagas

M.E

, Giske

C.G

, Harbarth

, Hindler

J.F

, Kahlmeter

, Olsson-Liljequist

, Paterson

D.L

, Rice

L.B

, Stelling

, Struelens

M.J

, Vatopoulos

, Weber

J.T

, and Monnet

D.L.

. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18:268–281.

41.

Black

J.A.

, Moland

E.S

, and Thomson

K.S.

. 2005. AmpC disk test for detection of plasmid-mediated AmpC beta-lactamases in Enterobacteriaceae lacking chromosomal AmpC beta-lactamases. J. Clin. Microbiol. 43:3110–3113.

42.

Bakour

, Garcia

, Loucif

, Brunel

J.M

, Gharout-Sait

, Touati

, and Rolain

J.M.

. 2015. Rapid identification of carbapenemase-producing Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii using a modified carba NP test. New Microbes New Infect. 7:89–93.

43.

Chabou

, Leangapichart

, Okdah

, Le Page

, Hadjadj

, and Rolain

J.M.

. 2016. Real-time quantitative PCR assay with taqman((R)) probe for rapid detection of mcr-1 plasmid-mediated colistin resistance. New Microbes New Infect. 13:71–74.

44.

Rebelo

A.R.

, Bortolaia

, Kjeldgaard

J.S

, Pedersen

S.K

, Leekitcharoenphon

, Hansen

I.M

, Guerra

, Malorny

, Borowiak

, Hammerl

J.A

, Battisti

, Franco

, Alba

, Perrin-Guyomard

, Granier

S.A

, De Frutos Escobar

, Malhotra-Kumar

, Villa

, Carattoli

, and Hendriksen

R.S.

. 2018. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro. Surveill. 23. DOI: 10.2807/1560-7917.ES.2018.23.6.17-00672.

45.

Roschanski

, Fischer

, Guerra

, and Roesler

. 2014. Development of a multiplex real-time PCR for the rapid detection of the predominant beta-lactamase genes CTX-M, SHV, TEM and CIT-type AmpCs in Enterobacteriaceae. PLoS One, 9:e100956.

46.

Peng

, and Zong

. 2011. Sequence type 38 Escherichia coli carrying bla(CTX-M-14). J. Med. Microbiol. 60,(Pt 5)::694–695.

47.

Nieves

, and Jones

. 2009. Epi Info: now an open-source application that continues a long and productive “life” through CDC support and funding. Pan. Afr. Med. J. 2:6.

48.

Dandachi

, Chabou

, Daoud

, and Rolain

J.M.

. 2018. Prevalence and emergence of extended-spectrum cephalosporin-, carbapenem- and colistin-resistant gram negative bacteria of animal origin in the Mediterranean basin. Front. Microbiol. 9:2299.

49.

Dierikx

C.M.

, van der Goot

J.A

, Smith

H.E

, Kant

, and Mevius

D.J.

. 2013. Presence of ESBL/AmpC-producing Escherichia coli in the broiler production pyramid: a descriptive study. PLoS One, 8:e79005.

50.

Greig

, Rajic

, Young

, Mascarenhas

, Waddell

, and LeJeune

. 2015. A scoping review of the role of wildlife in the transmission of bacterial pathogens and antimicrobial resistance to the food chain. Zoonoses Public Health, 62:269–284.

51.

Daehre

, Projahn

, Semmler

, Roesler

, and Friese

. 2018. Extended-spectrum beta-lactamase-/AmpC beta-lactamase-producing Enterobacteriaceae in broiler farms: transmission dynamics at farm level. Microb. Drug Resist. 24:511–518.

52.

Alba

, Leekitcharoenphon

, Franco

, Feltrin

, Ianzano

, Caprioli

, Stravino

, Hendriksen

R.S

, Bortolaia

, and Battisti

. 2018. Molecular epidemiology of mcr-encoded colistin resistance in Enterobacteriaceae from food-producing animals in Italy revealed through the EU harmonized antimicrobial resistance monitoring. Front. Microbiol. 9:1217.

53.

Fukuda

, Sato

, Shinagawa

, Takahashi

, Asai

, Yokota

S.I

, Usui

, and Tamura

. 2018. High prevalence of mcr-1, mcr-3 and mcr-5 in Escherichia coli derived from diseased pigs in Japan. Int. J. Antimicrob. Agents. 51:163–164.

54.

Hernandez

, Iglesias

M.R

, Rodriguez-Lazaro

, Gallardo

, Quijada

, Miguela-Villoldo

, Campos

M.J

, Píriz

, López-Orozco

, de Frutos

, Sáez

J.L

, Ugarte-Ruiz

, Domínguez

, and Quesada

. 2017. Co-occurrence of colistin-resistance genes mcr-1 and mcr-3 among multidrug-resistant Escherichia coli isolated from cattle, Spain, September 2015. Euro. Surveill. 22:pii: 30586.

55.

Zhang

, Chen

, Wang

, Yassin

A.K

, Butaye

, Kelly

, Gong

, Guo

, Li

, Yang

, Feng

, Jiang

, Song

, Wang

, You

, Yang

, Price

, Qi

, Kang

, and Wang

. 2018. Molecular detection of colistin resistance genes (mcr-1, mcr-2 and mcr-3) in nasal/oropharyngeal and anal/cloacal swabs from pigs and poultry. Sci. Rep. 8:3705.

56.

Chen

, Zhang

, Wang

, Butaye

, Kelly

, Li

, Yang

, Gong

, Yassin

A.K

, Guo

, Li

, Song

, and Wang

. 2018. Newly identified colistin resistance genes, mcr-4 and mcr-5, from upper and lower alimentary tract of pigs and poultry in China. PLoS One, 13:e0193957.

57.

El-Rami

F.E.

, Sleiman

F.T

, and Abdelnoor

A.M.

. 2012. Identification and antibacterial resistance of bacteria isolated from poultry. Pol. J. Microbiol. 61:323–326.

58.

Abdelnoor

A.M.

, Chokr

, Fayad

, and Al-Akl

. 2013. Review study on external-hospital bacteria as a source of infection and antimicrobial resistance in Lebanon. Int. Arabic J. Antimicrob. Agents. 3:1–6.

59.

Sola-Gines

, Cameron-Veas

, Badiola

, Dolz

, Majo

, Dahbi

, Viso

, Mora

, Blanco

, Piedra-Carrasco

, González-López

J.J

, and Migura-Garcia

. 2015. Diversity of multi-drug resistant avian pathogenic Escherichia coli (APEC) causing outbreaks of colibacillosis in broilers during 2012 in Spain. PLoS One, 10:e0143191.

60.

El Garch

, Sauget

, Hocquet

, LeChaudee

, Woehrle

, and Bertrand

. 2017. mcr-1 is borne by highly diverse Escherichia coli isolates since 2004 in food-producing animals in Europe. Clin. Microbiol. Infect. 23:51.e1–51.e4.

61.

Yoo

J.S.

, Kim

H.M

, Koo

H.S

, Yang

J.W

, Yoo

J.I

, Kim

H.S

, Park

H.K

, and Lee

Y.S

. 2013. Nosocomial transmission of NDM-1-producing Escherichia coli ST101 in a Korean hospital. J. Antimicrob. Chemother. 68:2170–2172.

62.

Gedebjerg

, Hasman

, Sorensen

C.M

, and Wang

. 2015. An OXA-48-producing Escherichia coli isolated from a Danish patient with no hospitalization abroad. Infect. Dis. (Lond), 47:593–595.

63.

Nawfal

D.T.

, Al-Bayssari

, Chabou

, Antar

, Diene

S.M

, Azar

, and Rolain

J.M.

. 2019. Investigation of multidrug-resistant ST2 Acinetobacter baumannii isolated from Saint George hospital in Lebanon. BMC Microbiol. 19:29.

64.

Nawfal

D.T.

, Azar

, Al-Bayssari

, Chamieh

A.S

, and Rolain

J.M.

. 2019. First detection of colistin-resistant Klebsiella pneumoniae in association with NDM-5 carbapenemase isolated from clinical Lebanese patients. Microb. Drug Resist. 25:925–930.

65.

Al-Bayssari

, Olaitan

A.O

, Leangapichart

, Okdah

, Dabboussi

, Hamze

, and Rolain

J.M.

. 2016. Whole-genome sequence of a blaOXA-48-harboring Raoultella ornithinolytica clinical isolate from Lebanon. Antimicrob. Agents Chemother. 60:2548–2550.

66.

Al Atrouni

, Hamze

, Jisr

, Lemarie

, Eveillard

, Joly-Guillou

M.L

, and Kempf

. 2016. Wide spread of OXA-23-producing carbapenem-resistant Acinetobacter baumannii belonging to clonal complex II in different hospitals in Lebanon. Int. J. Infect. Dis. 52:29–36.

67.

Al Atrouni

, Kempf

, Eveillard

, Rafei

, Hamze

, and Joly-Guillou

M.L.

. 2015. First report of oxa-72-producing Acinetobacter calcoaceticus in Lebanon. New Microbes New Infect. 9:11–12.

68.

Randall

L.P.

, Horton

R.A

, Lemma

, Martelli

, Duggett

N.A.D

, Smith

R.P

, Kirchner

M.J

, Ellis

R.J

, Rogers

J.P

, Williamson

S.M

, Simons

R.R.L

, Brena

C.M

, Evans

S.J

, Anjum

M.F

, and Teale

C.J.

. 2018. Longitudinal study on the occurrence in pigs of colistin-resistant Escherichia coli carrying mcr-1 following the cessation of use of colistin. J. Appl. Microbiol. 125:596–608.

69.

Okdah

, Leangapichart

, Hadjadj

, Olaitan

A.O

, Al-Bayssari

, Rizk

, Hammoud

, Diene

S.M

, and Rolain

J.M.

. 2017. First report of colistin-resistant Klebsiella pneumoniae clinical isolates in Lebanon. J. Glob. Antimicrob. Resist. 9:15–16.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.12 MB