First Identification of β-Lactamases in Antibiotic-Resistant Escherichia coli,Citrobacter freundii,and Aeromonas spp. Isolated in Stream Macroinvertebrates in a Central Italian Region

Abstract

Antibiotic-resistant bacteria (ARB) are widespread in nature and represent a serious public and environmental problem. In the present study, we report for the first time the presence of bacterial β-lactamases in two macroinvertebrate species with different feeding traits. The class A β-lactamases, SHV-1 and TEM-1, were found in Citrobacter freundii isolated from Gammarus elvirae and Escherichia coli from water samples, respectively. The metallo-β-lactamase CphA was found in Aeromonas veronii and Aeromonas hydrophila strains isolated from the predator Dina lineata. The presence of a large plasmid was ascertained only in E. coli strains isolated from water. In all strains studied, an integrase I typical of class I integrin was found. In contaminated freshwater habitats, ARB and antibiotic resistance genes could be disseminated through trophic links with important ecological implications. Transmission through the food chain may contribute to spreading and transferring antibiotic resistance not only in freshwater ecosystems but also outside the aquatic habitat.

Introduction

Antibiotic-resistant bacteria (ARB) are widespread in nature and represent a serious public and environmental problem.¹ The massive use of antibiotics in the treatment of clinical and veterinary infections or as promoters of livestock growth has determined a heavy antimicrobial contamination of the environment. The presence of antibiotics in groundwater, surface water, wastewater, soils, and sediments has been reported worldwide.² Compounds used in clinical therapy are only partially metabolized by patients and are then discharged into municipal wastewater, leading to proliferation of resistant bacteria in the environment.³ Freshwater ecosystems are particularly exposed to high levels of antibiotics, ARB, and antibiotic resistance genes (ARGs) because of contaminated material mainly from treated and untreated sewage, hospital waste, and agricultural runoff.^4–7 ARB have been widely found in water, sediment, and biofilm of rivers and lakes, mainly downstream from wastewater treatment plant (WWTP) effluents.^8,9 In addition, effluents from WWTPs are released directly into aquatic environments (i.e., rivers and ponds) or reused in agriculture or farms with an important impact on biological systems and human health.¹⁰ The biological treatment process of WWTPs creates an environment potentially suitable for resistance, development, and spreading of ARB and ARGs.^7,11 Recent studies have demonstrated that aquatic systems have an important ecological and evolutionary role in driving the persistence, emergence, and spread of ARB.⁴ The ease with which the ARGs spread in the aquatic environment is due to the fact that they are organized into mobile genetic elements (i.e., plasmids) in complex genetic structures as integrons and transposons, which can be mobilized and transferred to other bacteria of the same or different species.¹² In particular, integrons are natural expression systems able to capture and disseminate ARG cassettes.¹³

The aim of the present study was to investigate the presence of ARB and ARGs in water samples and macroinvertebrates collected downstream of a WWTP in a third-order stream (the Aterno River) of Central Italy. Being the main component of freshwater food webs, macroinvertebrates mediate the energy transfer from basal resources to final consumers with a series of complex trophic interactions. For this purpose, we selected two macroinvertebrate species that are common inhabitants of the Aterno River stream benthos and belong to two different trophic levels: the detritivore crustacean Gammarus elvirae and the predatory leech Dina lineata.^14,15

Materials and Methods

Samples and bacterial isolation

Samples were collected on June 2016 along the Aterno River (Abruzzo, Italy), downstream of a WWTP of L'Aquila city, Italy (42°20′48.1′′ N, 13°23′22.7′′ E). Water samples (∼200 mL) and macroinvertebrates were collected from the river downstream of the WWTP. The samples were immediately transferred (on ice) to the laboratory to be processed on the same day. Serial decimal dilutions of water samples (from 10⁻¹ to 10⁻⁴) were prepared in sterile saline solution (0.9% NaCl). A 100-μL volume of several dilutions of the samples was plated on MacConkey (Biolife, Italy) and Cled (Biolife) agar dishes supplemented with ampicillin (32 μg/mL) and sodium colistimethate (8 μg/mL) to select potential antibiotic-resistant producers. Plates were incubated at 30°C for 24 and 48 hr.

Macroinvertebrates were sampled with a Surber net (200-μm mesh size). From the material collected, 10 D. lineata (leeches) and 10 G. elvirae samples were selected for successive analysis. Leeches were totally macerated and sectioned in longitudinal and transversal directions after extensive washing with bidistilled sterile water. To select antibiotic-resistant producers, the mixture obtained was diluted 1:1 with sterile saline solution and plated on MacConkey and Cled agar dishes supplemented with ampicillin (32 μg/mL) and sodium colistimethate (8 μg/mL). The plates were incubated at 30°C for 24–48 hr. Instead, amphipods (G. elvirae) were washed extensively with bidistilled sterile water, homogenized in sterile saline solution (0.9% NaCl), and plated at the same conditions. Bacterial identification was performed using the EnteroPluri-Test System (Liofilchem, Italy) and confirmed by MALDI-TOF (matrix-assisted laser desorption ionization–time of flight) mass spectrometry (Biotyper 3.0; Bruker Daltonik, Germany).

Molecular biology experiments

Chromosomal DNA was extracted from selected strains, as previously described,¹⁶ and a large chromosomal DNA-free plasmid was extracted using the Large-Construct Kit (Qiagen). Mobile genetic elements encoding resistance determinants (i.e., integrons and gene cassettes), β-lactamase genes (bla_KPC, bla_VIM, bla_IMP, bla_NDM-1, bla_CphA, bla_TEM, bla_SHV, and bla_CTX-M), and the mcr-1 gene were detected by PCR using chromosomal and/or plasmid DNA as the template. The primers used for PCR experiments are listed in Table 1. To investigate the presence of integrons, the chromosomal DNA and/or plasmids of selected strains were analyzed by PCR using specific primers for intI1, intI2, and intI3 genes (Table 1). The variable region was analyzed by sequencing the amplicon obtained by PCR using primers 5′ CS and 3′ CS (Table 1). PCR products derived from three different amplifications were sequenced on both strands by the BigDye Sequencing Reaction Kit and an ABI PRISM 3500 capillary automated sequencer (Applied Biosystems, Monza, Italy). Results were compared and aligned with reference sequences using the online BLAST database and CLUSTAL W software.

Table 1.

Oligonucleotides Used for Polymerase Chain Reaction and Sequencing in This Study

Primer pair	Target	Sequence (5′–3′)	References
Int1_for	Int1	CTACCTCTCACTAGTGAG	22
Int1_rev	Int1	ATGAAAACCGCCACTGCG	22
Int2_for	Int2	CACGGATATGCGACAAAAAGGT	22
Int2_rev	Int2	GTAGCAAACGAGTGACGAAATG	22
Int3_for	Int3	ATCTGCCAAACCTGACTG	22
Int3_rev	Int3	CGAATGCCCCAACAACTC	22
5′-CS	Class 1 integron conserved region	GGCATCCAAGCAGCAAG	22
3′-CS	Class 1 integron conserved region	AAAGCAGACTTGACCTGA	22
IMP_for	bla_IMP gene	GTTTATGTTCATACATCGTT	11
IMP_rev	bla_IMP gene	CCAAACCACTACGTTATCT	11
VIM_for	bla _VIM-type	ATGTTCAAACTTTTGAGTAAGT	11
VIM_rev	bla _VIM-type	CTACTCAACGACTGAGC	11
CTX_M-1 _for	bla _CTX-M-type	ATGGTTAAAAAATCACTGCGTCAG	11
CTX_M-1_rev	bla _CTX-M-type	TTACAAACCGTTGGTGACGATTTTAG	11
TEM_for	bla _TEM-type	ATGAGTATTCAACATTTCCG	23
TEM_rev	bla _TEM-type	TTACCAATGCTTAATCAGTGAG	23
NDM-1_for	bla _NDM-1	GGTACCATGGAATTGCCCAATATTATG	11
NDM-1_rev	bla _NDM-1	GGATCCCTAGCGCAGCTTGTCGGCCAT	11
CphA_for	bla_CphA	ATGATGAAAGGTTGGATGAAGTGT	20
CphA_rev	bla_CphA	TTATGACTGGGGTGCGGCCTT	20
SHV_for	bla _SHV-type	GCCCGGGTTATTCTTATTTGTCGC	23
SHV_rev	bla _SHV-type	TCTTTCCGATGCCGCCGCCAGTCA	23
KPC_for	bla _KPC-3	ATGTCACTGTATCGCCGTCTAGTT	11
KPC_rev	bla _KPC-3	TTACTGCCCGTTGACGCCCAAT	11
KPC3int_for	bla _KPC-3	CCGCCGTGCAATACAGTGAT	11
KPC3int_rev	bla _KPC-3	TGGACTTGAGCGCATTCCAC	11
Mcr-1_for	mcr-1	CGGTCAGTCCGTTTGTTCTT	This study
Mcr-1_rev	mcr-1	CTTGGTCGGTCTGTAGG	This study

Antibiotic susceptibility testing

Minimum inhibitory concentrations (MICs) were assessed by conventional broth microdilution procedures using an inoculum of 5 × 10⁵ CFU/mL according to the Clinical and Laboratory Standards Institute (CLSI).¹⁷ The interpretation of the susceptibility of Aeromonas spp. was made in accordance with CLSI.¹⁸ The combination of amoxicillin–clavulanic acid was used at a ratio of 2:1. The antibiotics used were amoxicillin, amoxicillin–clavulanate, ceftazidime, cefotetan, ertapenem, meropenem, levofloxacin, gentamicin, and sodium colistimethate. Concerning sodium colistimethate, the cutoff points were in accordance with EUCAST.¹⁹ All antibiotics were purchased from Sigma-Aldrich (Milan, Italy) except sodium colistimethate (UCB Pharma, Milan, Italy)

β-Lactamase activity

β-Lactamase activity was determined spectrophotometrically on bacterial crude extract by measuring hydrolysis of 100 μM nitrocefin (λ = 482 nm; ΔɛM = +15.000 M⁻¹ cm⁻¹), a chromogenic cephalosporin.²⁰ Crude extracts of the strains were obtained by overnight culture in 100 mL of tryptic soy broth medium (Biolife, Italy) containing ampicillin (100 μg/mL). Cells were grown for 18 hr at 30°C and harvested by centrifugation at 8,000 rpm for 10 min at 4°C, washed twice with 20 mM sodium phosphate buffer, pH 7.0, and disrupted by sonication (30 W for 30 sec, five cycles). The membrane debris was removed by centrifugation at 22,000 rpm for 30 min. The cleared supernatant was used to calculate the rate of hydrolysis.

Results

Bacterial isolation and antimicrobial susceptibility

To identify antimicrobial-resistant bacteria, the samples, collected along a river (Aterno) situated downstream of a WWTP, were examined in the presence of ampicillin and sodium colistimethate. After 24–48 hr of incubation at 30°C, 4 bacterial species were counted: Escherichia coli (4 isolates), Citrobacter freundii (5 isolates), Aeromonas hydrophila (12 isolates), and Aeromonas veronii (5 isolates). The A. hydrophila strains were isolated from both water samples (seven isolates) and leeches (five isolates), whereas A. veronii strains were isolated only from leeches. E. coli strains were uniquely from water samples and C. freundii strains were from both water and G. elvirae. The antimicrobial susceptibility of all strains was tested against a large panel of antibiotics. As shown in Table 2, 8 of 12 A. hydrophila (5 isolates from leeches and 3 isolates from water) and 5 A. veronii (isolated from leeches) were resistant to all antibiotics tested. Four A. hydrophila, collected from water samples, were resistant to amoxicillin and amoxicillin/clavulanic acid. C. freundii strains were resistant to amoxicillin, amoxicillin/clavulanic acid, ceftazidime, cefotetan, gentamicin, and sodium colistimethate, but they were susceptible to carbapenems (ertapenem and meropenem) and levofloxacin. E. coli strains were susceptible to all antibiotics except amoxicillin (MIC value >128 μg/mL).

Table 2.

Distribution of Genetic Resistance Determinants in Environmental Isolates and Their Susceptibility Profiles

Species (No. of isolates)	Samples	Genetic elements	β-Lactamases	Antimicrobial susceptibility (MIC, μg/mL)
Species (No. of isolates)	Samples	Genetic elements	β-Lactamases	AMX	AMC	CAZ	CTT	ERT	MEM	LVX	CMS	GEN
Aeromonas hydrophila (4)	Water	Intl1, bla_CphA	CphA	>128 (R)	128 (R)	128 (R)	256 (R)	>8 (R)	32 (R)	32 (R)	32 (R)	64 (R)
A. hydrophila (3)	Water	Intl1	None detected	128 (R)	128 (R)	0.5 (S)	2 (S)	0.25 (S)	<0.03 (S)	0.5 (S)	32 (R)	0.5 (S)
A. hydrophila (4)	Dina lineata	Intl1, bla_CphA	CphA	>128 (R)	128 (R)	128 (R)	256 (R)	>8 (R)	32 (R)	32 (R)	32 (R)	64 (R)
A. hydrophila (1)	D. lineata	Intl1	None detected	128 (R)	128 (R)	0.5 (S)	2 (S)	0.25 (S)	<0.03 (S)	0.5 (S)	32 (R)	0.5 (S)
Aeromonas veronii (5)	D. lineata	Intl1, bla_CphA	CphA	>128 (R)	>128 (R)	>128 (R)	>256 (R)	>8 (R)	>64 (R)	64 (R)	64 (R)	>64 (R)
Escherichia coli (4)	Water	Plasmid, Intl1, bla_TEM-1	TEM-1	>128 (R)	4 (S)	1 (S)	0.25 (S)	<0.03 (S)	0.06 (S)	0.03 (S)	4 (R)	2 (S)
Citrobacter freundii (3)	Gammarus elvirae	Intl1, bla_SHV-1	SHV-1	>128 (R)	>128 (R)	>128 (R)	>256 (R)	0.25 (S)	0.125 (S)	<0.03 (S)	16 (R)	32 (R)
C. freundii (2)	Water	Intl1, bla_SHV-1	SHV-1	>128 (R)	>128 (R)	>128 (R)	>256 (R)	0.25 (S)	0.125 (S)	<0.03 (S)	16 (R)	32 (R)

AMC, amoxicillin–clavulanic acid; AMX, amoxicillin; CAZ, ceftazidime; CMS, sodium colistimethate; CTT, cefotetan; ERT, ertapenem; GEN, gentamicin; LVX, levofloxacin; MIC, minimum inhibitory concentration.

β-Lactamase identification

The presence of β-lactamases was ascertained by PCR analysis. An amplicon of about 750 bp was identified in A. hydrophila and A. veronii strains, whereas a fragment of 861 bp was isolated from C. freundii and E. coli. Sequence analysis showed that the amplicon of 750 bp, found in A. hydrophila and A. veronii, encoded for an enzyme of 227 amino acid residues with 100% homology with CphA enzyme (GenBank Accession No. X57102).

The amplimers of 861 bp were sequenced and their sequence showed high homology with bla_TEM-1 and bla_SHV-1. The β-lactamases, TEM-1 and SHV-1, were identified in a large plasmid isolated from E. coli strains and in the chromosome of C. freundii, respectively. The presence of β-lactamases was confirmed by measuring the activity of crude extracts using nitrocefin as the substrate (data not shown).

Plasmids and integron analysis

The screening of plasmids showed the presence of a large plasmid of more than 100 kb only in the E. coli strains. These plasmids harbored the bla_TEM-1 gene encoding the TEM-1 β-lactamase. The analysis of mobile genetic elements showed that all strains possessed the IntI1 gene encoding a type 1 integrase (data confirmed by sequencing). Nevertheless, with primers, 5′CS and 3′CS (Table 1), it was not possible to amplify the variable region of class 1 integron.

Discussion

The presence of antibiotic-resistant determinants was ascertained in Gram-negative bacteria isolated from water samples and stream macroinvertebrates collected from downstream effluents of an urban WWTP discharging into the Aterno River (L'Aquila, Central Italy). Overall, 26 isolates resistant to almost 3 of the 4 classes of antibiotics tested (β-lactams, fluoroquinolones, aminoglycosides, and polymyxins) were analyzed. However, β-lactam antibiotics are the most used molecules in clinical therapy to treat serious nosocomial infections. In the present study, we focused the attention on β-lactamases, the major mechanism of resistance to β-lactams. In samples collected from water and stream macroinvertebrates, we found metallo-β-lactamase, the CphA enzyme, and serine β-lactamases such as TEM-1 and SHV-1. The CphA enzyme is included in subclass B2 metallo-β-lactamases and it is most frequently found in A. hydrophila and A. veronii.^21,22 CphA is a chromosomally encoded metallo-β-lactamase able to efficiently hydrolyze carbapenems such as imipenem, meropenem, and ertapenem.²³ Normally, Aeromonas species are very often isolated from rivers, lakes, wastewater natural sail, drinking water, food, and animals.²⁴ In our previous article, two new CphA variants (named CphA4 and CphA5) were found in A. veronii and A. hydrophila isolated from municipal sewage in L'Aquila city (Italy).²² Nevertheless, A. hydrophila and A. veronii are also involved in serious human infections. Generally, TEM and SHV variants are plasmid-encoded enzymes frequently found in human pathogens.²⁵ The finding of TEM-1-producing bacteria in environmental bacteria is not unusual; in fact, in our previous study, bla_TEM-1 genes were found in bacteria isolated from sewage samples.²⁴

The antimicrobial susceptibility of all strains was tested toward five β-lactams (amoxicillin, ceftazidime, cefotetan, ertapenem, and meropenem) and one combination amoxicillin–clavulanic acid. Clavulanic acid is a good inhibitor of some serine-β-lactamases.²⁶ Clavulanic acid was unable to restore susceptibility of amoxicillin in all strains (MIC values ≥128) with the exception of E. coli isolates. This could be due to the intrinsic resistance to β-lactams, in particular in C. freundii strains. Four isolates of A. hydrophila, negative to CphA β-lactamase, showed intrinsic resistance to amoxicillin and the amoxicillin–clavulanic acid combination due to the possible presence of other β-lactamases (class C and/or class D) that were not isolated with our methods. However, other mechanisms such as efflux pumps and porins could be found in Aeromonas species.

The gene bla_TEM-1 was identified only in E. coli plasmids. These strains showed only resistance to amoxicillin and sodium colistimethate (MIC values >128 and 4 μg/mL). The resistance to sodium colistimethate was probably mediated by chromosomal mechanisms because we did not find the presence of the mcr-1 gene.²⁷ The presence of bla_TEM-1 in E. coli justifies the resistance to amoxicillin. In particular, TEM-1 is a β-lactamase, with a narrow spectrum of substrate, able to well hydrolyze penicillins and old-generation cephalosporins. For this reason, E. coli strains were susceptible to carbapenems (ertapenem and meropenem) and second- and third-generation cephalosporins (cefotetan and ceftazidime). The C. freundii strains, isolated in water and Gammarus species, were susceptible to carbapenems and levofloxacin, but resistant to penicillins and cephalosporins. The main mechanism of resistance to β-lactams in C. freundii is represented not only by chromosomal production of SHV-1 but also by inducible AmpC β-lactamase. In the present study, the presence of the IntI1 gene encoding a type 1 integrase was confirmed in all strains presuming the presence of class 1 integron. However, no results were obtained for a variable region of class 1 integron. Commonly, the 3′CS region of class 1 integron includes the sul1 gene (resistance to sulfonamides), which is usually present in clinical isolates, but frequently absent in environmental strains.²⁸ In our previous articles, we described the presence of class 1 integrons and β-lactamases (i.e., AmpC, TEM-1, and KPC-3) in water samples collected up- and downstream of the municipal WWTP of L'Aquila city (Abruzzo, Italy).^29,30 Our data support the hypothesis that biological and physicochemical processes used for wastewater systems are not always able to remove ARGs and, for this reason, WWTPs could be important reservoirs for ARB. The significance of WWTPs as ARG reservoirs is relevant, in particular, in those regions where treated wastewater is used for irrigation.

Conclusions

In this study, we report for the first time the presence of β-lactamases in resistant bacteria isolated both from water environments and two species of stream invertebrates, which have different feeding traits. Freshwater ecosystems are particularly exposed to high levels of antibiotics and antibiotic-resistant genes/bacteria because of contaminated material mainly from treated and untreated sewage, hospital waste, and agricultural runoff.^4,6 Recently, Marti et al. have demonstrated the presence of ARB in three wild fish species inhabiting freshwater reservoirs downstream a WWTP.³¹ To our knowledge, the presence of ARGs and ARB in stream macroinvertebrates has never been demonstrated. However, the presence of ARB in freshwater organisms has rarely been investigated and ascertained. Eckert et al. demonstrated that during the grazing activity, some species of the lake zooplankton may acquire ARGs from bacteria present in the lake microbiota and may act as reservoirs and sources of infection for other aquatic organisms.³² The detritivore G. elvirae was positive for C. freundii strains, while multidrug-resistant A. veronii and A. hydrophila were isolated from the predator D. lineata. Therefore, we can assume that in contaminated freshwater habitats, ARB and ARGs could be disseminated through both autotrophic and heterotrophic food chains with important ecological implications. Transmission through the food chain may contribute to spreading and transferring antibiotic resistance not only in freshwater ecosystems but also outside the aquatic habitat through, for example, invertebrate/fish-feeding birds.³¹ The transfer of ARB through trophic links may also explain the presence of contamination in freshwater predatory fishes. In this case, freshwater fisheries may contribute to the transfer of multidrug-resistant bacteria to humans. Finally, the presence of ARB in fresh water may induce a compositional shift in the resident microbiota with important consequences on microbial-driven ecosystem processes and freshwater ecosystem services.^32,33 Further studies are needed to better elucidate the role and ecological impacts of ARB in fresh water.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by a grant to G.A. from RIA (University of L'Aquila).

References

Kumar

, and Pal

. 2018. Antibiotic resistance and wastewater: correlation, impact and critical human health challenges. J. Env. Chem. Eng. 6:52–58.

L.P.

, Li

, and Zhang

. 2014. Abundant rifampin resistance genes and significant correlations of antibiotic resistance genes and plasmids in various environments revealed by metagenomics analysis. Appl. Microbiol. Biotechnol. 98:5195–5204.

Martinez, J.L. 2009. Environmental pollution by antibiotics and by antibiotic resistance determinants. Environ. Pollut. 157:2893–2902.

Taylor

N.G.H.

, Verner-Jeffreys

D.W

, and Baker-Austin

. 2011. Aquatic systems: maintaining, mixing and mobilising antimicrobial resistance? Trends Ecol. Evol. 26:278–284.

Baquero

, Martinez

J.L

, and Cantón

. 2008. Antibiotics and antibiotic resistance in water environments. Curr. Opin. Biotechnol. 19:260–265.

Marti

, Variatza

, and Balcazar

J.L.

. 2014. The role of aquatic ecosystems as reservoirs of antibiotic resistance. Trends Microbiol. 22:36–41.

Karkman

, Do

T.T

, Walsh

, and Virta

M.P.J

. 2018. Antibiotic-resistance genes in waste water. Trends Microbiol. 26:220–228.

Marti

, Jofre

, and Balcazar

J.L.

. 2013. Prevalence of antibiotic resistance genes and bacterial community composition in a river influenced by a wastewater treatment plant. PLoS One, 8:e78906.

Iwane

, Urase

, and Yamamoto

. 2001. Possible impact of treated wastewater discharge on incidence of antibiotic resistant bacteria in river water. Water Sci. Technol. 43:91–99.

10.

Rizzo

, Manaia

, Merlin

, Schwartz

, Dagot

, Ploy

M.C

, Michael

, and Fatta-Kassinos

. 2013. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: a review. Sci. Total Environ. 447:345–360.

11.

Piccirilli

, Pompilio

, Rossi

, Segatore

, Amicosante

, Rosatelli

, Perilli

, and Di Bonaventura

. 2019. Identification of CTX-M-15 and CTX-M-27 in antibiotic-resistant Gram-negative bacteria isolated from three rivers running in Central Italy. Microb. Drug Resist. 25:1041–1049.

12.

Frost

L.S.

, Leplae

, Summers

A.O

, and Touissaint

. 2005. Mobile genetic elements: the agents of open source evolution. Nat. Rev. Microbiol. 3:722–732.

13.

Gillings, M.R. 2017. Class 1 integrons as invasive species. Curr. Opin. Microbiol. 38:10–15.

14.

Di Sabatino

, Cristiano

, Pinna

, Lombardo

, Miccoli

F.P

, Marini

, Vignini

, and Cicolani

. 2014. Structure, functional organization and biological traits of macroinvertebrate assemblages from leaf-bags and benthic samples in a third-order stream of Central Apennines (Italy). Ecol. Indic. 46:84–91.

15.

Pinna

, Marini

, Cristiano

, Mazzotta

, Vignini

, Cicolani

, and Di Sabatino

. 2016. Influence of aperiodic summer droughts on leaf litter breakdown and macroinvertebrate assemblages: testing the drying memory in a Central Apennines River (Aterno River, Italy). Hydrobiologia, 782:111–126.

16.

Sambrook

, MacCallum

, and Russell

. 2001. Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

17.

Clinical and Laboratory Standards Institute. 2018. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically. 11th ed. CLSI Standard M07. Wayne, PA.

18.

Clinical and Laboratory Standards Institute. 2016. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria. 3rd ed. CLSI Guideline M45. Wayne, PA.

19.

The European Committee on Antimicrobial Susceptibility Testing (EUCAST). 2019. Breakpoint tables for interpretation of MICs and zone diameters. Version 9.0. Available at: www.eucast.org

20.

Franceschini

, Perilli

, Segatore

, Setacci

, Amicosante

, Mazzariol

and Cornaglia

. 1998. Ceftazidime and aztreonam resistance in Providencia stuartii: characterization of a natural TEM-derived extended-spectrum β-lactamase, TEM-60. Antimicrob. Agents Chemother. 42:1459–1462.

21.

Rossolini

G.M.

, Walsh

, and Amicosante

. 1996. The Aeromonas metallo-beta-lactamases: genetics, enzymology, and contribution to drug resistance. Microb. Drug Resist. 2:245–252.

22.

Bottoni

, Marcoccia

, Compagnoni

, Colapietro

, Sabatini

, Celenza

, Segatore

, Maturo

M.G

, Amicosante

, and Perilli

. 2015. Identification of new natural CphA metallo-β-lactamases CphA4 and CphA5 in Aeromonas veronii and Aeromonas hydrophila isolates from municipal sewage in Central Italy. Antimicrob. Agents Chemother. 59:4990–4993.

23.

Bebrone

2007. Metallo-β-lactamases (classification, activity, genetic organization, structure, zinc coordination) and their superfamily. Biochem. Pharmacol. 74:1686–1701.

24.

Pellegrini

, Celenza

, Segatore

, Bellio

, Setacci

, Amicosante

, and Perilli

. 2011. Occurrence of class 1 and 2 integrons in resistant Enterobacteriaceae collected from an urban wastewater treatment plant: first report from Central Italy. Microb. Drug Resist. 17:229–234.

25.

Perilli

, Segatore

, Mugnaioli

, Celenza

, Rossolini

G.M

, Stefani

, Luzzaro

, Pini

, and Amicosante

. 2011. Persistence of TEM-52/TEM-92 and SHV-12 extended-spectrum β-lactamases in clinical isolates of Enterobacteriaceae in Italy. Microb. Drug Resist. 17:521–524.

26.

Chen

, Shang

, Hu

, Lao

, Gao

, Zheng

, and Yao

. 2013. β-Lactamase inhibitors: an update. Mini Rev. Med. Chem. 13:1846–1861.

27.

Poirel

, Jayol

and Nordmann

. 2017. Polymyxin: antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 30:557–596.

28.

Rosser

S.J.

, and Young

H.K.

. 1999. Identification and characterization of class 1 integrons in bacteria from an aquatic environment. J. Antimicrob. Chemother. 44:11–18.

29.

Pellegrini

, Mercuri

P.S

, Celenza

, Galleni

, Segatore

, Sacchetti

, Volpe

, Amicosante

, and Perilli

. 2009. Identification of bla(IMP-22) in Pseudomonas spp. in urban wastewater and nosocomial environments: biochemical characterization of a new IMP metallo-enzyme variant and its genetic location. J. Antimicrob. Chemother. 63:901–908.

30.

Perilli

, Bottoni

, Pontieri

, Segatore

, Celenza

, Setacci

, Bellio

, Strom

, and Amicosante

. 2013. Emergence of blaKPC-3-Tn4401a in Klebsiella pneumoniae ST512 in the municipal wastewater treatment plant and in the university hospital of a town in central Italy. J. Glob. Antimicrob. Resist. 1:217–220.

31.

Marti

, Huerta

, Rodríguez-Mozaz

, Barceló

, Marcé

, and Balcázar

J.L.

. 2018. Abundance of antibiotic resistance genes and bacterial community composition in wild freshwater fish species. Chemosphere, 196:115–119.

32.

Eckert

E.M.

, Di Cesare

, Stenzel

, Fontaneto

, and Corno

. 2016. Daphnia as a refuge for an antibiotic resistance gene in an experimental freshwater community. Sci. Tot. Environ. 571:77–81.

33.

Di Sabatino

, Coscieme

, Vignini

, and Cicolani

. 2014. Scale and ecological dependence of ecosystem services evaluation: spatial extension and economic value of freshwater ecosystems in Italy. Ecol. Indic. 32:259–263.