Abstract
Plasmid-mediated polymyxin resistance has become a global health concern, not only because its dissemination has occurred drastically but also because it has begun to be reported in multidrug-resistant (MDR) pathogens. We hereby report microbiological and genomic characteristics of two mcr-1.1-positive polymyxin-resistant Escherichia coli isolates identified for the first time in community patients, in Santa Catarina, Southern Brazil. E. coli strains belonging to ST206 and ST354 and the resistome analysis revealed the presence of clinically important genes responsible for MDR profile. Interestingly, in both polymyxin-resistant E. coli strains, mcr-1.1 genes were carried by IncX4 plasmids, responsible for the worldwide dissemination of mcr-type genes. In this regard, plasmid backbones were almost identical to the first IncX4 plasmid reported in Brazil and sharing more than 99.9% identity to IncX4 plasmids from China, also lacking the ISApl1 insertion sequence upstream of mcr-1. In conclusion, these data confirm the presence of international ST206 and ST354 carrying mcr-1.1 genes and that the IncX4 plasmids have been key vectors contributing to the endemic status of mcr-1.1-positive polymyxin-resistant E. coli in Brazil. Also, we described the first known clinical isolate with the mrc1.1 gene in Santa Catarina state, Brazil, showing that plasmid-mediated polymyxin resistance has been affecting humans earlier than has been known so far.
Introduction
Polymyxin has been used in veterinary and clinical therapy for decades, but nowadays is playing an important role as a last resort in the treatment of severe multidrug-resistant (MDR) gram-negative bacilli infections. 1 It has been estimated that ∼12 tons of polymyxin are used in agriculture annually. 2 Acquired resistance is usually ascribed to a consequence of chromosomal mutations leading to modifications of the lipid A moiety of lipopolysaccharide. 3 However, in 2015, the plasmid-mediated polymyxin resistance gene mrc1.1 was described for the first time. This fact raised several questions about resistance genes dissemination between animal and human sources and has increased concern about multiresistant Enterobacterales. 2
Since the first description, the mcr-1 gene has been described globally in different Enterobacterales species, 4 mainly in Escherichia coli, Klebsiella pneumoniae, and Salmonella spp. from animal, environmental, and human sources. 5 The first identification of the mcr-1 gene in Brazil was published in 2016, it was found in E. coli isolates from livestock collected in 2012. This provides evidence for the fact that mcr-1-positive E. coli has been emerging in South America since at least 2012. 6 Thereafter, the gene has been found in clinical isolates,7–13 environmental samples, 14 and agricultural sources.15,16 In this study, we report for the first time the occurrence and genomic features of mcr-1.1-positive polymyxin-resistant Escherichia coli isolates from community patients, in Santa Catarina, Southern Brazil.
Materials and Methods
During a surveillance project from April 2015 to March 2016, at a University Hospital in Santa Catarina state, Brazil, 140 isolates of MDR 17 Enterobacterales from patients, health care professionals and hospital environment were screened for the presence of mcr-1 gene. The majority (80.7%) was isolated from patients (n = 113), and 23 (16.4%) of them were identified as E. coli. The mcr-1 screening was performed by qPCR using GoTaq® qPCR Master Mix (Promega Corporation) (mcr-1-F primer 5′GCTCTTTGGCGCGATGCTACTG 3′, mcr-1-R primer 5′GGTCTCGGCTTGGTCGGTCTG 3′) and appropriated controls. Two clinical isolates of E. coli (EC11 and EC91) were recovered from outpatients. One strain originated from a rectal swab, collected in 2015 (EC11), of a 48-year-old man, and the other one was recovered from a urine sample obtained in 2016 (EC91), from a 68-year-old woman presenting with urinary tract infection.
Identification were determined by VITEK™ 2 system (bioMérieux, Marcy-l'Étoile, France) and further confirmed by whole-genome sequencing (WGS) analysis. Antimicrobial susceptibility tests (AST) was performed by disc diffusion, except for polymyxin, where the minimum inhibitory concentration (MIC) was determined by the broth microdilution method. AST were interpreted according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) criteria (EUCAST, 2019).*
The WGS was performed using the MiSeq™ platform (Illumina, Inc., San Diego, CA). Genomic library was prepared using the Nextera DNA Flex Library Prep Kit (Illumina, Inc.) according to the manufacturer's instructions. WGS was executed using paired-end reads (250 bp). The reads were assembled with the A5 software, 18 being processed for adapter trimming, quality filtering, and error correction to generate contigs and scaffolds, obtaining a N50 value of 133,871 bp for EC11, and 181,326 bp for EC91.
Plasmid assembling from WGS data was performed using PlasmidSPAdes software v.3.13.0, 19 and the automatic annotation using Prokka. 20 In addition, resistance and virulence genes, sequence types, and plasmid incompatibility (Inc) types of the strains were identified using ResFinder v.3.1, 21 VirulenceFinder 1.5, 22 multilocus sequence typing (MLST) v.2.0 server, 23 and PlasmidFinder v.2.024 databases available from the Center for Genomic Epidemiology.** In addition, resistance genes sequences and mutations were confirmed using the Comprehensive Antibiotic Resistance Database.*** Phylogroups were established according to the Clermont et al. scheme. 25
Mating-out assays were performed by agar and broth methods using an azide-resistant lactose negative E. coli C600 and J53. Transconjugants harboring the mcr-1-positive IncX4 were expected to grow on McConkey agar supplemented with azide (100 μg/mL) and colistin (2 μg/mL).
Results
In this study, polymyxin-resistant E. coli strains (EC11 and EC91) carrying the mcr-1.1 gene were identified in outpatients who were not directly exposed to polymyxin. The copies of mcr-1.1 gene was located exclusively in plasmids, and both strains exhibited a MDR profile. 17 In this regard, among antibiotic tested, EC11 was resistant to ampicillin, ampicillin/sulbactam, amoxicillin/clavulanate, nalidixic acid, ciprofloxacin, levofloxacin, gentamycin, tobramycin, fosfomycin, sulfamethoxazole/trimethoprim, and polymyxin (MIC = 8 mg/L). In addition to polymyxin resistance (MIC = 8 mg/L) mediated by mcr-1.1, EC91 strain was also resistant to ampicillin, ampicillin/sulbactam, amoxicillin/clavulanate, cephalexin, cefuroxime, cefoxitin, ceftriaxone, cefotaxime, ceftazidime, cefepime, aztreonam, nalidixic acid, ciprofloxacin, levofloxacin, amikacin, gentamycin, tobramycin, and sulfamethoxazole/trimethoprim. Indeed, ESBL production was confirmed and explained the resistance to broad-spectrum cephalosporins (i.e., ceftriaxone, cefepime) (Table 1).
Phenotypic Resistance Profile and Acquired Resistance Genes for the Escherichia coli Strains EC11 and EC91 Harboring mcr-1
AST determined by disc diffusion according to EUCAST criteria.
MIC determined by broth microdilution method.
ST, MLST loci (adk, fumC, gyrB, icd, mdh, purA, and recA) defined by Achtman.
Phylogroups were established according to the Clermont et al. scheme. 25
Acquired resistance genes detected using ResFinder v.3.1. 21
Plasmid harboring mcr-1 gene.
Genes confirmed by qPCR.
AST, antimicrobial susceptibility tests; EUCAST, European Committee on antimicrobial susceptibility testing; MIC, minimum inhibitory concentration; MLST, multilocus sequence typing; QACs, quaternary ammonium compounds; ST, sequence type.
WGS analysis revealed that EC11 and EC91 belonged to ST206 and ST354, respectively. Antibiotic resistome analysis in EC11 identified resistance genes to β-lactams (blaTEM-1A), aminoglycosides [aph(6)-Id, aph(3'')-Ib, aph(3')-Ia, aadA1, aadA2], quinolones (qnrB19, gyrA S83L,QnrB10, parC p.A56T), phenicols (floR, cmlA1), sulfonamides (sul2, sul3), tetracyclines (tetA), trimethoprim (dfrA8), fosfomycin (GlpT E448K), and polymyxins (mcr-1); while in EC91, the presence of resistance genes to β-lactams (blaCTX-M-2), aminoglycosides [aadA1, aac(3)-IId, ant(2'')-Ia], quinolones (parC S80I, E84G; gyrA S83L, D87N; parE p.I355T), macrolides [mdf(A)], phenicols (ctaA1), sulfonamides (sul1), tetracyclines [tet(B)], trimethoprim (dfrA17), fosfomycin (glpT E448K, cyaA S352T, uhpT E350Q), and polymyxins (mcr-1) was confirmed (Table 1).
Plasmid incompatibility groups IncN, IncX3, IncX4, and IncFIB were identified in EC11 by PlasmidFinder, whereas Col (MG828), Col440I, p0111, IncFIA, IncFIB, and IncX4 groups were identified in EC91 (Table 1).
In both polymyxin-resistant E. coli strains, the presence of mcr-1.1 was associated with IncX4 plasmids, designated pMIMAEC11mcr (BioSample SAMN11954205) and pMIMAEC91mcr (BioSample SAMN11954204), respectively (GenBank access noss MK940857 and MK940858). In this regard, pMIMAEC11mcr and pMIMAEC91mcr shared 99.4% identity between them and 100% and 99.6% identity, respectively, with pICBEC72Hmcr (GenBank accession no. CP015977), the first IncX4 conjugative plasmid harboring mcr-1.1 gene described in Brazil, from a clinical E. coli isolate (Fig. 1A). 18 Although this high similarity, pMIMAEC11mcr and pMIMAEC91mcr conjugation assays, was performed at 37°C and 25°C, using E. coli strains C600 and J53 as receptor cells, different concentrations of polymyxin were unsuccessful.

Discussion
Plasmid-mediated polymyxin resistance brought a global public health concern. Previously polymyxin resistance was restricted to chromosomal mutations and intrinsic resistance26–28 and now is in several groups of highly transferable plasmids. 5 Plasmid location of mcr-1.1 genes described here were confirmed by PlasmidSPAdes assembly, 19 which uses coverage to remove 99% of chromosomal contigs, while retaining 99% of the plasmid contigs. Moreover, mcr-1 reads were not found in chromosomal sequences (∼10 × WGS coverage), supporting exclusive plasmid location of the genes. More recently, in silico analysis of the genetic context of mcr-1 genes have supported that mcr-1 is mobilized primarily as a composite transposon composed of one or two copies of ISApl1.29,30 Throughout evolutionary process, this composite transposon has lost one or both copies of ISApl1, increasing the stability of mcr-1 in plasmid vectors, facilitating the widespread dissemination of this gene in IncX4 plasmids. Therefore, absence of ISApl1 elements along mcr-1 genes here described could reduce their further chromosomal integration (Fig. 1B).
The first report of the mcr-1 gene in a clinical isolate in Brazil occurred in 2016, an E. coli ST101 isolate from a patient with diabetic foot. 31 Posteriorly, older strains were described from different samples: K. pneumoniae ST437 (2014), 9 E. coli ST744 (2014), 10 ST167, and ST354 (2015) 32 from rectal swabs; E. coli ST354 from blood (2015) 32 ; and K. pneumoniae ST392 from urine (2016). 7 Besides all diversity of features related to each report, the mcr-1 gene from that samples was located on almost identical IncX4 plasmids as reported here for EC11 and EC91 isolates.
The EC11 isolate was recovered in 2015, which makes it one of the oldest clinical isolates identified carrying the mcr-1 gene in the country, and the first in Santa Catarina state. This shows that strains carrying this resistance have affected humans in the state at least 3 years after the first description in a swine sample in 2012. 6 In Brazil, every plasmid harboring mcr-1 gene described so far belonged to the IncX4 group, with MIC values varying from 2 to 16 mg/L.7,10,14,15,31,33–35 That plasmid group is one of the principal responsibles for the mcr-1 dissemination.5,30 IncX4 plasmids are usually described as conjugative plasmids 30 and one of the major groups found in E. coli isolates, but also described in other Enterobacterales species.36,37
Interestingly, the plasmids pMIMAEC11mcr and pMIMAEC91mcr have highly similar backbone from IncX4 plasmid described by Fernandes et al. 31 (GenBank accession no. CP015977; ST101) in Brazil, also from human samples (Fig. 1). In addition, IncX4 plasmids of this study presented more than 99.9% identity to IncX4 plasmid found in China (GenBank accession no. KU761327.1; ST2448) 38 and in Estonia (GenBank accession no. KU743383.1; ST34). 39 In Latin America, mcr-1-positive-isolates have been circulating since 2012 in Brazil and Argentina, 2013 in Colombia, and 2016 in Ecuador as recently reviewed. 40 However, only IncX46,7,31,33 and I2 groups 41 were cited as the plasmids responsible for mcr-1 spread.
Altogether these data and previous published works support the hypothesis of an endemic plasmid circulating in Brazil, responsible for disseminating mcr-1 resistance gene in different species of Enterobacterales from different niches.
Besides the consensus that the IncX4 plasmid could be the key to the dissemination of the mcr-1 gene intercontinentally,6,15 conjugative capability lacks to both pMIMAEC11mcr and pMIMAEC91mcr. In this regard, it has been suggested that in addition to the plasmid-encoded regulatory elements, conjugation seems to be regulated by the internal environment, defined by the interaction between the host chromosome and the plasmid. 42 Therefore, since pMIMAEC11mcr, pMIMAEC91mcr, and the conjugative pICBEC72Hmcr plasmids were carried by E. coli strains belonging to ST206, ST354, and ST101, respectively, differences in the internal environment of these lineages could explain differences in plasmid mobilization. Also, the presence of other conjugative plasmids in the donor or recipient cells influences the transfer rate mutually.
In fact, it has been demonstrated that a plasmid tend to reduce conjugative efficiency of a coresident plasmid, and the transfer rate of a conjugative plasmid often increases if a distinct plasmid is present at the recipient cell, 43 which is the opposite condition of standard conjugation assays. Therefore, the presence of coresident plasmids in both E. coli EC11 (IncX4, IncN, IncX3, and IncFIB) and E. coli EC91 [IncX4, Col(MG828), Col440I, p0111, IncFIA, and IncFIB] helps to understand failure in IncX4 transfer. Finally, nonconjugative plasmids have been commonly reported among members of the Enterobacterales order, and probably rely largely on vertical transmission to be maintained in bacterial populations. 44
Thus, most likely, presence of nonconjugative plasmids (or nonconjugative environment) could explain the low prevalence (<0.1%) of mcr-1-positive isolates in hospital settings in Brazil and worldwide.45,46
Although E. coli ST206 and ST354 have been worldwide reported from human and nonhuman (food, food-producing animals, aquatic environments, and wild birds) sources, † including in Brazil (ST206), 47 the acquisition of mcr-1-type genes by E. coli isolates belonging to the ST206 has been restricted to China, so far being associated with human infections and colonization of livestock or aquatic environments.48–51 While for E. coli ST354, the acquisition of mcr-1 genes has been documented in China (human, chicken and companion animals),52,53 in Cambodia (clinical isolates), 54 and Pakistan (migratory wild birds), 55 thus being considered a new pandemic MLST genotype with zoonotic potential. Therefore, in this study, we confirm the presence of international ST206 and ST354 carrying mcr-1.1 genes in Brazil.
Conclusion
We provide the first description of IncX4 plasmids harboring mcr-1 gene in clinical isolates of Santa Catarina state, in Southern Brazil. Complementing other studies worldwide, our data help to understand the dissemination routes of the plasmid-mediated polymyxin resistance. Besides, these data confirm that IncX4 plasmids have been key vectors of mcr-1 distribution in Brazil, and the nonconjugative plasmids pMIMAEC11mcr and pMIMAEC91mcr could help understand the low prevalence of clinical infections caused by mcr-1.1-positive polymyxin-resistant strains in the state.
Footnotes
Acknowledgments
CNPq, CAPES, and FAPESP research grants are gratefully acknowledged. N.L. is research fellow of CNPq (312249/2017-9). C.P.Z. was recipient of a CAPES scholarship. The authors thank the microbiology laboratory from University Hospital Professor Polydoro Ernani of São Thiago for storage MDR isolates and to Dr. Mara Scheffer for EC91 isolation.
Disclosure Statement
P.C., A.F.R.S., and L.F.V.O., are employees of Neoprospecta AS. Other authors declare that no competing financial interests exist.
Funding Information
This work was funded by research grants from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq 458293/2014-8, 462042/2014-6, 312249/2017-9 and 433128/2018-6), Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP 2016/08593-9), and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).
