Abstract
Decreased production of erythropoietin (EPO) causes anemia in patients with chronic kidney disease, and recombinant human EPO is used to treat renal failure associated anemia. The liver, the main EPO-producing organ in utero, maintains the capacity to produce EPO in the adult but in insufficient quantities to restore hemoglobin levels to normal in patients with impaired renal function. Inhibition of prolyl-4-hydroxylase domain (PHD) proteins is known to cause an increase in EPO production through its effects on hypoxia inducible factor. Here, we utilized small interfering RNA (siRNA) targeting EGLN1, the gene encoding the PHD2 protein, to investigate the phenotypic consequences in nonhuman primates. A single, well-tolerated intravenous dose of an optimized EGLN1 siRNA encapsulated in a lipid nanoparticle formulation caused robust mRNA silencing in the liver, leading to increases in serum EPO and hemoglobin. The siRNA-induced erythropoiesis was dose-dependent and was sustained for at least 2 months. These data point to the potential for an RNA interference–based, liver-targeted therapeutic approach for the treatment of anemia.
Introduction
A
Transciption of the Epo gene is regulated by the hypoxia inducible factor (HIF). HIF is a heterodimeric gene transcription factor that consists of an oxygen sensitive α-subunit and a constitutively expressed β-subunit. Under normal oxygenation, HIF-α is hydroxylated on two conserved proline residues by the prolyl-4-hydroxylase domain (PHD) proteins that target it for proteosomal degradation via the Von Hippel Lindau (VHL)–E3 ubiquitin ligase complex. Under low oxygen conditions hydroxylation of HIF-α is restricted. This leads to the accumulation and migration of HIF-α into the nucleus where it forms a functional heterodimer with its β-subunit and regulates transcription of genes that control cellular adaptation to hypoxia (for full review [8]). A large number of gene pathways are regulated by hypoxia in a HIF-dependent manner, including those involved in erythropoiesis, angiogenesis, glycolytic energy metabolism, and apoptosis. Three HIF-α subunits (HIF-1α, HIF-2α, and HIF-3α) have been identified and recent in vitro and in vivo studies suggest that HIF-2α is responsible for hypoxia-induced expression of Epo in the kidney and liver [6,9–12].
While HIF is responsible for transcriptional regulation of Epo mRNA, it is the PHD enzymes, and not HIF itself, that are the direct cellular oxygen sensors. PHDs belong to an evolutionary conserved subfamily of dioxygensases that use oxygen and 2-oxoglutarate (2-OG) as substrates and iron and ascorbate as cofactors. Since hydroxylation of HIF by PHDs requires oxygen, reduced levels of oxygen results in reduced enzymatic activity of the PHDs and thus stabilization of HIF-α. Four different PHD isoforms have been identified in mammals. Those include PHD1, PHD2, and PHD3 (encoded by EGLN2, EGLN1, and EGLN3, respectively), which are all located in the cytoplasm or nucleus [13], and prolyl 4-hydroxylase, transmembrane (P4H-TM), which unlike any other P4H characterized so far, possesses a transmembrane domain and is located in the endoplasmic reticulum [14,15]. All isoforms exhibit distinct but overlapping tissue specific expression, which may suggest a tissue-specific mechanism for modulating the hypoxic response. While all four PHDs can hydroxylate HIF-α in vitro, the distinct functions of the different PHD isoforms in vivo are still being elucidated. Independent reports on the conditional inactivation of Egln1 in the mouse as well as the characterization of two human EGLN1 mutations point to PHD2 inhibition as being sufficient to stimulate erythropoiesis [16–20]. Single knockouts of Egln2 and Egln3 are viable but do not exhibit erythrocytosis. However, the Egln2/3 double knockout mice show a moderate increase in hematocrit, associated with HIF2-α accumulation in the liver [17,21–23].
The pivotal role that PHD enzymes play in the regulation of hypoxia has created intensive interest in their potential to serve as therapeutic targets for the treatment of anemia and ischemic diseases. Recombinant human EPO (rhEPO) is currently the standard therapy for renal and cancer associated anemia [24,25]. However, recent reassessment of the risks and benefits of EPO treatment have raised concerns about cardiovascular complications as well as possible tumor growth promotion in cancer patients treated with rhEPO [26,27]. Development of small molecule PHD inhibitors is an attractive alternative because of its beneficial effects of simultaneous stimulation of endogenous EPO synthesis and iron metabolism, while significantly reducing treatment costs. However, systemic delivery of a PHD inhibitor might not fully recapitulate the normal cellular and physiologic response to hypoxia and prolonged stabilization of HIF does raise potential safety concerns that will need to be carefully monitored in preclinical models as well as in clinical trials.
An alternative approach to PHD small molecule inhibitors is the development of a therapeutic based on RNA interference. Simultaneous knockout of Egln1, Egln2, and Egln3 in the liver has been shown to increase hematocrit and increase serum EPO concentrations exceeding those achieved by inactivation of PHD2 in the kidney [28]. Recently, it was shown that small interfering RNA (siRNA) silencing of Egln1 in mouse liver resulted in an increase in serum EPO, hematocrit, and hemoglobin levels. Simultaneous siRNA mediated silencing of Egln1, Egln2, and Egln3 in the liver further increased serum EPO concentrations, hematocrit, and hemoglobin compared with only Egln1 silencing and showed a marked induction of Epo mRNA in liver [29]. To investigate the potential of developing an RNA interference (RNAi) therapeutic for the treatment of anemia based on targeted knockdown of the PHD enzymes in liver, we used siRNAs designed against EGLN1 for systemic delivery into mature nonhuman primates.
Materials and Methods
Test articles and reagents
Chemically modified double-stranded RNAs were synthesized and encapsulated in lipid nanoparticles at Merck Research Laboratories using the stepwise mixing and diafiltration method as described elsewhere [30,31]. The cationic lipid was synthesized at Merck (West Point, PA). Distearoylphosphatidylcholine (DSPC) and cholesterol were obtained from Sigma-Aldrich. Poly(ethylene glycol)2000-dimyristoylglycerol (PEG 2000-DMG) was manufactured by NOF Corporation. All siRNAs were synthesized at Merck. Ethanol was obtained from Sigma-Aldrich, SYBR gold was obtained from Molecular Probes. Dulbecco's phosphate buffered saline solution (PBS) was obtained from HyClone laboratories. All other buffers used in the study were prepared from the acid or sodium salt form of the components.
siRNA lipid nanoparticle preparation and characterization
siRNA lipid nanoparticles (LNPs) were prepared via the rapid precipitation process as previously described [32], with modifications as follows. Specifically, LNPs were assembled by micromixing appropriate volumes of an organic solution of lipids with an aqueous solution containing siRNA duplexes. The lipids solution was prepared by dissolving cationic lipid, cholesterol, DSPC, and PEG 2000-DMG, in a molar ratio of 58:30:10:2, in ethanol. siRNA duplexes were prepared in an aqueous citrate buffer (pH 5) using an siRNA to cationic lipid molar ratio of 0.17. Reagent solutions were preheated and delivered at nearly equal volumetric flow rates to the inlet of a confined volume T-mixer device using syringe pumps (Harvard Apparatus PHD 2000). The mixed material was sequentially diluted into equal volumes of citrate buffer (pH 6) and PBS in a multistage in-line mixing process. Following buffer dilutions, siRNA LNPs were incubated and subsequently purified for removal of free siRNA via anion exchange chromatography. The residual ethanol was removed, and the external buffer exchanged into PBS via tangential flow diafiltration. Finally, siRNA LNPs were concentrated to target siRNA concentration, sterilized by filtration via 0.2 μm sterile filter, vialed under aseptic conditions, and frozen for storage at −20°C. LNP size and size distribution were determined by dynamic light scattering using a DynaPro particle sizer (Wyatt Technology). Particle size was calculated from the time-based fluctuation in the light scattering intensity, quantified by a second order correlation function. The intensity-averaged particle diameter was 80±5 nm with a particle distribution index of less than 0.1. The concentrations of the four lipid components of the LNP (cationic lipid, DSPC, cholesterol, and PEG 2000-DMG) were determined by gradient reverse-phase ultrahigh-performance liquid chromatography methods. The total siRNA concentration was determined by a gradient strong anion-exchange method. The efficiency of siRNA encapsulation in LNPs was determined by SYBR gold fluorimetric method and was greater than 90% for all preparations.
Primate dosing and tissue collection
Studies were conducted at New Iberia Research Center (NIRC). Protocols (animal procedure statements) were reviewed and approved by the institutional animal care and use committees at both NIRC and Merck. Dosing and blood collection were performed while subjects were alert, while liver biopsies were performed under sedation using ketamine and/or telazol. Test articles were administered as a 2-minute infusion followed by a saline flush. Subjects were observed for a minimum of one hour after each dosing and procedure, and no signs of acute pharmacology, illness, or injection site reactions were reported. Percutaneous liver biopsies were obtained using a Mehghini needle (16T gauge), yielding approximately 20 mg of tissue. Liver samples were preserved for the RNA endpoints using RNAlater® solution (Life Technologies), and for the argonaute 2 (Ago2) immunoprecipitation assay by cryopreservation.
Clinical chemistry, hematology, and bioassays
For serum chemistry, 2 mL blood was collected into SST Vacutainer tubes and a standard chemistry panel was performed using the Dade Dimension Xpand platform (Siemens). For hematology including complete blood count, 1 mL blood was collected in EDTA tubes for analysis on an LH 780 Hematology Analyzer (Beckman Coulter). EPO and Hepcidin were measured by enzyme-linked immunosorbent assay (ELISA) (Epo: Abnova Cat. No. KA0175; Hepcidin: TSZ ELISA, Cat. No. HU8300) according to vendors' protocols.
Data analysis
In performing power analysis in support of this study, we reviewed clinical chemistry and hematology measurements in control-treated rhesus from previous studies. As expected, we found that pre and postdose measurements were generally well correlated across individuals, supporting the utility of normalization of postdose measurements to predose measurements per subject. We also found that multiple blood measurements, including hematocrit, were significantly decreased after a single dose of PBS or of placebo siRNA-LNP as described [33]. Data from paired PBS and placebo siRNA-LNP treated rhesus in nine studies were pooled and examined for changes in hematocrit (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/nat). Decreases in hematocrit began within a day of going on study, lasted up to several weeks, and varied among individuals, significantly correlating with their degree of on-study weight loss. These data supported the utility of normalization to control treatment at the same time point to normalize for on-study effects not related to the intended treatment. Clinical chemistry and hematology measurements relevant to on-target activity were normalized to predose baseline per subject by subtraction of predose values. The predose normalized data were renormalized to control treatment by subtracting the mean predose normalized value in the placebo-treated group at each time point. Clinical chemistry data related to cell counts were normalized in linear scale, while Taqman and ELISA data were normalized in native log scale. Raw and normalized values tested as reasonably normally distributed by the Shapiro-Wilk test. Significance of normalized changes in each measure were assessed by repeated-measures analysis of variance and confirmed by linear regression, over all postdose time points.
RNA-based endpoints
Normalized relative mRNA levels were determined by quantitative real-rime polymerase chain reaction (qPCR) using total RNA isolated using MagMAX™ technology (Life Technologies), which was then used as a template for complementary DNA synthesis according to vendor's protocol (High Capacity cDNA Archive Kit, ABI4368813). All primer/probe sets were obtained from Life Technologies and were as follows: EGLN1 (Hs00254392_m1), EGLN2 (Hs01091275_m1), EGLN3 (Hs00222966_m1), peptidylprolyl isomerase B (PPIB) (forward primer: GGCCAACGCAGGCAAA; reverse primer: CGTCTTGACTGTTGTGATGAAGAA; probe: 6FAM- ACACCAACGGCTCC), EPO (Rh02789296_m1), and hepcidin antimicrobial peptide 1 (HAMP1) (Hs00221783_m1). Sequence detection was performed on ABI7900 thermocyclers (Life Technologies) and data were analyzed using the standard ΔΔCt method. All samples were run in duplicate. Quantitation of Ago2-bound siRNA was performed using cryopreserved material as described [34]. The custom oligonucleotide sequences used for step-loop qPCR detection of EGLN1 siRNA were as follows: reverse transcription: GTCGTATCCAGT GCAGGGTCCGAGGTATTCGCACTGGATACGACAAGATGTGTG; forward primer: GGCGGTATATACATGTCAC, reverse primer: AGTGCAGGGTCCGAG, probe: 6FAM-ACTGGATACGACAATGATG.
Results
Selection of EGLN1 siRNAs
Chemically modified 21-mer siRNA duplexes targeting EGLN1 were screened in silico and in vitro, leading to three candidates for screening in primates (Fig. 1A). The siRNAs were encapsulated in lipid nanoparticles (LNPs), using the previously described DLinKC2-DMA formulation [35]. Cynomolgus monkeys were subjected to a single intravenous dose of formulated siRNA at 26.7 mg/m2 (approximately 1.8 mg/kg). Liver biopsies were performed at days −7, 2, 7, and 14. All three siRNAs caused a robust decrease in liver EGLN1 mRNA, and the three lead candidates were very comparable in their activity (Fig. 1B). Relative to the predose biopsy, steady-state EGLN1 mRNA was decreased by a mean of 90% at 2 days postdose. The pharmacodynamic response only dropped slightly in magnitude at 14 days postdose. Based on these data, siRNA-962 was chosen for further analysis.

Small interfering RNA (siRNA) selection.
Dose-dependent and specific mRNA silencing in rhesus macaques
For the next stage of characterization, siRNA-962 was formulated in a novel, highly potent, and well-tolerated LNP formulation developed in-house as described in “Materials and Methods.” Since this siRNA has cross-species sequence compatibility, we decided to perform the phenotypic studies in rhesus as a second primate species. A dose–response study was performed by treating the subjects at 3, 8.9, or 26.7 mg/m2 (0.15–1.4 mg/kg) and liver biopsies were collected at days −7, 3, and 12. An irrelevant placebo siRNA was also included as a specificity control. Dose-dependent mRNA silencing was observed for EGLN1, ranging from 59%–90% at day 3, and only slightly lower in magnitude at day 12 (Fig. 2A). The placebo siRNA had no effect on EGLN1. The treatments were well tolerated, with no adverse effects by gross observation and a transient increase in alanine aminotransferase at the highest dose immediately after dosing, which was fully resolved before day 3 (Supplementary Fig. S2). To determine whether the siRNA-962 was specific for EGLN1, we also measured EGLN2 and EGLN3 mRNAs, which encode the PHD1 and PHD3 proteins, respectively, in the liver biopsies (Fig. 2B, C). EGLN2 mRNA was not affected by siRNA-962, while EGLN3 modest demonstrated dose-dependent upregulation (up to two-fold). The effect on EGLN3 is consistent with previous reports that there is a compensatory mechanism that induces this transcript in response to loss of EGLN1 [22].

Potency and selectivity of EGLN1 siRNA-962 in Rhesus. Rhesus macaques were subjected to a single intravenous dose of lipid nanoparticles–encapsulated siRNA targeting EGLN1 or a placebo siRNA at 3 mg/m2 (∼0.15 mg/kg), 8.9 mg/m2 (∼0.45 mg/kg), or 26.7 mg/m2 (∼1.4 mg/kg) as indicated. n=7 subjects for all treatment groups except the highest dose, which was n=3. Liver biopsies were obtained at days −7, 3, and 12, and relative levels of EGLN1/PHD2
After cell internalization, siRNA is only pharmacologically active if it escapes endocytic vesicles into the cytosol, where it is accessible to the mRNA endonuclease Ago2 and other components of the RNA-induced silencing complex (RISC) [36]. To confirm that the observed dose-dependent decrease in EGLN1 mRNA correlates to exposure to RISC-activated siRNA, we immunoprecipitated Ago2 from liver homogenates and measured the associated siRNA guide strand using a methodology first reported by Pei et al. [34]. Ago2-bound siRNA was readily detectable at all three dose levels, only decreased an average of 3.2-fold from day 3 to day 12, correlating well to the long duration of mRNA silencing (Fig. 2D).
Dose-dependent erythropoiesis
In order to accurately measure the effect of EGLN1 mRNA silencing on erythropoiesis, one must consider the effect of intravenous administration of any solution, including buffer alone, into primates. Namely, intravenous dosing tends to cause a modest reduction of hemoglobin levels, as shown in the meta-analysis presented in Supplementary Fig. S1. This effect has been well documented in rhesus and is believed to be related to changes in respiratory rate and blood pressure caused by either physical restraint or anesthesia [33]. In order to prevent masking of the phenotype caused by this stress response, especially at the lowest siRNA dose, we normalized the data from hemoglobin (Hb) and hematocrit (Hct) endpoints against the placebo siRNA. We observed significant increases in Hb and Hct at all three doses levels (Fig. 3A, B). The lowest siRNA dose (∼0.15 mg/kg) achieved a peak increase of ∼1g/dL Hb, while the middle and high dose achieved increase of ∼2g/dL and ∼3g/dL Hb, respectively. All siRNA-treated subjects yielded a response. In addition to the magnitude of response, the duration of response was also dose dependent. Hb and Hct levels were resolved and approaching baseline at around 60 days postdose for the lowest siRNA dose, while the higher dose still displayed dramatic and sustained erythropoiesis at day 67, when the study concluded. As expected, these endpoints correlated to a dose-dependent increase in RBC counts (Fig. 3C).

Effect of EGLN1 siRNA on erythropoiesis. Hematological parameters were measured from blood collected every 3–6 days in all 24 subjects included in the study. Data are presented for red blood cells
Effects on EPO and Hepcidin mRNA
PHD domain proteins regulate erythropoiesis by regulating the activity of HIF-α. EPO, which is regulated at the transcriptional level by a HIF-responsive element, is believed to be the primary HIFα effector which causes maturation of reticulocytes into RBCs. EPO is produced primarily by the liver only during the fetal stage, and almost entirely by the kidney in adult humans (for review see [2]). Administration of EGLN1 siRNA caused a significant increase in liver Epo mRNA (up to >30-fold at day 12), which led to large, transient increase in EPO protein (Fig. 4A, B). Interestingly, Epo mRNA induction was relatively modest at the two lower siRNA doses (3- to 4-fold) and did not cause readily detectable increases in circulating EPO protein (Fig. 4A, B). Likewise, decreases in HAMP mRNA and its corresponding protein, hepcidin, a regulator of iron homeostasis and a well-characterized downstream response of EPO induction and exogenous EPO treatment [37], were only observed at the high siRNA dose (Fig. 4C, D).

Effect of EGLN1 siRNA on erythropoietin (EPO) and Hepcidin mRNA. Normalized liver EPO
To carefully investigate the kinetic relationship between pharmacodynamic and efficacy endpoints after dosing of EGLN1 siRNA, we performed an independent higher-powered rhesus study (n=7), using only the highest siRNA dose (26.7 mg/m2, corresponding to 0.14 mg/kg). Figure 5 shows a composite analysis of liver EGLN1 mRNA, liver EPO mRNA, blood EPO protein, reticulocytes, and hemoglobin as a function of time. While effector mRNA silencing peaks two days postdose leading to transient circulating EPO increases approximately 1 week later, the maximum elevation of hemoglobin does not occur until at least 30 days postdose. These data suggest the causal dependence of erythropoiesis on RNAi silencing of EGLN1.

The kinetic relationship between proximal (mRNA) and distal (hematological parameters) endpoints in an independent, higher-powered (n=7) Rhesus study. Dashed lines show placebo siRNA treatment. Data were double normalized against predose values and placebo siRNA as described. Data are presented as mean±SEM.
Discussion
Epo is primarily expressed by peritubular fibroblasts in the renal cortex but Epo mRNA is also detectable in brain, liver, spleen, lung, and testis, though these organs appear unable to substitute for renal Epo in chronic kidney disease [38].
Mice in which Epas1 (Hif2) has been genetically deleted in the kidney become severely anemic [6]. It is now clear from experiments such as those described by Kapitsinou et al. that in conditions of normal to moderate hypoxia, the adult liver does not contribute to the serum EPO pool but can do so given the appropriate stimuli. In this report, we have demonstrated that dose-dependent knockdown of hepatic EGLN1 leads to increases liver Epo mRNA expression. These changes promote increases in serum EPO levels that, in turn, lead to increases in hematocrit, red blood cells, and hemoglobin. In our experiments, the plasma EPO levels did not change for the lowest siRNA doses, despite a clear effect on liver Epo mRNA levels and red blood cells. The lack of an observable increase in plasma EPO at the lower dose levels is most likely due to a lack of sensitivity in the assay and/or slight differences in kinetics, which lead to missing peak measurements.
Our data are consistent with the findings recently described by Querbes et al. (2012) showing that knockdown of liver Egln1 in mice was sufficient to significantly increase hemoglobin and hematocrit in mice [29]. The authors also showed that simultaneous knockdown of Egln1, Egln2, and Egln3 increased liver Epo mRNA to a higher magnitude than Egln1 silencing alone. It should be noted, however, that two other groups (Minamishima and Kealin [28] and Liu et al. [39]) have published manuscripts in which liver specific genetic deletion (using albumin-Cre) of Egln1 did not result in increased expression of hepatic Epo mRNA. The failure to see increased Epo in this model could be due to developmental compensation and/or compensation from Egln3. Another possibility is that the Cre recombinase–driven deletion of Egln1 is incomplete and thus only leads to a partial reduction in protein. Lastly, It is also possible that Egln1 silencing in extrahepatic tissues (or nonparenchymal cells within the liver) is partially responsible for the erythropoiesis, but we consider this unlikely based on the expected LNP biodistribution properties [30].
Our findings thus have important implications for potential development of an siRNA as a therapeutic for anemia. First, we show that the capacity to induce erythoposis through liver-targeted siRNA is maintained in higher species; secondly, we show that a single siRNA is sufficient to obtain significant and titratable increases in hemoglobin, a markedly easier development path than a combination of three siRNAs.
It is noteworthy that the lowest siRNA dose used in these studies (∼0.15 mg/kg) promotes an increase in hemoglobin levels that achieved what is strived for clinically (1 g/dL over 4 weeks), suggesting that once monthly dosing with EGLN1 siRNA, a dosing paradigm that is analogous to the current clinically accepted treatment (Aranesp), could potentially be sufficient to increase red blood cell levels. However, more studies are required to determine the optimal dosing regimen.
While much needs to be learned about the underlying molecular mechanism, the development of therapeutic agents based on inhibition of PHD enzymes for the treatment of anemia is well on its way [40]. PHD inhibitors can be thought of as “hypoxia-mimetics” leading not only to the induction of endogenous EPO, but also have the added benefit to the natural mobilization and utilization of iron stores critical to the formation of new oxygen-carrying RBCs [41]. Here, we show that siRNAs targeting EGLN mRNAs, which encode the PHDs, can offer a similar benefit as PHD inhibitors in regard with EPO production and iron metabolism via the suppression of hepcidin. The fact that this can be achieved by systemic administration of a siRNA that only lowers mRNA expression in the liver can potentially be an advantage over the PHD inhibitors, which might cause HIF stabilization in a broader array of tissues. Alternatively, our findings could clear the way for the development of small molecule inhibitors that are preferentially taken up by the liver, leading to lower systemic compound levels while maintaining the desired pharmacological effect.
Lipid nanoparticle (LNP)–mediated delivery represents the most advanced technology for clinical development of siRNA therapeutics. In early clinical data recently reported by Coelho et al., [42], administration of LNP-encapsulated siRNA at doses up to 1 mg/kg in healthy volunteers and transthyretin amyloidosis patients resulted in robust mRNA and protein knockdown without changes in hematological or clinical chemistry parameters. Furthermore, in a recent phase-1 oncology study, chronic dosing of an LNP-siRNA at doses up to 1.5 mg/kg was safe and well tolerated [43]. These observations provide a strong rationale for expanding the number of liver-expressed siRNA targets in clinical evaluation. The clinically meaningful efficacy and long duration of erythropoiesis observed in primates at sub-mg/kg doses suggests that EGLN1 is an excellent candidate for further evaluation of RNAi-based therapeutics to benefit chronic anemia patients.
Footnotes
Acknowledgments
The authors would like to acknowledge Mirian Gindy and Mihir Patel for providing the formulated siRNAs, Joe Davide for study coordination, and Jane Fontenot and her staff at New Iberia Research Center for executing the studies.
Author Disclosure Statement
No competing financial interests exist.
References
Supplementary Material
Please find the following supplemental material available below.
For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.
For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.
