Can RNAi Target Salmonid Whirling Disease In Vivo ?

Salmonid whirling disease is caused by the cnidarian-myxozoan parasite, Myxobolus cerebralis, which alternates between two hosts: (1) a salmonid fish and (2) an invertebrate oligochaete, Tubifex tubifex [1,2]. Accordingly, M. cerebralis alternates between two transmission stages: an actinosporean triactinomyxon spore that is produced in the oligochaete host and a myxosporean spore that develops in the salmonid host. Among all salmonid species known as hosts of M. cerebralis, the rainbow trout (Oncorhynchus mykiss) exhibits the worst pathology and is also the most susceptible. After a three-phase development in the intestinal epithelial tissue of the oligochaete, the triactinomyxon stages of M. cerebralis are released into the water. These spores are infectious to the alternate host, salmonids. The triactinomyxon spores penetrate the epidermis of the fish, and then, the sporoplasm cells undergo replication and dispersion in the epidermis and dermis, before reaching the peripheral nerves and migrating to the cartilage. The disease has three characteristic symptoms: whirling swimming behavior, blackening of the caudal part of the fish, and deformation of the head and spinal column. There is no successful treatment to salmonid whirling disease, which poses a severe threat to both the salmon industry and to aquatic ecology. Culling of diseased salmonid populations remains the only viable strategy to disease intervention. Thus, the development of an effective control and prevention method will significantly diminish the economic losses incurred by the salmon industry due to whirling disease and also contribute to restoring the natural ecology of salmonid populations.

RNA interference (RNAi)-mediated gene silencing has been demonstrated in cells of mammals and other vertebrates like fish, making RNAi a potential therapeutic tool in human and veterinary medicine [3]. In terms of host–parasite interaction mechanisms in salmonid whirling disease, specific proteases of M. cerebralis, namely the serine protease, MyxSP-1, belonging to the chymotrypsin-like family of serine proteases was seen to be highly expressed during parasitic development in the salmonid host [4]. We hypothesize that targeting MyxSP-1 using small-interfering RNA (siRNA)-induced RNAi in the oligochaete host in vivo would abrogate the M. cerebralis life cycle in the oligochaete host providing a proof-of-concept intervention strategy in salmonid whirling disease (Fig. 1). We observed that soaking the invertebrate oligochaete T. tubifex in a solution containing 2 μM Cy3-labeled-negative controlled siRNA for 24 h at 15°C leads to rapid uptake of the fluorescently labeled siRNA, which to the best of our knowledge is the first such demonstration. siRNA delivery was also tested at 2 μM for 48, 72, and 96 h, but optimally observed only for 24 h (data not shown). Fluorescence was detected in the oligochaete hypodermis and intestine, intercellular pansporocysts of the parasite, but not in the coelomic cavity. Using this siRNA soaking protocol, we targeted MyxSP-1 in vivo in M. cerebralis-infected oligochaetes (3 months post-exposure) and observed a ∼74% knockdown in MyxSP-1 mRNA expression measured by real-time quantitative PCR. This reverse genetics approach would offer a significant advance toward molecular control of parasitic diseases, which can aid in the identification of genes involved in host–parasite interaction mechanisms for molecular targeting using RNAi.

OPEN IN VIEWER

FIG. 1.

RNA interference (RNAi) as a possible control of salmonid whirling disease. Diseased rainbow trout, myxospores, mature triactinomyxon spores, and naive rainbow trout images courtesy: M.E.-M. Tubifex tubifex image courtesy: S.S. (A) In vitro uptake of Cy3-labeled-negative control small-interfering RNA (siRNA, #AM 4621; Ambion) by T. tubifex. Representative image shows staining of the T. tubifex intestine after soaking oligochaetes for 24 h at 15°C in 2 μM Cy3-labeled-negative control siRNA. Fluorescence was visualized by an epifluorescence microscope (Olympus) using the rhodamine filter set at emission 590 nm; scale bar=50 μm. (B) In vivo siRNA knockdown of MySP-1 in T. tubifex. T. tubifex oligochaetes infected with Myxobolus cerebralis (3 months post-exposure) were soaked for 24 h at 15°C in 2 μM siRNA directed against MyxSP-1. Custom-designed siRNAs specific for MyxSP-1 were obtained from Ambion; the 5′-3′ sequences of the sense and antisense siRNA strands were as follows: sense (GCUCAUUGCAUUGACUUUATT); antisense (UAAAGUCAAUGCAAUGAGCCC). MyxSP-1 gene expression normalized to that of M. cerebralis β-actin. Bars represent the mean normalized expression (n=3; +SE).