Oxacillinase Gene Distribution,Antibiotic Resistance,and Their Correlation with Biofilm Formation in Acinetobacter baumannii Bloodstream Isolates

Abstract

Objectives:

The limitations of treatment options in bloodstream infections caused by multidrug-resistant Acinetobacter baumannii (MDRAB) have been related to high morbidity and mortality. The aim of our present study was to determine antimicrobial susceptibility profiles, molecular resistance patterns, and biofilm properties of A. baumannii isolated from bloodstream infections.

Materials and Methods:

In the present study, a total of 44 A. baumannii bloodstream isolates were included. Antimicrobial susceptibility profiles and biofilm formation ability were assessed. The distribution of class D carbapenemases, ISAba1, ISAba1/blaOXA-23, blaNDM-1, mcr-1, and ompA was investigated by polymerase chain reaction (PCR). Arbitrarily primed-PCR (AP-PCR) was performed to evaluate clonal relationships.

Results:

A total of 32 isolates were MDRAB, whereas 6 isolates were also resistant to colistin without mcr-1 positivity. All isolates were harboring blaOXA-51 gene, whereas blaOXA-23 positivity was 63.6%. Fifty percent of the isolates had ISAba1. ISAba1 upstream of blaOXA-23 was determined in 18 isolates. None of the isolates were positive for blaNDM-1 gene. Majority of the strains were strong biofilm producers (86.8%). A total of 56.8% of the isolates were positive for ompA gene with no direct association with strong biofilm formation. However, blaOXA-51 + 23 genotype and trimethoprim–sulfamethoxazole resistance showed a significant relationship with biofilm formation. AP-PCR analysis revealed six distinct clusters of A. baumannii.

Conclusions:

Herein, majority of the A. baumannii blood isolates were characterized as blaOXA-51+OXA-23 carbapenemase genotype and were strong biofilm formers. None of the isolates were positive for blaNDM-1, which was promising. Resistant isolates were tended to form strong biofilms. Our results highlight the emergence of oxacillinase-producing MDRAB isolated from bloodstream with high biofilm formation ability.

Introduction

Acinetobacter baumannii is an important nosocomial pathogen, which is responsible for a wide range of infections with high morbidity and mortality rates.¹ In particular, bloodstream infections caused by A. baumannii have become a major clinical concern in clinical settings due to high rates of multidrug-resistant (MDR) phenotypes.² Overall mortality rates due to A. baumannii bloodstream infections have been reported between 34.0% and 43.4% in intensive care units.³

The increasing rates of multidrug-resistant strains of A. baumannii (MDRAB) have been reported worldwide. Resistance in Acinetobacter spp. may occur by chromosomal mutations or mobile genetic elements. The resistance mechanism mainly due to permeability changes in outer membrane proteins, activation of efflux pumps, and hydrolysis by β-lactamases.⁴

Class D carbapenemases are the main reason for increasing resistance rates in A. baumannii isolates, which mainly include acquired carbapenemases blaOXA-23, blaOXA-24, and blaOXA-58 as well as blaOXA-51, which is intrinsic to A. baumannii.⁵ The oxacillinase genes are usually associated with insertion sequences (IS).⁶ Class D carbapenemases, particularly blaOXA-23, are weak carbapenemases. However, mainly ISAba1 overexpresses the downstream located blaOXA-23 and enhances the hydrolyzing capacity of carbapenems.⁶ Moreover, the availability of IS leads to transfer of resistance genes.^7,8 Thus, the availability of IS in A. baumannii strains is also an important determinant in carbapenem-resistant A. baumannii (CRAB). Metallo-β-lactamases such as blaNDM-1 are also another major concern in MDRAB, however, in less frequency.⁵

Due to the limited treatment options, CRAB has become a major concern. Colistin, tigecycline, and fosfomycin are the last resort treatment options in CRAB bacteremia. Due to the increasing use of colistin to treat CRAB, colistin resistance has been emerged.⁵

Ability of biofilm formation on biotic and abiotic surfaces is one of the most important virulence factors of A. baumannii. Previous studies have reported an association between biofilm formation and antibiotic resistance in A. baumannii isolates.⁹ Outer membrane protein A (OmpA) is the major surface protein of A. baumannii, which involves in biofilm formation,¹⁰ adherence to epithelial cells, and inducing cytotoxicity,¹¹ and an important determinant of the mortality risk in bacteremia.¹²

Genotypic and phenotypic resistance patterns and biofilm formation characteristics are the main factors effecting progression of A. baumannii infections.^2,12 Accordingly, the aim of our present study was to determine antimicrobial susceptibility, distribution of molecular resistance genes and ompA, clonal relationship, and biofilm formation in A. baumannii bloodstream isolates.

Materials and Methods

Bacterial isolation

A total of 44 nonduplicated A. baumannii isolated from bloodstream infections in Hacettepe University Central Laboratory between September 2017 and November 2019 were included in the present study. Blood cultures were incubated in BD BACTEC Fx (Becton Dickinson, Maryland). Positive blood cultures were subjected to Gram staining and subcultured into 5% sheep blood agar, eosin methylene blue agar, and chocolate agar plates and incubated at 35°C for 24–28 hours in 5% CO₂. Recovered isolates were identified by conventional methods and Matrix-assisted Laser Desorption/Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF MS) (Bruker Daltonics, Germany) as A. baumannii.

Antimicrobial susceptibility testing

Antibiotic susceptibility profiles were determined by the Kirby–Bauer disk diffusion susceptibility test for ampicillin–sulbactam, ceftazidime, imipenem, meropenem, gentamicin, ciprofloxacin, piperacillin–tazobactam, trimethoprim–sulfamethoxazole, amikacin, cefepime, and netilmicin.¹³ MDRAB was defined as resistance to at least one antibiotic in three or more antimicrobial groups.⁴ Imipenem and meropenem resistance was also confirmed by antimicrobial gradient test and classified as carbapenem resistant if they were resistant to one or more carbapenems tested. Colistin resistance was determined by broth microdilution method, and European Committee on Antimicrobial Susceptibility Testing (EUCAST) colistin resistance breakpoint of >2 mg/L was used.¹⁴ Briefly, twofold serial dilutions of colistin sulfate (Sigma) were prepared ranging between 0.0625 and 64 μg/mL. Escherichia coli ATCC 25922 and mcr-1-positive E. coli NCTC 13846 were used as quality control strains.

Polymerase chain reaction amplification of antibiotic resistance genes

For bacterial DNA extraction, five to seven colonies were picked from fresh overnight cultures in Tryptic Soy Agar and suspended in 200 μL Tris-EDTA buffer. The tubes were then kept at 95°C for 15 minutes. After centrifugation at 10,000 rpm for 10 minutes, the supernatants containing sufficient concentration and good quality DNA were transferred into sterile micro tubes. Class D oxacillinases were determined by multiplex polymerase chain reaction (PCR). The PCR conditions and primers for amplification of carbapenemase-encoding genes including blaOXA-23-like, blaOXA-24-like, blaOXA-51-like, blaOXA-58-like, and blaNDM-1 were performed as previously described.^15,16 Colistin-resistant strains were also tested for the presence of mcr-1 gene as reported by Rebelo et al.,¹⁷ by using mcr-1-carrying E. coli NCTC 13846 isolate as positive control. A frequent insertion sequence ISAba1 was also analyzed.¹⁸ To detect the presence of ISAba1 located upstream of blaOXA-23, PCR amplification was carried out using the reverse primer of blaOXA-23 gene and forward primer of ISAba1 by using previously described primers and conditions.^19,20 Since prior studies showed the importance of OmpA in biofilm formation²¹ and its role in determining mortality in bacteremia,¹² ompA gene was also investigated. The specific primer pairs used in the study are presented in Table 1. Each amplicon was subjected to electrophoresis in 2% agarose gel. Amplified products were detected after staining with ethidium bromide (50 mg/L).

Table 1.

Primer Sequences Used in This Study

Importance	Gene	Forward (5′–3′)	Reverse (5′–3′)	References
Insertion sequence	ISAba1	CACGAATGCAGAAGTTG	CGACGAATACTATGACAC	¹⁸
OXA-23 with upstream-located ISAba1	ISAba1/blaOXA-23	CACGAATGCAGAAGTTG	ATTTCTGACCGCATTTCCAT	²⁰
Class D oxacillinases	blaOXA-23-like	GATCGGATTGGAGAACCAGA	ATTTCTGACCGCATTTCCAT	¹⁵
	blaOXA-24-like	TTCCCCTAACATGAATTTGT	GTACTAATCAAAGTTGTGAA	¹⁵
	blaOXA-51-like	TAATGCTTTGATCGGCCTTG	TGGATTGCACTTCATCTTGG	¹⁵
	blaOXA-58-like	TGGCACGCATTTAGACCG	AAACCCACATACCAACCC	¹⁵
Class B metallo-β-lactamase	blaNDM1	GGTTTGGCGATCTGGTTTTC	CGGAATGGCTCATCACGATC	¹⁶
Mobile colistin resistance	mcr-1	AGTCCGTTTGTTCTTGTGGC	AGATCCTTGGTCTCGGCTTG	¹⁷
Virulence, biofilm formation	ompA	CGCTTCTGCTGGTGCTGAAT	CGTGCAGTAGCGTTAGGGTA	²¹

Biofilm formation assay

Biofilm formation degree of A. baumannii isolates was determined using a microplate assay as previously described with slight modifications.²² Briefly, overnight A. baumannii cultures in Tryptic Soy Broth (TSB) were diluted to obtain 10⁷ cfu/mL cell suspension. One hundred microliters of aliquots of cell suspension were added to each well. The plates were subsequently incubated at 37°C for 24 hours. The same amount of sterile TSB was added to top and bottom rows to avoid edge effects. After washing nonadherent cells, biofilms were stained with 0.1% crystal violet for 20 minutes and stained biofilms were solubilized with 33% acetic acid. Optical densities (OD) were measured at 570 nm. The OD570 values of uninoculated wells were used as a negative control. Biofilm assay was carried out in duplicates. Strains were classified as follows: non-biofilm producer (OD < ODc), weak biofilm producer (ODc < OD ≤2 × ODc), moderate biofilm producer (2 × ODc < OD <4 × ODc), and strong biofilm producer (4 × ODc < OD).⁹ Biofilm-producing strain of Pseudomonas aeruginosa PA01 was used as positive control.

DNA fingerprinting by arbitrarily primed PCR

Clonal relatedness of the isolates was determined using arbitrarily primed PCR (AP-PCR). Since AP-PCR does not require any particular sequence,²³ we used M13 universal primers for random amplification (5′-GTAAAACGACGGCCAGTG-3′ and 5′-CAGGAAACAGCTATGACCATG-3′). Reaction mixture was prepared in 25 μL final volume containing 10 × PCR buffer, 2.5 mM MgCl₂, 2.5 mM dNTP mix, 2.5 mmol of each primer, and 2.5 U Taq polymerase (SibEnzyme). Amplification reactions include an initial denaturation (4 minutes at 95°C), followed by 8 cycles (94°C for 30 seconds, 37°C for 1 minute, 72°C for 2 minutes) and 35 cycles of denaturation (30 seconds at 94°C), annealing (1 minute at 60°C), and extension (2 minutes at 72°C), with a single final extension of 5 minutes at 72°C. Each amplicon was subjected to electrophoresis in 1.8% agarose gel. Amplified products were detected after staining with ethidium bromide (50 mg/L). The DNA fragments were visualized, and gel images were analyzed with the GelJ software v.2.0.²⁴ The dendrogram was constructed by unweighted pair-group method with arithmetic mean. Dice coefficient with a 2% band tolerance was used. Isolates were considered within the same clone if they had higher than 90% similarity.

Statistical analysis

Data are expressed as percentage and mean ± standard deviation of the mean. Comparison of the mean OD570 values for biofilm formation between the groups was performed with the nonparametric Mann–Whitney U test or Kruskal–Wallis test with Dunn's multiple comparison testing, where appropriate. Correlation analysis was performed using the Spearman rank correlation since the variables are not normally distributed. p-Values of <0.05 was considered as significant.

Results

Antimicrobial susceptibility of the isolates

All bloodstream isolates included in the study were identified as A. baumannii by MALDI-TOF MS. A total of 32 isolates were defined as MDRAB according to antimicrobial susceptibility profiles (Table 2). Of the 44 bloodstream isolates, resistance rates for tested antibiotics were as follows: 72.7% for ampicillin–sulbactam, imipenem, meropenem, ciprofloxacin, piperacillin–tazobactam, cefepime, netilmicin; 75.0% for ceftazidime; 70.5% for gentamicin; 81.8% for trimethoprim–sulfamethoxazole, and 68.2% for amikacin.

Table 2.

Antimicrobial Susceptibility Patterns of Acinetobacter baumannii Bloodstream Isolates (Number of Isolates)

Antimicrobial groups	Antimicrobials	Susceptible	Intermediate	Resistant
Penicillin combination	Ampicillin–sulbactam	12	0	32
Penicillin combination	Piperacillin–tazobactam	11	1	32
Carbapenem	Imipenem	12	0	32
Carbapenem	Meropenem	12	0	32
Cephalosporin	Ceftazidime	1	10	33
Cephalosporin	Cefepime	12	0	32
Sulfonamide	TMP/SMX	8	0	36
Aminoglycoside	Gentamicin	13	0	31
	Netilmicin	12	0	32
	Amikacin	14	0	30
Fluoroquinolone	Ciprofloxacin	3	9	32
Polymyxin	Colistin	38	NA	6

Antimicrobial susceptibility testing was determined by Phoenix™ 100 (Becton Dickinson). Imipenem and meropenem resistance was further confirmed by antimicrobial gradient test. Colistin resistance was determined by broth microdilution method.

NA, not applicable; TMP/SMX, trimethoprim–sulfamethoxazole.

According to broth microdilution results, six isolates were determined as colistin resistant (13.6%). All colistin-resistant isolates were resistant to all tested antibiotics. None of the colistin-resistant isolates were harboring mcr-1 gene.

Molecular detection of antibiotic resistance genes and ompA

PCR analysis for class D β-lactamases revealed that all isolates were harboring intrinsic blaOXA-51 gene as expected.²⁵ None of the isolates were positive for blaOXA-58 and blaOXA-24 genes. blaOXA-23 gene was found in 28 of the 44 A. baumannii bloodstream isolates (63.6%). However, when we only consider carbapenem-resistant isolates, 87.5% of them were positive for blaOXA-23 gene (Supplementary Fig. S1).

Insertion sequence ISAba1 gene was present in 22 isolates (50.0%). Thus, we further ask the question if blaOXA-23 was located in the downstream of ISAba1 or not. By using the forward primer for ISAba1 and reverse primer for blaOXA-23, ISAba1 upstream of blaOXA-23 was determined in 18 isolates of 28 blaOXA-23-positive isolates (64.3%). All blaOXA-23-positive strains and ISAba1/blaOXA-23-positive strains were resistant to carbapenems.

None of the isolates were harboring mobile plasmid-mediated colistin resistance gene mcr-1 and blaNDM-1. ompA gene was determined in 25 isolates (56.8%). Among ompA-positive strains, 21 of them were MDRAB.

Biofilm formation

According to the microtiter plate biofilm assay, among the 44 tested isolates, only 3 isolates (6.8%) were not biofilm producers (OD570: 0.10 ± 0.02), 5 isolates (11.4%) were moderate biofilm formers (OD570: 0.34 ± 0.07), and 36 isolates (86.8%) were strong biofilm formers (OD570: 1.44 ± 0.62) (Supplementary Fig. S2). Among 32 MDRAB, 24 were strong and 5 were moderate biofilm formers, whereas 3 of them were not biofilm formers. All 12 non-MDRAB isolates were strong biofilm formers.

Next, we aimed to determine the relationship between the biofilm formation ability and antimicrobial susceptibility to representative antibiotic agents covering penicillin combination, carbapenem, cephalosporin, sulfonamide, aminoglycoside, fluoroquinolone, and polymyxin groups (Fig. 1A–L). Due to the substantial differences in sample size, only one isolate was intermediate resistant to piperacillin–tazobactam (Fig. 1B) and one isolate was susceptible to ceftazidime (Fig. 1E), we exclude these groups form group comparisons. For all tested antibiotics, resistant isolates tended to form strong biofilms according to their OD570 values, except for colistin. The isolates resistant to trimethoprim–sulfamethoxazole showed significantly higher OD570 values for the biofilm formation ability when compared with susceptible isolates (p = 0.01; Fig. 1G). We also conducted a correlation analysis between biofilm formation ability and antimicrobial susceptibility profiles. There was a significant positive correlation between the biofilm formation ability and trimethoprim–sulfamethoxazole resistance (r = 0.38, p = 0.01). Resistance to all tested antimicrobials was positively correlated with biofilm formation, except colistin (r = −0.07, p = 0.67), however, not significant.

FIG. 1.

Comparison of biofilm formation capability and different antibiotic resistance phenotypes (A–L). Group comparisons were performed using the nonparametric Mann–Whitney U test or Kruskal–Wallis, where appropriate; *p < 0.05.

Among 25 ompA-positive strains, 20 of them (80.0%) were strong biofilm formers, whereas 4 of them were moderate and 1 of them was none biofilm former. Moreover, 17 of 19 ompA-negative isolates were strong biofilm formers, whereas 2 of them were none biofilm formers (Table 3). There was no significant relationship between ompA positivity and OD570 values indicating the biofilm formation ability (p = 0.79; Fig. 2A).

FIG. 2.

Correlation of ompA (A) and oxacillinase genotype (B,C) with biofilm formation. Group comparisons were performed using the nonparametric Mann–Whitney U test; *p < 0.05.

Table 3.

Distribution of the Isolates According to Biofilm Formation Ability and Specific Gene Positivity

	Biofilm ability No. (%) of the isolates			Total
	None	Moderate	Strong	Total
blaOXA-51
+	3 (6.8)	5 (11.4)	36 (81.8)	44
−	0	0	0	0
blaOXA-23
+	0	2 (12.5)	14 (87.5)	16
−	3 (10.7)	3 (10.7)	22 (78.6)	28
ISAba1
+	2 (9.1)	5 (22.7)	15 (68.2)	22
−	1 (4.5)	0	21 (95.5)	22
ompA
+	1 (4.0)	4 (16.0)	20 (80.0)	25
−	2 (10.5)	0	17 (89.5)	19

Since our results highlight the dissemination of blaOXA-23, we also investigated the relationship between blaOXA-23 and biofilm formation ability. blaOXA-23-positive isolates had significantly higher biofilm formation ability according to OD570 values (p = 0.01; Fig. 2B). However, there was no significant relationship between ISAba1/blaOXA-23 strains and biofilm formation (p = 0.51; Fig. 2C). Distribution of the isolates according to the biofilm formation ability and presence or absence of a specific gene is presented in Table 3.

Clonal diversity

Dendrogram was constructed according to AP-PCR patterns (Supplementary Fig. S3). The genotypic and phenotypic characteristics of the isolates are presented in the dendrogram in Fig. 3. A total of 44 bloodstream isolates revealed 11 different clones with 90% similarity cutoff value. At 100% similarity level, there were 22 different clones. We found that 39 isolates were clonally related, which were gathered in 6 clusters with a tolerance of 2% and a cutoff value of 90% similarity. The numbers of the isolates in each cluster were ranging between 2 and 17 (cluster A, n = 2; cluster B, n = 4; cluster C, n = 17; cluster D, n = 6; cluster E, n = 3; cluster F, n = 7). All four isolates in cluster B had 100% similarity. The largest cluster was cluster C. In cluster F, all the isolates were MDR, blaOXA-51 and blaOXA-23 positive, harboring ISAba1, and all of them were located upstream of blaOXA-23. Moreover, cluster F isolates were all ompA positive, and all of them were strong biofilm formers except one isolate. The isolation dates for cluster F was within 1 month. The other clusters did not reveal a specific genotype or phenotype. All six colistin-resistant isolates were within a cluster: three of them were in cluster C, two of them were in cluster F, and one of them was in cluster D.

FIG. 3.

Dendrogram of the Acinetobacter baumannii isolates. The clusters were named with uppercase letters (A–F). Genotypic and phenotypic characteristics of the isolates were presented for individual strains.

Discussion

Higher prevalence rates of MDRAB have become a major problem worldwide particularly in intensive care units.² Therefore, it is important to define genotypic and phenotypic characteristics of the MDRAB isolates as a part of infection control measures. In addition to the antimicrobial susceptibility profiles, biofilm formation ability of a clinical isolate is also of importance, because biofilm formation is one of the main determinants of virulence affecting treatment options.⁹ Majority of the studies on genotypic and phenotypic characterization of A. baumannii clinical isolates were involving isolates from various clinical samples.^8,21,26,27 In this present prospective single-center study, we only included bloodstream isolates of A. baumannii. Herein, we defined 32 of the 44 bloodstream isolates as MDRAB, and 6 isolates were also resistant to colistin. Majority of the isolates were strong biofilm formers. blaOXA-51 and blaOXA-23 were the major responsible oxacillinases in our study population.

Colistin (polymyxin E) has been considered as the last resort treatment in infections caused by MDR gram-negative bacteria due to its neurotoxicity and nephrotoxicity.²⁸ However, it has become an increasingly important treatment option for carbapenem-resistant gram-negative bacteria.²⁸ Colistin resistance rates in A. baumannii were not as high as observed in Klebsiella pneumoniae isolates in Turkey²⁹ and Europe.³⁰ We found a colistin resistance rate of 13.6% by microdilution method in our present study. In a recent study from Hungary, colistin resistance rate of 2.6% for A. baumannii blood culture isolates was reported.³¹ In another recent study on A. baumannii bloodstream infections from a Greek university hospital, colistin resistance rate was reported as high as 42%.³² None of the isolates were harboring plasmid-mediated colistin resistance in our study. Therefore, the resistance to colistin might be mainly due to chromosomal mutations in PmrA/PmrB two-component system³³ or other less frequent mechanisms including efflux pumps³⁴ and complete loss of lipopolysaccharide.³⁵

Oxacillinases are the major enzymes involved in antibiotic resistance in A. baumannii strains.³⁶ In our present study, all A. baumannii isolates had intrinsic blaOXA-51 gene, whereas 63.6% of them were harboring blaOXA-23 gene and none of them were positive for blaOXA-58 and blaOXA-24. These findings are also similar with other studies, which reported the most prevalent oxacillinases in A. baumannii as blaOXA-51 and blaOXA-23 worldwide with various prevalence rates between geographical regions.^26,37

Similar to our previous findings, other recent studies from Turkey also reported that all clinical A. baumannii isolates were harboring blaOXA-51 gene. However, blaOXA-23 prevalence was reported between 94% and 97% in those studies.^27,38 We also did not determine blaNDM-1 in any of the isolates. This finding is consistent with another recent study from our country.³⁸ Moreover, we also showed the significant relationship between blaOXA-23 genotype and biofilm formation, which is consistent with a previous study on MDRAB isolates from various clinical samples.³⁹

The dissemination of blaOXA-23-producing MDRAB isolates has been reported worldwide, including Turkey.^26,27 It has been known that the expression of oxacillinases might be increased by ISAba1 sequence upstream of blaOXA-23 gene.⁸ We found that ISAba1 was located upstream of the blaOXA-23 gene in 18 of 28 blaOXA-23-positive isolates. Moreover, all blaOXA-23-positive isolates with or without upstream-located ISAba1 showed resistance to carbapenems. It should also be noted that OXA-23-positive isolates without upstream-located ISAba1 could be susceptible to carbapenems indicating the nonfunctional expression of oxacillinase.⁴⁰

Higher prevalence rates for ISAba1/blaOXA-23 have been reported from a recent study in which majority of the A. baumannii isolates were from respiratory tract.⁸ Since majority of our isolates were carbapenem resistant (32/44), the relatively low prevalence of blaOXA-23 and ISAba1/blaOXA-23 is surprising. However, this can be explained by coexistence of other resistance mechanisms in these strains.

Similar to our present findings, majority of the studies also reported 100% prevalence rates for chromosomally encoded blaOXA-51 in both Turkey²⁷ and worldwide.³⁷ These findings support the previous studies that blaOXA-51 gene can be used as a supplementary tool for identification of A. baumannii.²⁵

To prevent the spread of A. baumannii in clinical settings, it is important to determine its origins and transmission routes.⁴¹ We also performed AP-PCR analysis to determine clonally related isolates. It was noteworthy that all the isolates in one of the dominant cluster (cluster F) were carrying blaOXA-51 and blaOXA-23 with an upstream-located ISAba1. Moreover, all the isolates in this cluster were MDR, and two of them were colistin resistant. Since the isolation dates were closer for that cluster, it might be considered as a small clonal spread within the intensive care unit.

Bacteremia caused by A. baumannii is mostly caused by intravascular and respiratory tract catheters.¹ Thus, it is important to determine biofilm characteristics of A. baumannii isolates since the biofilm formation ability plays an important role in the host–bacteria interaction and infection outcome.⁴² As expected, majority of the isolates were biofilm formers in our study. In addition, we determined a high rate of strong biofilm formation (86.8%) when compared with other reported rates in the literature for A. baumannii.^43,44 However, it should be noted that we used a static assay for biofilm formation. Continuous flow systems might result in less biofilm formation when compared with static models, as previously reported.⁴⁵

The relationship between biofilm formation capability and antibiotic resistance phenotypes remains controversial.⁴² While some of the studies demonstrated that the biofilm formation ability was positively correlated with resistance,^9,46 some other studies showed that MDR strains tended to form weak biofilms.^47,48 In our present study, we investigated the association of biofilm formation capability with individual antibiotic phenotypes. We determined a significant positive correlation between trimethoprim–sulfamethoxazole resistance and biofilm formation ability. For other antibiotics, resistant isolates were tended to form stronger biofilms except for colistin. This might be due to substantial differences in number of resistant and susceptible isolates since there was only six colistin-resistant isolates. Our results are consistent with those of Yang et al.,⁴⁴ as both studies showed the tendency for stronger biofilm formation in resistant isolates and a significant positive correlation between the biofilm formation ability and resistance to trimethoprim–sulfamethoxazole.

While our antimicrobial susceptibility results were only covering planktonic cells, it should be noted that the minimum biofilm eradication concentration values might be much higher than the minimum inhibitory concentrations determined in our study, as previously reported.⁴⁹ Da Cunda et al.⁵⁰ investigated a colistin- and gentamicin-susceptible isolate of A. baumannii and reported that none of the antibiotics were sufficient in eradication of the biofilm stage.

OmpA is a prominent surface protein in A. baumannii, which is involved in drug resistance, adhesion to epithelial cells and abiotic surfaces, and biofilm formation.¹⁰ It has been previously shown that OmpA is a risk factor for the mortality rate in bacteremia caused by A. baumannii.¹² Considering its importance in bloodstream isolates, we also investigated ompA gene positivity rates, which was relatively lower (56.8%) when compared with the reported rates in the literature (91–100%).^21,44 Moreover, the biofilm formation ability was not significantly different between ompA-positive and ompA-negative isolates. There have been conflicting results and no clear evidence to ascertain the essential role of OmpA in biofilm formation.^10,44,51 In a study in which 154 A. baumannii strains were tested for the biofilm formation ability, it was found that 45.4% were strong biofilm formers. Moreover, ompA gene was present in 91.6% of the isolates they tested and they found that ompA-positive strains tended to form strong biofilm than the negative isolates.⁴⁴ However, these findings are mostly from A. baumannii isolated from various clinical samples. The role of OmpA might be dependent on the clinical origin of the strain. Besides our majority of the isolates were strong biofilm formers, evidence from the previous literature⁵¹ and our present findings suggests that OmpA may not have an essential role in biofilm formation in blood isolates.

In our present study, we characterized the A. baumannii bloodstream isolates for their antimicrobial susceptibility, major resistance genotypes, and biofilm properties along with OmpA distribution. Moreover, we also showed the significant correlation of trimethoprim–sulfamethoxazole resistance and biofilm formation. Majority of the studies on this field were focusing on various sample sites for A. baumannii characterization. Thus, our present findings may contribute to the current literature on bloodstream infections of A. baumannii.

We acknowledge the following limitations of our study. First, our sample size was relatively small, and only 72.7% of them were MDRAB. However, bloodstream isolates are rare when compared with other clinical sites and we included nonduplicated A. baumannii isolates. Second, we did not screened for all possible resistance and biofilm-related genes, such as efflux pump genes adeABC and adeJK, or bapA for the biofilm formation ability. None of the isolates were harboring mcr-1; however, we did not confirm the PmrA/PmrB mutations, which was likely to be the main colistin resistance mechanism in our A. baumannii isolates.

Conclusions

In conclusion, our present findings highlight the dissemination of blaOXA-23 gene in A. baumannii bloodstream isolates. The emergence of oxacillinase-producing MDRAB bloodstream isolates, with high virulence characteristics such as strong biofilm formation ability, underscores the importance of screening and early detection of these strains. Moreover, most of the oxacillinase genes are located in highly mobile genetic elements. The screening for oxacillinases and metallo-β-lactamases is of importance to control dissemination of these strains as a part of nosocomial infection control measures.

Footnotes

Acknowledgment

We would like to acknowledge Public Health Institution of Turkey, National Antimicrobial Resistance Laboratory, for providing E. coli NCTC 13846.

Disclosure Statement

No competing financial interests exist.

Funding Information

No funding was received for this article.

Supplementary Material

References

Almasaudi, S.B. 2018. Acinetobacter spp. as nosocomial pathogens: epidemiology and resistance features. Saud. J. Biol. Sci. 25:586–596.

Smolyakov

, Borer

, Riesenberg

, Schlaeffer

, Alkan

, Porath

, Rimar

, Almog

, and Gilad

. 2003. Nosocomial multi-drug resistant Acinetobacter baumannii bloodstream infection: risk factors and outcome with ampicillin-sulbactam treatment. J. Hosp. Infect. 54:32–38.

Garnacho-Montero

, Amaya-Villar

, Ferrandiz-Millon

, Diaz-Martin

, Lopez-Sanchez

J.M

, and Gutierrez-Pizarraya

. 2015. Optimum treatment strategies for carbapenem-resistant Acinetobacter baumannii bacteremia. Expert Rev. Anti Infect. Ther. 13:769–777.

Magiorakos

A.P.

, Srinivasan

, Carey

R.B

, Carmeli

, Falagas

M.E

, Giske

C.G

, Harbarth

, Hindler

J.F

, Kahlmeter

, Olsson-Liljequist

, Paterson

D.L

, Rice

L.B

, Stelling

, Struelens

M.J

, Vatopoulos

, Weber

J.T

, and Monnet

D.L.

. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18:268–281.

Clark

N.M.

, Zhanel

G.G

, and Lynch

J.P

, 3rd. 2016. Emergence of antimicrobial resistance among Acinetobacter species: a global threat. Curr. Opin. Crit. Care, 22:491–499.

Turton

J.F.

, Ward

M.E

, Woodford

, Kaufmann

M.E

, Pike

, Livermore

D.M

, and Pitt

T.L.

. 2006. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol. Lett. 258:72–77.

Viana

G.F.

, Zago

M.C

, Moreira

R.R

, Zarpellon

M.N

, Menegucci

T.C

, Cardoso

C.L

, and Tognim

M.C.

. 2016. ISAba1/blaOXA-23: a serious obstacle to controlling the spread and treatment of Acinetobacter baumannii strains. Am. J. Infect. Control, 44:593–595.

Meshkat

, Amini

, Sadeghian

, and Salimizand

. 2019. ISAba1/blaOXA-23-like family is the predominant cause of carbapenem resistance in Acinetobacter baumannii and Acinetobacter nosocomialis in Iran. Infect. Genet. Evol. 71:60–66.

Bardbari

A.M.

, Arabestani

M.R

, Karami

, Keramat

, Alikhani

M.Y

, and Bagheri

K.P.

. 2017. Correlation between ability of biofilm formation with their responsible genes and MDR patterns in clinical and environmental Acinetobacter baumannii isolates. Microb. Pathog. 108:122–128.

10.

Gaddy

J.A.

, Tomaras

A.P

, and Actis

L.A.

. 2009. The Acinetobacter baumannii 19606 OmpA protein plays a role in biofilm formation on abiotic surfaces and in the interaction of this pathogen with eukaryotic cells. Infect. Immun. 77:3150–3160.

11.

Choi

C.H.

, Hyun

S.H

, Lee

J.Y

, Lee

J.S

, Lee

Y.S

, Kim

S.A

, Chae

J.P

, Yoo

S.M

, and Lee

J.C.

. 2008. Acinetobacter baumannii outer membrane protein A targets the nucleus and induces cytotoxicity. Cell Microbiol. 10:309–319.

12.

Sanchez-Encinales

, Alvarez-Marin

, Pachon-Ibanez

M.E

, Fernandez-Cuenca

, Pascual

, Garnacho-Montero

, Martinez-Martinez

, Vila

, Tomas

M.M

, Cisneros

J.M

, Bou

, Rodriguez-Bano

, Pachon

, and Smani

. 2017. Overproduction of outer membrane protein A by Acinetobacter baumannii as a risk factor for nosocomial pneumonia, bacteremia, and mortality rate increase. J. Infect. Dis. 215:966–974.

13.

Clinical and Laboratory Standards Institute [CLSI]. 2006. Performance Standards for Antimicrobial Disk Susceptibility Tests. Approved Standard. 9th ed. M2–A9. CLSI, Wayne, PA.

14.

European Committee on Antimicrobial Susceptibility Testing (EUCAST).. 2016. Recommendations for MIC determination of colistin (polymyxin E). As recommended by the joint CLSIEUCAST Polymyxin Breakpoints Working Group. Växjö: EUCAST. Available at www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/General_documents/Recommendations_for_MIC_determination_of_colistin_March_2016.pdf (accessed March 15, 2020).

15.

Hou

, and Yang

. 2015. Drug-resistant gene of blaOXA-23, blaOXA-24, blaOXA-51 and blaOXA-58 in Acinetobacter baumannii. Int. J. Clin. Exp. Med. 8:13859–13863.

16.

Nordmann

, Poirel

, Carrer

, Toleman

M.A

, and Walsh

T.R.

. 2011. How to detect NDM-1 producers. J. Clin. Microbiol. 49:718–721.

17.

Rebelo

A.R.

, Bortolaia

, Kjeldgaard

J.S

, Pedersen

S.K

, Leekitcharoenphon

, Hansen

I.M

, Guerra

, Malorny

, Borowiak

, Hammerl

J.A

, Battisti

, Franco

, Alba

, Perrin-Guyomard

, Granier

S.A

, Escobar

C.D.F

, Malhotra-Kumar

, Villa

, Carattoli

, and Hendriksen

R.S.

. 2018. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro Surveill. 23:17-00672.

18.

Segal

, Garny

, and Elisha

B.G.

. 2005. Is IS(ABA-1) customized for Acinetobacter? FEMS Microbiol. Lett. 243:425–429.

19.

Hong

S.B.

, Shin

K.S

, Ha

, and Han

. 2013. Co-existence of blaOXA-23 and armA in multidrug-resistant Acinetobacter baumannii isolated from a hospital in South Korea. J. Med. Microbiol. 62:836–844.

20.

Royer

, de Campos

P.A

, Araujo

B.F

, Ferreira

M.L

, Goncalves

I.R

, Batistao

, Brigido

, Cerdeira

L.T

, Machado

L.G

, de Brito

C.S

, Gontijo-Filho

P.P

, and Ribas

R.M.

. 2018. Molecular characterization and clonal dynamics of nosocomial blaOXA-23 producing XDR Acinetobacter baumannii. PLoS One, 13:e0198643.

21.

Handal

, Qunibi

, Sahouri

, Juhari

, Dawodi

, Marzouqa

, and Hindiyeh

. 2017. Characterization of Carbapenem-Resistant Acinetobacter baumannii Strains Isolated from Hospitalized Patients in Palestine. Int. J. Microbiol. 2017:8012104.

22.

Stepanovic

, Vukovic

, Dakic

, Savic

, and Svabic-Vlahovic

. 2000. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods, 40:175–179.

23.

Welsh

, and McClelland

. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18:7213–7218.

24.

Heras

, Dominguez

, Mata

, Pascual

, Lozano

, Torres

, and Zarazaga

. 2015. GelJ—a tool for analyzing DNA fingerprint gel images. BMC Bioinformatics, 16:270.

25.

Howard

, O'Donoghue

, Feeney

, and Sleator

R.D.

. 2012. Acinetobacter baumannii: an emerging opportunistic pathogen. Virulence, 3:243–250.

26.

, Duan

, Peng

, and Rui

. 2019. Molecular characteristics of carbapenem-resistant Acinetobacter spp. from clinical infection samples and fecal survey samples in Southern China. BMC Infect. Dis. 19:900.

27.

Asgin

, Otlu

, Cakmakliogullari

E.K

, and Celik

. 2019. High prevalence of TEM, VIM, and OXA-2 beta-lactamases and clonal diversity among Acinetobacter baumannii isolates in Turkey. J. Infect. Dev. Ctries. 13:794–801.

28.

Falagas

M.E.

, and Kasiakou

S.K.

. 2005. Colistin: the revival of polymyxins for the management of multidrug-resistant gram-negative bacterial infections. Clin. Infect. Dis. 40:1333–1341.

29.

Kocak

C.O.

, and Hazirolan

. 2019. Colistin resistance in carbapenem-resistant Klebsiella pneumoniae clinical isolates. Turk. Mikrobiyoloji Cem. Derg. 49:17–23.

30.

Capone

, Giannella

, Fortini

, Giordano

, Meledandri

, Ballardini

, Venditti

, Bordi

, Capozzi

, Balice

M.P

, Tarasi

, Parisi

, Lappa

, Carattoli

, and Petrosillo

. 2013. High rate of colistin resistance among patients with carbapenem-resistant Klebsiella pneumoniae infection accounts for an excess of mortality. Clin. Microbiol. Infect. 19:E23–E30.

31.

Juhasz

, Ivan

, Pinter

, Pongracz

, and Kristof

. 2017. Colistin resistance among blood culture isolates at a tertiary care centre in Hungary. J. Glob. Antimicrob. Resist. 11:167–170.

32.

Papathanakos

, Andrianopoulos

, Papathanasiou

, Priavali

, Koulenti

, and Koulouras

. 2020. Colistin-resistant Acinetobacter baumannii bacteremia: a serious threat for critically ill patients. Microorganisms, 8:287.

33.

Adams

M.D.

, Nickel

G.C

, Bajaksouzian

, Lavender

, Murthy

A.R

, Jacobs

M.R

, and Bonomo

R.A.

. 2009. Resistance to colistin in Acinetobacter baumannii associated with mutations in the PmrAB two-component system. Antimicrob. Agents Chemother. 53:3628–3634.

34.

Lin

M.F.

, Lin

Y.Y

, and Lan

C.Y.

. 2017. Contribution of EmrAB efflux pumps to colistin resistance in Acinetobacter baumannii. J. Microbiol. 55:130–136.

35.

Moffatt

J.H.

, Harper

, Harrison

, Hale

J.D

, Vinogradov

, Seemann

, Henry

, Crane

, St Michael

, A.D. Cox

, Adler, Nation

R.L

, Li

, Boyce

J.D

. 2010. Colistin resistance in Acinetobacter baumannii is mediated by complete loss of lipopolysaccharide production. Antimicrob. Agents Chemother. 54:4971–4977.

36.

Zarrilli

, Giannouli

, Tomasone

, Triassi

, and Tsakris

. 2009. Carbapenem resistance in Acinetobacter baumannii: the molecular epidemic features of an emerging problem in health care facilities. J. Infect. Dev. Ctries. 3:335–341.

37.

Wang

T.H.

, Leu

Y.S

, Wang

N.Y

, Liu

C.P

, and Yan

T.R.

. 2018. Prevalence of different carbapenemase genes among carbapenem-resistant Acinetobacter baumannii blood isolates in Taiwan. Antimicrob. Resist. Infect. Control, 7:123.

38.

Boral

, Unaldi

, Ergin

, Durmaz

, Eser; and Acinetobacter Study Group

O.K

. 2019. A prospective multicenter study on the evaluation of antimicrobial resistance and molecular epidemiology of multidrug-resistant Acinetobacter baumannii infections in intensive care units with clinical and environmental features. Ann. Clin. Microbiol. Antimicrob. 18:19.

39.

Avila-Novoa

M.G.

, Solis-Velazquez

O.A

, Rangel-Lopez

D.E

, Gonzalez-Gomez

J.P

, Guerrero-Medina

P.J

, and Gutierrez-Lomeli

. 2019. Biofilm formation and detection of fluoroquinolone- and carbapenem-resistant genes in multidrug-resistant Acinetobacter baumannii. Can. J. Infect. Dis. Med. Microbiol. 2019:3454907.

40.

Kobs

V.C.

, Ferreira

J.A

, Bobrowicz

T.A

, Ferreira

L.E

, Deglmann

R.C

, Westphal

G.A

, and Franca

P.H.

. 2016. The role of the genetic elements bla oxa and IS Aba 1 in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex in carbapenem resistance in the hospital setting. Rev. Soc. Bras. Med. Trop. 49:433–440.

41.

Villalon

, Valdezate

, Medina-Pascual

M.J

, Rubio

, Vindel

, and Saez-Nieto

J.A.

. 2011. Clonal diversity of nosocomial epidemic Acinetobacter baumannii strains isolated in Spain. J. Clin. Microbiol. 49:875–882.

42.

Eze

E.C.

, Chenia

H.Y

, and El Zowalaty

M.E.

. 2018. Acinetobacter baumannii biofilms: effects of physicochemical factors, virulence, antibiotic resistance determinants, gene regulation, and future antimicrobial treatments. Infect. Drug Resist. 11:2277–2299.

43.

, Li

, Zhang

, Liang

, Li

, Wang

, Du

, Liu

, Qiu

, and Song

. 2016. Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii. Front. Microbiol. 7:483.

44.

Yang

C.H.

, Su

P.W

, Moi

S.H

, and Chuang

L.Y.

. 2019. Biofilm formation in Acinetobacter baumannii: genotype-phenotype correlation. Molecules, 24:1849.

45.

Tomaras

A.P.

, Dorsey

C.W

, Edelmann

R.E

, and Actis

L.A.

. 2003. Attachment to and biofilm formation on abiotic surfaces by Acinetobacter baumannii: involvement of a novel chaperone-usher pili assembly system. Microbiology, 149:3473–3484.

46.

Gurung

, Khyriem

A.B

, Banik

, Lyngdoh

W.V

, Choudhury

, and Bhattacharyya

. 2013. Association of biofilm production with multidrug resistance among clinical isolates of Acinetobacter baumannii and Pseudomonas aeruginosa from intensive care unit. Indian J. Crit. Care Med. 17:214–218.

47.

Amin

, Navidifar

, Shooshtari

F.S

, Rashno

, Savari

, Jahangirmehr

, and Arshadi

. 2019. Association between biofilm formation, structure, and the expression levels of genes related to biofilm formation and biofilm-specific resistance of Acinetobacter baumannii strains isolated from burn infection in Ahvaz, Iran. Infect. Drug Resist. 12:3867–3881.

48.

Perez, L.R. 2015. Acinetobacter baumannii displays inverse relationship between meropenem resistance and biofilm production. J. Chemother. 27:13–16.

49.

Wang

Y.C.

, Huang

T.W

, Yang

Y.S

, Kuo

S.C

, Chen

C.T

, Liu

C.P

, Liu

Y.M

, Chen

T.L

, Chang

F.Y

, Wu

S.H

, How

C.K

, and Lee

Y.T.

. 2018. Biofilm formation is not associated with worse outcome in Acinetobacter baumannii bacteraemic pneumonia. Sci. Rep. 8:7289.

50.

Da Cunda

, Iribarnegaray

, Papa-Ezdra

, Bado

, Gonzalez

M.J

, Zunino

, Vignoli

, and Scavone

. 2020. Characterization of the different stages of biofilm formation and antibiotic susceptibility in a clinical Acinetobacter baumannii strain. Microb. Drug Resist. 26:569–575.

51.

Vijayakumar

, Rajenderan

, Laishram

, Anandan

, Balaji

, and Biswas

. 2016. Biofilm formation and motility depend on the nature of the Acinetobacter baumannii clinical isolates. Front. Public Health, 4:105.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.13 MB

5.71 MB

0.18 MB