Antisense Oligonucleotides Targeting Raf-1 Block Japanese Encephalitis Virus In Vitro and In Vivo

Abstract

Japanese encephalitis virus (JEV) infections represent a major health concern in Southeast Asia since no effective treatments are available. Recently, several reports have demonstrated that inhibition of certain host cell proteins prevents viral infection. Raf-1 kinase is a central component of many signaling pathways involved in normal cell growth and oncogenic transformation, and Ras/Raf/ERK signaling activation has been observed during viral infections (including JEV infection). In this study, Raf-1 was confirmed to be upregulated by JEV infection, which suggested that Raf-1 might be important for JEV infection and might be a target for novel anti-JEV drugs. To determine the role of Raf-1 during the JEV infection process, antisense oligonucleotides (ASODNs) were used to downregulate Raf-1 expression in JEV-infected baby hamster kidney (BHK-21) cells and African green monkey kidney (Vero) cells. From five ASODNs candidates tested, Raf-1-1 (Raf-1 antisense) significantly downregulated Raf-1 protein expression levels, significantly inhibited cytopathic effect (CPE) in cultured cells, and reduced JEV RNA levels in cell medium without affecting cell viability. Furthermore, it also demonstrated that ASODN Raf-1-1 possessed therapeutic effects by using a lethal JEV infection mouse model. In conclusion, data presented in this report demonstrated that ASODN Raf-1-1 could suppress Raf-1 protein and that Raf-1 inhibition suppressed JEV replication in vitro and in vivo. These data provided evidence for targeting Raf-1 in the development of novel anti-JEV therapies. In addition, Raf-1-1 represents potential drugs that can be adapted for treating JEV infections.

Introduction

Japanese encephalitis virus (JEV) belongs to the genus Flavivirus, family Flaviviridae; neurotropic flaviviruses that can cause acute encephalitis associated with high fatality rates. JEV infections are responsible for 50,000 encephalitis cases worldwide resulting in permanent neurological disabilities in 50% of survivors and an annual mortality rate of 30% [1,2]. JEV is prevalent in Southeast Asia, but has been expanding its “geographical footprint” into previously nonendemic regions [3,4]. Currently, JEV vaccines are available in different parts of Asia, however, there are usage limitations relating to efficacy, safety, and cost. Although considerable research is ongoing, no effective antiviral therapeutic treatments are available to treat JEV infections [5 –7].

All pathogenic microorganisms interact in some capacity with host tissues and cells during the infection process. Some host cell pathways and enzymes are essential to the replicative life cycle of respective pathogens, especially viruses [8 –11]. Raf-1 kinase is a central component of many signaling pathways involved in both normal cell growth and oncogenic transformation. Raf proteins were first identified in the early 1980s as retroviral oncogenes and have since been a significant research focus [12]. Ras/Raf/ERK-mediated signaling activation has been described following viral infections [13,14]. Reports have indicated that the Hepatitis C virus core protein interacts with the 14-3-3 Protein resulting in Raf-1 kinase activation [15]. It has been demonstrated that inhibition of Raf signaling impaired influenza virus propagation [16,17]. Recent studies have also found that Hepatitis B virus regulates Raf-1 expression in HepG2.2.15 cells by enhancing its promoter activity [18]. Moreover, Chen et al. demonstrated that the Ras/Raf/ERK cascade was activated in JEV-infected microglia [19,20].

In this report, we demonstrated that Raf-1 expression was upregulated in JEV-infected baby hamster kidney (BHK-21) cells. However, it remained unclear what role Raf-1 upregulation played in the context of controlling viral replication. We expect that downregulated Raf-1 expression may have effect on viral replication, pathogenesis, or cellular responses associated with viral clearance. This report then demonstrated that Raf-1 was required for JEV propagation both in vitro and in vivo. Specifically, antisense oligonucleotides (ASODNs) were used to downregulate Raf-1 expression. Results demonstrated that inhibition of Raf-1 by ASODN Raf-1-1 inhibited JEV propagation in BHK-21 cells and Vero cells without affecting cell proliferation. In addition, we found that ASODN Raf-1-1 exhibited therapeutic potential in a lethal JEV infection mouse model.

Materials and Methods

Cells, viruses, and animals

BHK-21 cells were cultured in Dulbecco's modified Eagle's medium (DMEM; HyClone, Beijing, China) with 7% fetal bovine serum (FBS; Gibco, Carlsbad, CA) and 1% penicillin/streptomycin in 5% CO₂ humidified incubators at 37°C.

Vero cells were cultured in minimum essential medium (HyClone) with 10% FBS (Gibco) and 1% penicillin/streptomycin in 5% CO₂ humidified incubators at 37°C.

The peking strain of JEV was grown and titrated by the plaque assay using BHK-21 cells. JEV strains were prepared from culture supernatants of infected BHK-21 cells or suspensions of infected suckling mouse brain tissue.

Three-week-old female BALB/c mice (9–10 g) were purchased from the Experimental Animal Center of Chinese Academy of Medical Sciences (Beijing, China) and were housed in microisolator cages and provided autoclaved water and chow ad libitum. All animal works were approved by the IACUC/ethics committee in the Experimental Animal Center of Chinese Academy of Medical Sciences (Approved No. SCXK-2007-004) and conformed to the national institutes of health guide for care and use of laboratory animals (Publication No. 85-23, revised in 1985).

ASODNs design and synthesis

The whole length messenger RNA (mRNA) sequence of Raf-1 (GenBank Accession Nos. NM_002880 and NM_029780) was chosen as potential target sequences, and homologous regions of Mice and humans were chosen as ASODN binding targets. Using a Basic Local Alignment Search Tool search, targeting these regions were determined to be specific and did not appear to inhibit the expression of other proteins (Table 1). The ASODNs, including Raf-1-1 sequences and random ASODN (Raf-1-MIS) sequences, were synthesized on an ABI8909 nucleic acid synthesis system and purified by Oligonucleotide Purification Cartridge (OPC; PerkinElmer, Foster City, CA). The ASODN lengths were verified by gel electrophoresis. As ASODNs are nuclease resistant due to containing phosphorothioate, all generated ASODNs were chemically modified with phosphorothioate by substituting the oxygen molecules of the phosphate backbone with sulfur. [21]

Table 1.

Antisense Oligonucleotide Sequences Targeting Raf-1 Messenger RNA

Code	Raf-1 position (nt)	Length (nt)	Sequence (5′–3′)
Raf-1-1	1,776–1,795	20	GGGCAATGTCAATTAGCTGG
Raf-1-2	551–570	20	CGCTGATAGCCAAACTGCTG
Raf-1-3	739–758	20	GGAGAAGTCTGAACACTGCA
Raf-1-4	1,242–1,261	20	CAGGGTGGTGCTGACCATGT
Raf-1-5	1,309–1,328	20	GGGCTGAAGGTGAGGCTGAT

nt, Nucleotides.

Assay for virus-induced cytopathic effect

Inhibition of virus-induced cytopathic effect (CPE) was used to assay antiviral effect in vitro. Briefly, BHK-21 cells were plated in 96-well plates at a concentration of 6,000 cells per well and incubated overnight in DMEM containing 7% FBS, and then were infected with one multiple of infection (MOI) of virus (100 μL). After 1 h of incubation, cells were washed twice to remove unabsorbed viruses, 2 μM ASODNs or serial dilutions of the compound Raf-1-1 starting at 0.125–2 μM or 2 μM Raf-1-MIS in the maintenance media (0.7% FBS) were then added to the cell monolayer. Cells were further incubated at 37°C for 72 h. Pathological changes in cells infected with JEV were observed using an inverted microscope (Olympus CKX41). The viabilities of cells were assayed by the Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan). CPE inhibition rate was calculated as: (Asample-Avirus)/(Acontrol-Avirus) × 100%. Assays were performed in triplicate, and the average inhibitory rate expressed as the mean standard deviation (SD).

Western blot analysis for detecting Raf-1 protein

To detect the effects of JEV on cellular expression of Raf-1 protein, BHK-21 cells were used for this assay and virus was inoculated at one MOI. After inoculation in the maintenance media (0.7% FBS) at 37°C for 48, 72 h, respectively, cells were collected and subjected to western blotting analysis.

To detect the inhibiting effects of Raf-1-1 on Raf-1 expression, BHK-21 cells and Vero cells monolayer or JEV-infecting cells were exposed to several concentrations of compounds in the maintenance media (0.7% FBS) at 37°C for 72 h. Cells were collected, and western blot analysis was manipulated.

For western blot analysis, the treated cells were washed twice with phosphate-buffered saline (PBS) and then lysed in radio immunoprecipitation assay buffer for 30 min on ice. The lysates were centrifuged at 12,000g for 15 min to remove debris. Protein concentration was quantified using the Bio-Rad method. Thirty micrograms of total protein was separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride membranes (Millipore). The membranes were then blocked with 5% nonfat milk in Tris-buffered saline–Tween buffer [25 mmol/L Tris, 190 mmol/L NaCl, and 0.5% (v/v) Tween 20, pH 7.5]) and then incubated with primary antibody (Abcam) against Raf-1 or anti-β-actin polyclonal antibody (Pharmacia, Hong Kong, China) at 4°C overnight. After being washed, the membranes were incubated at 25°C for 1 h with horseradish peroxidase (HRP)-labeled secondary antibody (1:2,000 dilution). After being washed, the membranes were developed with an enhanced chemiluminescence reagent (GE Healthcare) and exposed to X-Omat BT Film (KodakRochester). Bands were quantified by densitometry using an ATTO Densitograph (ATTO Corporation), normalized relative to beta-actin as an internal control.

Real-time reverse transcription–polymerase chain reaction for detecting JEV RNA

To assess the effect of ASODNs on JEV RNA levels, JEV RNA detection in culture medium was determined by quantitative reverse transcription–polymerase chain reaction (qRT-PCR). JEV RNAs were isolated at 24 and 48 h postinfection. Using TIANamp Virus RNA kit (Tiangen Co., Beijing, China) and then subjected to detecting JEV RNA expression levels using one-step primescript RT-PCR detection kit (TaKaRa). The forward primer of JEV was 5′-TGGGAATTATTCAGCGCAAGT-3′, the reverse primer was 5′-AGGGCTACCGAAGGAGCATT-3′, and the taqman probe was 5′-FAM-CGTCCCAGGCGGCAAAGTTTACAGTAAC-TAMARA-3′. PCR amplification and analysis were performed using the iCycler real-time PCR detector (Bio-Rad). Assays were repeated in triplicate, and the average threshold cycle values were used to determine JEV RNA concentrations. The inhibitory rate was calculated using the follow formula: IR (%) = (Ccontrol − Ctester)/Ccontrol × 100%, where Ccontrol represents JEV RNA copies in JEV-infected cells and Ctester represents JEV RNA copies in JEV-infected cells treated with ASODN.

Cell proliferation assay

BHK-21 cells or Vero cells were plated in 96-well plates at a concentration of 6,000 cells per well and incubated overnight. Cell monolayers were exposed to serial dilutions of the compound Raf-1-1 starting at 0.5 − 16 μM in the maintenance media (0.7% FBS) at 37°C for 72 h. The viabilities of cells were assayed by the CCK-8 (Dojindo Laboratories). Each experiment was performed in triplicate and repeated three times.

Mice infection and treatment

Groups of 3-week-old female BALB/c mice (n = 8) were intraperitoneal challenged with a lethal dose of virus per mouse, and the mice were subsequently inoculated with PBS or different doses of Raf-1-1. Following the JEV infection, mice received Raf-1-1 of 12.5, 25, or 50 or PBS intraperitoneal every 24 h for the next 4 days. Mice were observed daily for 20 days after infection for mortality. The statistical significance of the difference in survival of mice in different treatment groups was determined by the log rank test, and a P value <0.05 was considered significant.

Plaque reduction assay

Groups of 3-week-old female BALB/c mice (n = 4) were intraperitoneal challenged with a lethal dose of virus and treated with Raf-1-1 as described above. On day 5 postinfection, the mice from each group were sacrificed and brain tissues were harvested for virus titrations; the brain tissues of four mice in every group were homogenized into a 2% suspension in DMEM, centrifuged, and filter sterilized. JEV titer was determined by plaque formation on BHK-21 cells as described above. The minimum detection limit of the plaque assay was 50 pfu/mL. All animal studies were conducted following the approved protocols of the Institutional Animal Care and Ethics Committee.

Statistical analysis

The data are expressed as mean ± SD. Statistical analysis was performed by Student's t-test (two tailed) and one-way analysis of variance.

Results

Raf-1 protein expression was upregulated following JEV infection in BHK-21 cells

Following infection of BHK-21 cells or Vero cells with JEV for 48 and 72 h, cell proteins were analyzed for Raf-1 expression by western blot analysis. Results showed that Raf-1 was upregulated in JEV-infected BHK-21 cells (Fig. 1a, b).

FIG. 1.

Raf-1 protein levels in JEV-infected BHK-21 cells. (a) BHK-21 cells were infected with JEV for 48 and 72 h. Total proteins were isolated, and Raf-1 expression was analyzed by western blot. (b) Raf-1 protein levels in JEV-infected cells compared with control cells. Raf-1 protein levels were normalized to the β-actin protein levels, assuming that the Raf-1, β-actin protein levels in control BHK-21 cells were 100%. Results are expressed as the mean ± SD of two independent experiments. BHK-21, baby hamster kidney; JEV, Japanese encephalitis virus; SD, standard deviation.

Antiviral screening of ASODNs targeting Raf-1 by in vitro CPE inhibition assay

To determine whether Raf-1 inhibition affects JEV replication, 2 μM ASODNs designed targeting Raf-1 were added to BHK-21 cells infected with JEV. Inhibition of virus-induced CPE was used to assay antiviral effect. Results showed that 2 μM Raf-1-1 significantly inhibited JEV-induced CPE in BHK-21 cells, the average inhibition rate reached to 95.32% (Fig. 2).

FIG. 2.

Cytopathic effect inhibition by antisense oligonucleotides targeted Raf-1. Following infection with JEV, 2 μM ASODNs or 1,000 U/mL IFN-α-2a was added to cells; at 72 h, the virus induced CPE was assayed by the Cell Counting Kit-8. CPE inhibition rate was calculated. Assays were performed in triplicate, and the average inhibitory rate expressed as the mean SD. Data are expressed as the mean ± SD (n = 3). ASODNs, antisense oligonucleotides; CPE, cytopathic effect.

Raf-1 expression was downregulated by Raf-1-1 in BHK-21 cells and Vero cells specifically and dose dependently

To determine if Raf-1-1 could downregulate Raf-1 expression, Raf-1-1 was added to BHK-21 cells or JEV-infected BHK-21 cells or Vero cells. Total proteins were isolated and subjected to western blot analysis. Raf-1-MIS was used as a control to exclude nonspecific effects that may be conferred by Raf-1-1. Raf-1-MIS is a scrambled Raf-1-1 sequence used to test whether the Raf-1-1 sequence nonspecifically affected cell function. Results demonstrated that Raf-1-1 inhibited Raf-1 expression in a dose-dependent manner while treatment with 2 μM Raf-1-MIS had no effect on Raf-1 protein expression (Fig. 3a–f). These results indicated that Raf-1-1 specifically and dose dependently inhibited Raf-1 protein expression unrelated to nonspecific gene-regulatory events.

FIG. 3.

Raf-1 protein expression in Raf-1-1-treated BHK-21 and Vero cells. (a) BHK-21 cells were either untreated, treated with 1 or 2 μM Raf-1-1 or 2 μM Raf-1-MIS for 72 h, at which time cells were harvested and Raf-1 expression was analyzed by western blot. (b) Raf-1 protein levels in treated cells compared with control cells. Raf-1 protein levels were normalized to the β-actin protein levels, assuming that the Raf-1, β-actin protein levels in control cells were 100%. Results are expressed as the mean ± SD of two independent experiments. (c) BHK-21 cells were either untreated, treated with 1 or 2 μM Raf-1-1 following JEV injected for 72 h, at which time cells were harvested and Raf-1 expression was analyzed by western blot. (d) Raf-1 protein levels in treated cells compared with control cells. Raf-1 protein levels were normalized to the β-actin protein levels, assuming that the Raf-1: β-actin protein levels in control cells were 100%. (e) Vero cells were either untreated, treated with 1 or 2 μM Raf-1-1 following JEV injected for 72 h, at which time cells were harvested and Raf-1 expression was analyzed by western blot. (f) Raf-1 protein levels in treated cells compared with control cells. Raf-1 protein levels were normalized to the β-actin protein levels, assuming that the Raf-1,β-actin protein levels in control cells were 100%. Results are expressed as the mean ± SD of two independent experiments.

Raf-1-1 specifically and dose dependently inhibited JEV-induced CPE in BHK21 cells and Vero cells

The anti-JEV activity of Raf-1-1 was assessed by measuring inhibition of CPE in BHK-21 cells and Vero cells using the CCK8 method. To exclude nonspecific oligonucleotide effects, the mismatched oligonucleotide (Raf-1-MIS) was used as a negative control. Results demonstrated that treatment with serial dilutions of Raf-1-1 inhibited CPE induced by JEV in a dose-dependent manner, while no inhibition of CPE activity was observed for cells treated with Raf-1-MIS (Fig. 4).

FIG. 4.

Raf-1-1 inhibits cytopathic effect induced by JEV in BHK-21 cells and Vero cells specifically and in a dose-dependent manner. (a) JEV-infected BHK-21 cells were treated with Raf-1-1 (0.125–2 μM) or Raf-1-MIS (2 μM) for 72 h, and cell viability assessed using the Cell Counting Kit-8 assay. (b) JEV-infected Vero cells were treated with Raf-1-1 (0.125–2 μM) or Raf-1-MIS (2 μM) for 72 h and cell viability assessed using the Cell Counting Kit-8 assay. Data are expressed as the mean ± SD from three independent experiments.

JEV RNA in cell culture medium was reduced by Raf-1-1 in a dose-dependent manner

To determine whether Raf-1 inhibition by Raf-1-1 specifically blocked JEV propagation, JEV-infected BHK-21 cells and Vero cells were treated with 0.5, 1, or 2 μM Raf-1-1, or with 2 μM Raf-1-MIS, and then the presence of JEV RNA in cell culture medium was determined. Results suggested that Raf-1-1 inhibited JEV RNA in cell culture in a dose-dependent manner. Treatment with 2 μM Raf-1-MIS had no effect on JEV RNA levels in JEV-infected BHK-21 cells and Vero cells (Fig. 5).

FIG. 5.

Effects of Raf-1-1 on JEV RNA production in cell medium. (a) JEV-infected BHK-21 cells were treated with Raf-1-1 (0.5–2 μM) or Raf-1-MIS (2 μM) for 48 h and JEV RNA in cell supernatants analyzed by real-time RT-PCR. (b) JEV-infected Vero cells were treated with Raf-1-1 (0.5–2 μM) or Raf-1-MIS (2 μM) for 48 h and JEV RNA in cell supernatants analyzed by real-time RT-PCR. Inhibitory rates were calculated and expressed as the mean ± SD from three independent experiments, assuming that the inhibitory rates in control cells (only injected) were 0. RT-PCR, reverse transcription–polymerase chain reaction.

The kinetics of action of Raf-1-1 in relation to the replicative cycle of JEV in vitro

To understand JEV and Raf-1-1 interactions, experiments were designed to determine the kinetics of JEV replication in vitro. It was noted that the earliest appearance of JEV in infected BHK-21 cells or Vero cells was ∼12 h postadsorption. The antiviral activity of Raf-1-1 was subsequently investigated in relation to the kinetics of JEV replication. Nontoxic concentration of Raf-1-1 was added at following entry of JEV into BHK-21 cells or Vero cells. Cell culture was collected respectively at 0, 4, 8, 12, 24, 48 h after Raf-1-1 treatment and subjected to JEV RNA detection. The ASODNs Raf-1-1 at a concentration of 2 μM were able to inhibit JEV replication when added to the infected monolayer postinfection evidenced by the reduced viral RNA in cell cultures at 12, 24, and 48 h (Fig. 6).

FIG. 6.

Raf-1-1 mediated of JEV Kinetics of action in BHK-21 cells and Vero cells. (a) JEV RNA in cell culture was detected after BHK-21 cells infected or 2 μM Raf-1-1 treated at 0, 4, 8, 12, 24, 48 h. (b) JEV RNA in cell culture was detected after Vero cells infected or 2 μM Raf-1-1 treated at 0, 4, 8, 12, 24, 48 h. Results are expressed as the mean ± SD of three independent experiments.

Downregulation of Raf-1 by Raf-1-1 does not affect BHK-21 and Vero cell viability

To determine the viability of BHK-21 cells and Vero cells following Raf-1-1 treatment, cell proliferations were assessed using the CCK8 assay. As shown in Fig. 7a and b, treatment of BHK-21 cells and Vero cells with serial Raf-1-AS dilutions was not cytotoxic (determined by cellular proliferation rates) even at a concentration as high as 16 μM.

FIG. 7.

Effects of Raf-1-1 on BHK-21 and Vero cell viability. (a) BHK-21 cells were incubated with serial dilutions of Raf-1-1 (0.5–16 μM) for 72 h and then the Cell Counting Kit-8 assay was used. We assumed that the OD value of control cells was 1. (b) Vero cells were incubated with serial dilutions of Raf-1-1 (0.5–16 μM) for 72 h and then the Cell Counting Kit-8 assay was used. We assumed that the OD value of control cells was 1. The OD ratios are expressed as mean ± SD from three independent experiments. OD, optical density.

Raf-1-1 mediated protection of JEV-infected mice

Based on the described data in vitro, we determined whether inhibiting Raf-1 by ASODN Raf-1-1 conferred antiviral activity against JEV in mice. Results showed that JEV infected mice receiving Raf-1-1 presented less severe symptom and mortality rates (in a dose-dependent manner) compared to virus-infected control mice or mice receiving Raf-1-MIS (P < 0.05). All the virus-infected control mice died earlier than mice receiving Raf-1-1 (Fig. 8a). Following Raf-1-1 administration (50 mg/kg/d), seven out of eight mice survived, in addition six out of eight survived following treatment with 25 mg/kg/d, and five out of eight mice survived following administration of 12.5 mg/kg/d. Weight loss in infected mice treated with ASODN Raf-1-1 was also dose and time dependent (Fig. 8b). Lower doses generally resulted in greater weight loss than higher doses. No signs of drug-related toxicity were observed when Raf-1-1 was administered intraperitoneally with the dose of 50 mg/kg/d (Fig. 8a, b).

FIG. 8.

Raf-1-1 mediated protection of JEV-infected mice. (a) Effects of intraperitoneal administration of Raf-1-1 on survival of mice (n = 8 per group) following infection with JEV. Raf-1-1 and virus were administered intraperitoneally. Mice received the indicated dose of Raf-1-1 and Raf-1-MIS every 24 h after infection for 4 days. Mortality was monitored for 20 days. (b) Effects of intraperitoneal administration of Raf-1-1 on changes in body weight following inoculation with JEV. Body weight measurements were taken daily, and changes in body weight were calculated for each group based on the initial starting weight at day 0 before virus inoculation.

JEV replication was inhibited by ASODN Raf-1-1 in mouse brains

It is not clear if the downregulation of Raf-1 has impact on the spread of JEV infection from the periphery to brain. We next determined the JEV titers and Raf-1 expression level in mouse brains after Raf-1-1 treatment. Viral titers were determined with plaque assay in JEV-infected mice brains following treatment with 12.5, 25, or 50 mg/kg/d of Raf-1-1 or with 25 mg/kg Raf-1-MIS or in brains harvested from untreated mice (Fig. 9a). JEV titers approached 7 × 10⁷ pfu/mL in JEV-infected mice at 5 days postinfection. No significant differences in viral titers between JEV-infected and Raf-1-MIS-treated JEV-infected mice were observed. However, mice treated with 25 or 50 mg/kg of Raf-1-1 presented with 2 × 10² pfu/mL or no detectable JEV in the brains. The detection limit of the JEV plaque assay was 50 pfu/mL. To determine if Raf-1-1 could downregulate Raf-1 expression in the mouse brain, total protein was isolated and subjected to western blot analysis. Results demonstrated that Raf-1-1 inhibited Raf-1 expression in mice brains (Fig. 9b, c).

FIG. 9.

JEV titers and Raf-1 expression in mouse brains were inhibited following Raf-1-1 treatment. (a) Brain tissues (n = 4 per group) were harvested 5 days postinfection and homogenized for plaque assays. JEV titers from individual mouse brains are shown. (b) Brain tissues (n = 4 per group) were harvested 5 days postinfection. Total proteins were isolated, and Raf-1 expression was analyzed by western blot. (c) Raf-1 protein levels in JEV infected mice brain compared with control mice. Raf-1 protein levels were normalized to the β-actin protein levels, assuming that the Raf-1: β-actin protein levels in control mice brains were 100%. Results are expressed as the mean ± SD of two independent experiments.

Discussion

Data presented in this report demonstrated that treatment with ASODN Raf-1-1 targeting Raf-1 inhibited JEV replication in vitro and in vivo. CPE resulting from JEV infections and JEV RNA levels was significantly inhibited in Raf-1-1-treated cells compared to untreated cells similarly infected. Furthermore, we observed that Raf-1-1 effectively protected mice against the JEV challenge and inhibited JEV replication in mice brain.

Raf-1 is a Ser/Thr kinase important to the Ras-Raf-MAPK signaling pathway involved in the control of gene expression profiles associated with the cell cycle, apoptosis, cell differentiation, and cell migration [22 –24]. Efforts to develop drugs targeting Raf family members and their downstream effector molecules have increased since attempts to inhibit Raf signaling failed in preclinical and clinical studies [25]. Different approaches, including inhibiting Raf kinase activity by small molecule inhibitors, decreasing Raf protein levels using ASODNs, and targeting Raf protein–protein interactions (especially Raf-Ras interactions), were developed [12].

Viruses utilize the host cell machinery to replicate, and some cellular pathways and enzymes are essential for viral replication and survival of other pathogens [8,9,26 –28]. Although Raf-1 kinase in JEV infections has not been well defined to date, conclusions can be made based on Raf family characteristics. Moreover, as described in this report, Raf-1 expression levels were upregulated in JEV-infected BHK-21 cells or Vero cells. Therefore, we speculated that Raf-1 might play roles in JEV replication, and ASODNs targeting Raf-1 would inhibit JEV replication.

ASODNs are short, single-strand DNA sequences (13–25 nucleotides) that hybridize to specific mRNA sequences inducing target RNA degradation by RNase-H or by forming stable DNA-RNA duplexes that hinder RNase-H cleavage activity resulting in the inhibition of protein translation [29 –31]. The use of ASODNs as antiviral agents has emerged as a powerful new approach for treating JEV infections [32,33], and many ASODN drugs are now being widely developed. For example, the first antisense drug Vitravene (ISIS Pharmaceuticals, Carlsbad, CA) has been already approved by the Food and Drug Administration and is currently used for the treatment of cytomegalovirus infections [34 –36]. In addition, a large number of antisense compounds have been studied both in vitro and in vivo [37].

In this study, Raf-1 protein levels were reduced in BHK-21 cells and Vero cells following treatment with Raf-1-1. Since it has been demonstrated that phosphorothioate ASODNs possess nonspecific effects associated with the nonspecific cleavage of unintended targets [38], Raf-1-1 specificity was confirmed using western blot analysis. Furthermore, the mismatched oligonucleotide (Raf-1-MIS) did not affect Raf-1 expression or JEV propagation, suggesting that reduction of JEV RNA levels was not the result of nonspecific Raf-1-1 effects on cell physiology. Moreover, it was shown that JEV-induced CPE and JEV RNA levels detected in cell culture medium were significantly inhibited by Raf-1-1 in a dose-dependent manner without affecting cell proliferation or inducing apoptosis even at high doses (16 μM).

Importantly, Raf-1-1 effectively protects mice against lethal encephalitis induced by JEV. Raf-1-1-treated mice presented with reduced clinical signs of disease and mortality rates following JEV infection in a dose-dependent manner. Furthermore, plaque assays from brain homogenates made from animals from all groups demonstrated that the number of infective viral particles produced was dramatically reduced following Raf-1-1 treatment.

It remains unclear why Raf-1 inhibition by ASODN Raf-1-1 results in reduced JEV replication. Raung et al. demonstrated that the Ras/Raf/ERK cascade was associated with JEV-infected microglia and that inhibition of this pathway resulted in the diminished production of JEV-induced proinflammatory cytokines and neurotoxicity [19]. Chen et al. further found that Src may be a crucial switching molecule for JEV to turn on ERK-related signaling in microglia, and the linking bridge between Src and ERK consists of Ras/Raf and Raf. [20]. Although the mechanisms remain to be determined, Src family PTK inhibitors were hypothesized to play a role in the budding and release of viral particles [39,40]. These suggested that one mechanism may involve the downregulation of Raf-1 expression resulting in the inhibition of JEV viral particle release ultimately blocking JEV replication. In addition, there may be additional mechanisms associated with Raf-1 inhibition resulting in reduced viral replication.

In conclusion, data presented in this report demonstrated that ASODN Raf-1-1 targeting Raf-1 suppressed JEV replication in vitro and in vivo. These data provided evidence for targeting Raf-1 in the development of novel JEV therapies. In addition, ASODN Raf-1-1 represents potential drugs that can be adapted for treating JEV infections.

Footnotes

Acknowledgment

This work was supported by two grants from the National Natural Science Foundation of China (nos. 31270197 and 81473184).

Author Disclosure Statement

No competing financial interests exist.

References

Ghosh

and Basu

. (2009). Japanese encephalitis—a pathological and clinical perspective. PLoS Negl Trop Dis, 3:e437.

Solomon

and Vaughn

. (2002). Pathogenesis and clinical features of Japanese encephalitis and West Nile virus infections. Curr Top Microbiol Immunol, 267:171–194.

Gurav

, Bondre

, Tandale

, Damle

, Mallick

, Ghosh

and Nag

. (2016). A large outbreak of Japanese encephalitis predominantly among adults in northern region of West Bengal, India. J Med Virol, 88:2004–2011.

Eick-Cost

, Hu

, Klein

, Putnak

and Jarman

. (2015). Seroconversion to Japanese encephalitis virus among U.S. Infantry Forces in Korea. Am J Trop Med Hyg, 93:1052–1054.

Saxena

and Dhole

. (2008). Preventive strategies for frequent outbreaks of Japanese encephalitis in Northern India. J Biosci, 33:505–514.

Gould

, Solomon

and Mackenzie

. (2008). Does antiviral therapy have a role in the control of Japanese encephalitis. Antiviral Res, 78:140–149.

Misra

and Kalita

. (2010). Overview: Japanese encephalitis. Prog Neurobiol, 91:108–120.

Schwegmann

and Brombacher

. (2008). Host-directed drug targeting of factors hijacked by pathogens. Sci Signal, 1:re8.

Kellam

(2006). Attacking pathogens through their hosts. Genome Biol, 7:201–208.

10.

Linero

, Sepulveda

, Giovannoni

, Castilla

, Garcia

, Scolaro

and Damonte

. (2012). Host cell factors as antiviral targets in arenavirus infection. Viruses, 4:1569–1591.

11.

, Londrigan

, Nasr

, Cunningham

, Turville

, Brooks

and Reading

. (2016). The C-type lectin langerin functions as a receptor for attachment and infectious entry of influenza A virus. J Virol, 90:206–221.

12.

Matallanas

, Birtwistle

, Romano

, Zebisch

, Rauch

, von Kriegsheim

and Kolch

. (2011). Raf family kinases: old dogs have learned new tricks. Genes Cancer, 2:232–260.

13.

Booth

, Coggeshall

, Gordon

and Metcalf

. (2004). Adenovirus type 7 induces interleukin-8 in a lung slice model and requires activation of Erk. J Virol, 78:4156–4164.

14.

Chen

, Ou

, Chang

, Pan

, Liao

, Raung

and Chen

. (2011). TNF-alpha and IL-1beta mediate Japanese encephalitis virus-induced RANTES gene expression in astrocytes. Neurochem Int, 58:234–242.

15.

Aoki

, Hayashi

, Moriyama

, Arakawa

and Hino

. (2000). Hepatitis C virus core protein interacts with 14–3-3 protein and activates the kinase Raf-1. J Virol, 74:1736–1741.

16.

Pleschka

, Wolff

, Ehrhardt

, Hobom

, Planz

, Rapp

and Ludwig

. (2001). Influenza virus propagation is impaired by inhibition of the Raf/MEK/ERK signalling cascade. Nat Cell Biol, 3:301–305.

17.

Ludwig

, Wolff

, Ehrhardt

, Wurzer

, Reinhardt

, Planz

and Pleschka

. (2004). MEK inhibition impairs influenza B virus propagation without emergence of resistant variants. FEBS Lett, 561:37–43.

18.

Tian

, Hu

, Wang

, Chen

, Zhang

, Wang

, Ren

, Huang

and Tang

. (2011). Hepatitis B virus regulates Raf1 expression in HepG2.2.15 cells by enhancing its promoter activity. Arch Virol, 156:869–874.

19.

Raung

, Chen

, Liao

, Chen

and Chen

. (2007). Japanese encephalitis virus infection stimulates Src tyrosine kinase in neuronglia. Neurosci Lett, 419:263–268.

20.

Chen

, Ou

, Chang

, Pan

, Lin

, Liao

, Raung

, Chen

and Chang

. (2011). Src signaling involvement in Japanese encephalitis virus-induced cytokine production in microglia. Neurochem Int, 58:924–933.

21.

Uhlmann

, Peyman

, Ryte

, Schmidt

and Buddecke

. (2000). Use of minimally modified antisense oligonucleotides for specific inhibition of gene expression. Methods Enzymol, 313:268–284.

22.

Shibasaki

, Karasaki

, Graslund

, Nygren

, Sano

and Iwasaki

. (2014). Inhibitory effects of H-Ras/Raf-1-binding affibody molecules on synovial cell function. AMB Express, 4:82.

23.

Chen

, Xia

, Zuo

, Wang

, Zhang

, Kuang

, Duan

, Zhao

and Wang

. (2015). Crosstalk between SDF-1/CXCR4 and SDF-1/CXCR7 in cardiac stem cell migration. Sci Rep, 5:16813.

24.

Pinyol

, Nault

, Quetglas

, Zucman-Rossi

and Llovet

. (2014). Molecular profiling of liver tumors: classification and clinical translation for decision making. Semin Liver Dis, 34:363–375.

25.

, Yang

, Ward

, Liu

, Guo

and Xu

. (2015). A-Raf: a new star of the family of raf kinases. Crit Rev Biochem Mol Biol, 50:520–531.

26.

Ding

, Yang

and Wang

. (2011). Antisense oligonucleotides targeting abhydrolase domain containing 2 block human hepatitis B virus propagation. Oligonucleotides, 21:77–84.

27.

Wimmer

and Schreiner

. (2015). Viral mimicry to usurp ubiquitin and SUMO host pathways. Viruses, 7:4854–4872.

28.

Berard

, Severini

and Coombs

. (2015). Differential reovirus-specific and herpesvirus-specific activator protein 1 activation of secretogranin II leads to altered virus secretion. J Virol, 89:11954–11964.

29.

Dias

and Stein

. (2002). Antisense oligonucleotides: basic concepts and mechanisms. Mol Cancer Ther, 1:347–355.

30.

Scherer

and Rossi

. (2003). Approaches for the sequence-specific knockdown of mRNA. Nat Biotechnol, 21:1457–1465.

31.

Coma

, Noe

, Lavarino

, Adán

, Rivas

, López-Matas

, Pagan

, Mitjans

, Vilaró

, Piulats

and Ciudad

. (2004). Use of siRNAs and antisense oligonucleotides against survivin RNA to inhibit steps leading to tumor angiogenesis. Oligonucleotides, 14:100–113.

32.

Nazmi

, Dutta

and Basu

. (2010). Antiviral and neuroprotective role of octaguanidinium dendrimer-conjugated morpholino oligomers in Japanese encephalitis. PLoS Negl Trop Dis, 4:e892.

33.

Anantpadma

, Stein

and Vrati

. (2010). Inhibition of Japanese encephalitis virus replication in cultured cells and mice by a peptide-conjugated morpholino oligomer. J Antimicrob Chemother, 65:953–961.

34.

Marwick

(1998). First “antisense” drug will treat CMV retinitis. JAMA, 280:871.

35.

Stix

(1998). Shutting down a gene. Antisense drug wins approval. Sci Am, 279:46–50.

36.

Wacheck

(2006). Oligonucleotide therapeutics – an emerging novel class of compounds [in German]. Wien Med Wochenschr, 156:481–487.

37.

Pirollo

, Rait

, Sleer

and Chang

. (2003). Antisense therapeutics: from theory to clinical practice. Pharmacol Ther, 99:55–77.

38.

Woolf

, Melton

and Jennings

. (1992). Specificity of antisense oligonucleotides in vivo. Proc Natl Acad Sci U S A, 89:7305–7309.

39.

Hirsch

, Medigeshi

, Meyers

, DeFilippis

, Früh

, Briese

, Lipkin

and Nelson

. (2005). The Src family kinase c-Yes is required for maturation of West Nile virus particles. J Virol, 79:11943–11951.

40.

Raung

, Chen

, Liao

, Chen

and Chen

. (2005). Tyrosine kinase inhibitors attenuate Japanese encephalitis virus-induced neurotoxicity. Biochem Biophys Res Commun, 327:399–406.