Cholesterol–GalNAc Dual Conjugation Strategy for Reducing Renal Distribution of Antisense Oligonucleotides

Abstract

Recently, some studies have reported nephrotoxicity associated with a certain class of antisense oligonucleotides (ASOs) in humans. One possibility for reducing the potential nephrotoxicity of ASOs is to alter their pharmacokinetics. In this study, we investigated the effect of a ligand conjugation strategy on the renal accumulation of ASOs. We selected two ligands, cholesterol and N-acetylgalactosamine (GalNAc), with the purpose of reducing renal distribution and liver targeting, and then designed a series of cholesterol–GalNAc dual conjugated ASOs. The gene-silencing activity of the cholesterol-GalNAc dual conjugated ASO in the liver was slightly lower than that of a GalNAc-conjugated ASO. On the other hand, the renal distribution of the cholesterol–GalNAc dual conjugated ASO was considerably decreased compared with the GalNAc-conjugated ASO, as we expected. As dual conjugation was successful in reducing the renal distribution of ASO, it should be an effective strategy for reducing the nephrotoxic potential of ASOs.

Introduction

Antisense oligonucleotides (ASOs) are 8–20 mer oligonucleotides designed to knockdown disease-associated messenger RNAs (mRNAs) or noncoding RNAs (ncRNAs) [1 –3]. ASOs have been a useful laboratory tool for research in molecular biology and there are expectations that they will be used as next-generation therapeutic agents. In fact, several ASOs have recently received marketing approval [4 –7].

However, as clinical experience with ASOs has increased, some safety concerns have been raised [8,9]. Although uncommon, one of the adverse events reported is nephrotoxicity that appears to be related to ASO chemistry and renal drug burden [9]. A noteworthy precedent is that serious acute kidney injury was found in healthy subjects during the clinical development of SPC5001, a locked nucleic acid (LNA)-modified ASO for the treatment of dyslipidemia, and the trial was eventually terminated in spite of the agent's significant therapeutic activity [10,11]. More recently, marked elevation of serum creatinine and the urinary kidney injury molecule 1 (Kim-1) was observed in subjects receiving a multiple-dose protocol of 2′-methoxyethyl (MOE)-modified ASO targeting sodium–glucose cotransporter-2 (SGLT2) in the first-in-human study [12,13], which had not been predicted from preclinical animal studies [14].

Our group has been independently developing ASOs targeting liver-associated diseases [15]. During preclinical development, we also observed nephrotoxicity, which will be reported elsewhere. Therefore, nephrotoxicity can be considered to be a potential adverse event of a certain class of ASO agents that needs to be eliminated. In this context, reducing the renal distribution of ASOs would be a preferred strategy because nephrotoxicity is a dose-related event [11 –13]. To reduce the possibility of nephrotoxic effects of ASOs, we investigated ligands that would be capable of conjugation with ASOs and reduce their renal distribution, while maintaining the gene-silencing activity in the liver, the target organ.

Amazing advances have been made in techniques for the delivery of ASOs to the liver over the last few decades. Hepatic accumulation of ASOs has been successfully increased through phosphorothioate (PS) internucleotide modification [16,17]. PS-ASOs are thought to interact more strongly with serum proteins such as albumin [18], and they have been found to be taken up by hepatocytes mainly through Stabilin receptors [19]. In addition, cholesterol conjugation strategies have come to be widely utilized for delivering oligonucleotides to the liver [2,20,21]. It has been found that cholesterol conjugation helps oligonucleotides to interact with serum proteins and lipoproteins to trespass into hepatocytes through receptor-mediated or nonmediated pathways [20,22 –24]. Furthermore, in addition to the liver–acid characteristics of cholesterol, its ability to prolong the blood half-life of cholesterol-conjugated ASOs should be beneficial in reducing the total amount of ASO presented to and accumulated in the kidneys [22]. We have recently investigated the effect of cholesterol conjugation on the in vivo gene-silencing activity of ASOs, and found the linker structure between ASO and cholesterol to be important [25]. Nakajima et al. took this a step further and investigated the optimum location for binding cholesterol to ASOs [26]. In this regard, it is important to note that Watanabe et al. showed that cholesterol-conjugated ASOs preferentially accumulated in nonparenchymal cells (NPCs) over hepatocytes in the liver [27].

On the other hand, N-acetylgalactosamine (GalNAc) has been gaining more attention as a liver-targeting ligand [27 –30]. GalNAc conjugation permits hepatocyte-specific delivery of ASOs because multivalent GalNAc is a specific ligand for the asialoglycoprotein receptor (ASGPR) expressed in hepatocytes [31,32]. We and other groups have demonstrated that GalNAc improves efficacy 5–10 times as compared with the parent ASO [30,33]. Taken together, the above observations, suggest that cholesterol–GalNAc dual conjugation would enable us to reduce ASO amounts in the kidney by altering the pharmacokinetics and pharmacodynamics of ASOs.

In this study, we designed a series of cholesterol and GalNAc doubly modified hybrid ASOs against the mRNA of apoliporotein B (apoB), a prospective therapeutic target for homozygous familial hypercholesterolemia [34], and investigated their in vivo gene-silencing activity as well their effects on renal distribution.

Materials and Methods

Oligonucleotides

Monovalent GalNAc phosphoramidite was synthesized according to the procedure in our previous study [33]. The ASOs used in the present study were synthesized by Gene Design, Inc. (Osaka, Japan). (Supplementary Fig. S4–S6 Supplementary Data are available online at www.liebertpub.com/nat); The sequences of the ASOs targeting apoB were as previously reported [35] and their designs are shown in Fig. 1.

FIG. 1.

Sequences and designs of ASOs used in this study. (A) Sequences and molecular weights, T_m values, and schematic illustrations of ASOs used in this study. Upper case and lower case letters indicate LNAs and DNA. * indicates phosphodiester linkage. ^ indicates phosphorothioate linkage. X indicates mono-GalNAc. Chol indicates TEG-cholesterol. (B) Structure of GalNA–cholesterol dual conjugation to ASO (5Chol-5GN). ASO, antisense oligonucleotide; LNA, locked nucleic acid; TEG, triethylene glycol.

T_m measurement

T_m measurements were carried out on a SHIMADZU UV-1800 spectrometer with quartz cuvettes. Equimolecular amounts of each ASO and target 30-mer RNA (partial sequence of murine apoB mRNA, GenBank number NM_009693.2: 5′-gucaucacacugaauaccaaugcuggacuu-3′) were dissolved in 10 mM sodium phosphate buffer (pH = 7.2) containing 100 mM NaCl to give a final strand concentration of 2 μM. For annealing, the mixed samples were heated to 95°C, followed by slow cooling to room temperature. Melting profiles were recorded at 260 nm from 5°C to 95°C at a scan rate of 0.5°C/min. T_m values were determined from maxima of the first derivative of the melting curves.

Animal study

All animal studies were conducted with the approval of the Animal Care Ethics Committee of the National Cerebral and Cardiovascular Center Research Institute (Osaka, Japan) based on the 3Rs (Replacement/Reduction/Refinement) principle. Male C57BL/6J mice were purchased from SLC Japan (Tokyo, Japan). All studies were started when mice were 7 weeks old. Mice were maintained on a 12-h light/12-h dark cycle and fed a normal chow (CE-2; CLEA Japan, Tokyo, Japan). Each ASO was injected into mice (n = 4) intravenously at a dose of 8.75–35 nmol/kg and the injection volume was adjusted to 200 μL with saline (Otsuka Pharmaceuticals, Tokyo, Japan). Three days after ASO injections, mice were sacrificed. They were anesthetized with isoflurane (Mylan, Inc., Canonsburg, PA) before sacrifice, and whole blood samples, livers, and kidneys were collected. The livers and kidneys were flash frozen in liquid nitrogen or immersed in RNAlater (Thermo Fisher Scientific, Inc., Waltham, MA) and stored at −80°C until analysis. Serum was obtained using BD Microtainer yellow (BD, Franklin Lakes, NJ).

Quantitative polymerase chain reaction analysis

Total RNA was extracted from each tissue stored in RNAlater using the QuickGene RNA Tissue Kit SII (Fujifilm, Tokyo, Japan) with a QuichGene 810 instrument (Fujifilm). cDNA was synthesized using 2 μg of the extracted total RNA with a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Inc.). The quantitative reverse transcription–polymerase chain reaction (PCR) was performed using Fast SYBR Green Master Mix (Thermo Fisher Scientific, Inc.) with a StepOnePlus system (Applied Biosystems, Foster City, CA). Primer sequences are shown below.

Mouse Gapdh (forward: 5′-TGTGTCCGTCGTGGATCTGA-3′; reverse: 5′- TTGCTGTTGAAGTCGCAGGAG -3′).

Mouse ApoB (forward: 5′-TCCTCGGTGAGTTCAATGACTTTC-3′; reverse: 5′- TGGACCTGCTGTAGCTTGTAGGA-3′).

Serum chemistry

All parameters of serum chemistry were measured using FUJI DRI-CHEM SLIDE TCHO-PIII (Fujifilm) with a FUJI DRI-CHEM instrument (Fujifilm).

ASO quantification

The ASOs accumulated in each tissue were quantified by enzyme-linked oligonucleotide sorbent assay (ELOSA) as described previously [36]. In brief, liver or kidney homogenates containing 300 μg (liver) or 250 μg (kidney) of total protein were added to the ligation buffer (66 mM Tris–HCl, 6.6 mM MgCl2, 10 mM DTT, and 0.1 mM ATP, pH 7.6) containing a 5′-biotinylated LNA probe (5′-Biotin-TGAATA-3′) and a 3′-digoxigenin (DIG)-conjugated 5′-phosphorylated LNA probe (5′-pCCAATGC-N(6)-DIG-3′) complementary to an Apob-targeted ASO, and T4 DNA ligase (1.5 U/well; TaKaRa, Shiga, Japan). In probe sequences, upper case letters indicate LNAs (C = 5-methy-cytidine LNA) and N(C6) indicates an aminohexamethylene linker. The reaction mixture was applied to a nunc immobilizer streptavidin 96-well black plate (Thermo Fisher Scientific, Inc.) and incubated for 2 h at 15°C. After incubation, the reaction wells were washed four times with TBS-T. Anti-DIG antibody–alkaline phosphatase conjugate (Roche, Indianapolis, IN) was diluted to 1:2,000 in TBS-T containing 10% SuperBlock (TBS) Blocking Buffer (Thermo Fisher Scientific, Inc.). Then, 100 μL of the antibody solution was added to each well and incubated for 90 min at 37°C. After incubation, the reaction wells were washed four times with TBS-T. The antibody-bound ASO was detected using AttoPhos^® Fluorescent AP Substrate System (Promega, Madison, WI) with CORONA GRATING MICROPLATE READER SH-9000Lab (CORONA ELECTRIC Co., Ibaraki, Japan).

Statistics

For T_m measurement, data were collected in triplicate for each ASO. In all animal studies, there were more than four mice per treated arm. Quantification of ApoB mRNA and measurement of serum chemistry were performed for the individual experiments (n = 4–5 mice). Quantification of ASO in the liver or kidney by ELOSA was performed as triplicate technical replicates for individual experiments (n = 4–5 mice). All data are indicated as mean + standard deviation. Statistical significance (P < 0.05) was determined by Tukey's multiple comparison tests or Student's t-test.

Results and Discussion

Designs of cholesterol–GalNAc dual conjugated ASOs

We utilized the previously reported monomeric GalNAc unit (mono-GalNAc) [33,37] to achieve dual conjugation. With the use of mono-GalNAc, it is possible to place the cholesterol molecule right next to the GalNAc ligand and conjugate as many GalNAc ligands as required, no matter where it is intended to place them. This is unlikely to be achieved with the conventional trivalent GalNAc [29,30]. Using mono-GalNAc, we designed and synthesized ASOs targeting apolipoprotein B (apoB) (Fig. 1).

As liberation of both cholesterol and GalNAc from the parent ASO within the target tissue or cells is considered the key to achieving high activity [25,26,33], we used a biolabile phosphodiester linkage for the cholesterol–GalNAc, GalNAc–ASO, and cholesterol–ASO linkages. As it had been found that direct conjugation of the conventional GalNAc to the 3′-end of the ASO slowed the metabolic release of ASO from the conjugate as compared with the 5′-end [38], we thought that it might be much the same for cholesterol conjugation [26]. Therefore, in the 5GN-3Chol that we designed, the cholesterol was conjugated at the 3′-end of the ASO through a four-nucleotide spacer to make it easier to be cleaved within cells. As no difference was found between the gene-silencing effect of an unconjugated 13-mer and that of an unconjugated 17-mer, (Supplementary Table S1) we considered that a four-nucleotide spacer would have little influence on gene-silencing activity (Supplementary Fig. S1).

In vivo gene-silencing activity and accumulation of cholesterol–GalNAc dual conjugated ASOs in liver

To optimize the position of the cholesterol in the parent GalNAc-conjugated ASO, 5GN, we evaluated the activity of a series of compounds in vivo. The unconjugated ASO, 5GN, 5Chol-5GN, and 5GN-3Chol were injected into mice through the tail vein at doses of 8.75 or 35 nmol/kg (8.75 nmol/kg: approximately unconjugated ASO 38 μg/kg, 5GN 51 μg/kg, 5Chol-5GN 57 μg/kg, 5GN-3Chol 68 μg/kg; 35 nmol/kg: approximately unconjugated ASO 0.15 mg/kg, 5GN 0.20 mg/kg). Both the gene-silencing effect and total cholesterol-lowering effect of 5Chol-5GN and 5GN-3Chol were found to be comparable or only slightly less than those of 5GN (Fig. 2A, B). On the other hand, the potency of 5Chol-5GN and 5GN-3Chol was two to three times higher than that of ASO with cholesterol conjugation only (Supplementary Fig. S2). Furthermore, despite the similar hepatic accumulation between cholesterol–GalNAc dual conjugates (8.75 nmol/kg) and unconjugated ASO (35 nmol/kg) (Fig. 2C), the gene-silencing efficacy of dual conjugates was much higher than that of unconjugated ASO. These results indicate that in the context of dual conjugation, cholesterol modification did not add any positive effect to the net activity in the liver, but also that it does not significantly interfere with the liver-targeting ability of GalNAc.

FIG. 2.

Effects of ASOs on liver and serum total cholesterol levels. (A) ApoB mRNA expression levels in liver. Three days after intravenous injection at a dose of 8.75 or 35 nmol/kg (8.75 nmol/kg: approximately unconjugated ASO 38 μg/kg, 5GN 51 μg/kg, 5Chol-5GN 57 μg/kg, 5GN-3Chol 68 μg/kg; 35 nmol/kg: unconjugated ASO 0.15 mg/kg, 5GN 0.20 mg/kg), apoB mRNA levels in the livers of mice were quantitated using real-time quantitative PCR and normalized to gapdh mRNA. Data are indicated as ratios relative to apoB mRNA levels in the livers of mice treated with saline. (B) Serum total cholesterol levels in mice treated with saline or ASOs. (C) Hepatic accumulation for each ASO. Data were calculated as ratios of the amount of ASO in the whole liver to the injected amount of ASO. Data are presented as mean values + SD. P values were determined by Tukey's multiple comparison tests. * indicates P < 0.05. PCR, polymerase chain reaction; SD, standard deviation.

This is supported by the finding that GalNAc-conjugated ASO accumulated and showed gene-silencing activity highly specifically in hepatic parenchymal cells as compared with unconjugated ASO and cholesterol-conjugated ASO [30]. Part of the reason for the difference in activity between the cholesterol conjugates and the cholesterol unconjugates is the preferential accumulation of cholesterol conjugates in NPCs over hepatocytes in the liver. Watanabe et al. demonstrated that accumulation of cholesterol-conjugated ASOs was much greater in NPCs than in hepatic parenchymal cells as compared with unconjugated ASOs or GalNAc-conjugated ASOs [27]. Possibly providing support for the above explanation is a recent study by Donner et al., who showed that ASOs are inherently less active in NPCs than in hepatocytes [39].

Surprisingly, the effects of binding cholesterol to the 3′- and the 5′-terminus were comparable, differing from the finding of previous studies [26]. This provided a clue for how to optimize activity by introducing biolabile linkers. In addition, we noted a tendency for hepatic accumulation of 5GN-3Chol to be greater than that of 5Chol-5GN. As hepatotoxicity has also been found to be an adverse event in both preclinical and clinical studies on ASO agents, reducing hepatic drug burden without sacrificing knockdown activity would be a desirable characteristic for them to have.

We utilized the ELOSA to quantify the amount of ASO in each tissue. In this assay, terminal modifications of ASOs could hamper the quantification result, because the ligands greatly affect the chemical properties of ASOs as well as enzymatic reactivity in ELOSA. However, it has been shown that ligands, such as GalNAc or cholesterol, connected to ASOs through phosphodiester linkers were immediately cleaved off, and the parent ASO was released within 48 h after dosing [27,40]. We determined the hepatic accumulation of 5GN in mice treated at 35 nmol/kg (∼0.2 mg/kg) after 72 h to be 113 nmol/whole liver (∼0.5 μg unconjugated ASO/whole liver) by ELOSA, when the parent ASO was utilized for calibration. The level measured in the liver is consistent with that determined by Watanabe et al. They showed that 0.2 mg/kg of a GalNAc-conjugated ASO, which had a different GalNAc structure, but identical parent ASO to the one used in this study, resulted in a hepatic concentration of the unconjugated parent ASO of 0.5 μg/kg after 72 h [27]. Therefore, while we assume that terminal modifications of ASOs may affect the accuracy of this assay to some extent, because ligand dissociation occurs rapidly and the parent ASO can eventually be detected by ELOSA in the liver, the measurements that we obtained and the tendencies observed with this method would be reliable enough to merit discussion in this study.

Renal accumulation of cholesterol–GalNAc dual conjugated ASOs

Next, to investigate renal accumulation, we quantitated levels of 5GN-3Chol, 5GN, and unconjugated ASO in the kidney. We injected 5GN-3Chol and 5GN into mice through the tail vein and quantitated hepatic apoB mRNA as well as the renal uptake and accumulation of each ASO. Both mRNA expression and accumulation were significantly greater for 5GN as compared with 5GN-3Chol (Fig. 3A, B). Surprisingly, when analyzing the whole kidney for a dose of 8.75 nmol/kg, renal accumulation of 5GN-3Chol was hardly detectable, whereas the tissue concentration of 5GN was determined to be ∼1.75 pmol/whole kidney (∼7.6 ng unconjugated ASO/whole kidney) under the same conditions (Fig. 3C). In further analysis, the renal accumulation (% dose) of 5GN-3Chol was estimated to be about one-fifth of that of 5GN, and about one-fiftieth of that of unconjugated ASO (Fig. 3D). Thus, although only GalNAc conjugation was effective in avoiding excess accumulation of ASOs in kidney, we demonstrated that in the context of the dual conjugation, cholesterol has an additive effect in reducing renal uptake and accumulation of ASO agents.

FIG. 3.

Comparison of efficacy and renal accumulation of 5GN-3Chol with those of 5GN or unconjugated ASO. (A) ApoB mRNA expression levels in liver. Three days after intravenous injection at a dose of 8.75, 17.5, or 35 nmol/kg (8.75 nmol/kg: approximately 5GN 51 μg/kg, 5GN-3Chol 68 μg/kg; 17.5 nmol/kg: approximately 5GN-3Chol 0.14 mg/kg; 35 nmol/kg: approximately 5GN-3Chol 0.27 mg/kg), apoB mRNA levels in the livers of mice were quantitated using real-time quantitative PCR and normalized to gapdh mRNA. Data are indicated as ratios relative to apoB mRNA in the livers of mice treated with saline. (B) Serum total cholesterol levels in mice treated with saline or ASOs. (C) Renal accumulation of 5GN or 5GN-3Chol in the whole kidney was quantitated by ELOSA. (D) Unconjugated ASO and 5GN or 5GN-3Chol was intravenously injected at a dose of 35 nmol/kg, and the percentage of renal accumulation of the injected dose was calculated. (C, D) Kidneys were harvested 3 days after injection. Data are presented as mean values + SD. (C) P values were determined by Tukey's multiple comparison tests. * indicates P < 0.05. n.d. indicates “not detected.” (D) P values were determined by Student's t-tests. ** indicates P < 0.01. ELOSA, enzyme-linked oligonucleotide sorbent assay.

Wolfrum et al. demonstrated that cholesterol-conjugated siRNAs preincubated with lipoproteins were delivered to liver cells through lipoprotein receptors, such as low-density lipoprotein receptor (LDLR) or Scavenger receptor class B member 1 (SR-B1) [20]. Nishina et al. reported that α-tocopherol-conjugated ASO admixed with lipoproteins had lower efficacy in the livers of LDLR-knockout (LDLR^−/−) mice than those of wild-type mice [41]. In the present experiments, compared with wild-type mice, there was no difference in hepatic accumulation of cholesterol-conjugated ASO intravenously injected into LDLR^−/− mice or apolipoprotein E-knockout (apoE^−/−) mice without preincubation with lipoproteins (Supplementary Fig. S3). Thus, in our study, it is more likely that 5GN-3Chol interacted with high density lipoprotein than with low density lipoprotein. Otherwise, it could have been due to cholesterol aggregation in the blood [25]. On the other hand, the findings of Onishi et al. have indicated the possibility of binding between albumin and cholesterol conjugates [42]. Therefore, predominant albumin-mediated uptake may be another explanation for the reduction in renal uptake [43].

In this study, we showed that our cholesterol–GalNAc dual conjugation strategy was clearly successful in reducing the dosage and altering the biodistribution of the parent unmodified ASOs, as well as reducing renal accumulation with no significant effect on hepatic gene-silencing efficacy. We plan to further test this dual conjugation strategy in preclinical models to evaluate the effects on the kidney in more detail.

Footnotes

Acknowledgments

This work was supported by Project Promoting Clinical Trials for Development of New Drugs (AMED) and the Platform Project for Supporting Drug Discovery and Life Science Research of the Japan Agency for Medical Research and Development (AMED).

Author Disclosure Statement

No competing financial interests exist.

References

Yamamoto

, Nakatani

, Narukawa

and Obika

. (2011). Antisense drug discovery and development. Future Med Chem, 3:339–365.

Dowdy

. (2017). Overcoming cellular barriers for RNA therapeutics. Nat Biotechnol, 35:222–229.

Khvorova

and Watts

. (2017). The chemical evolution of oligonucleotide therapies of clinical utility. Nat Biotechnol, 35:238–248.

Lim

, Maruyama

and Yokota

. (2017). Eteplirsen in the treatment of Duchenne muscular dystrophy. Drug Des Devel Ther, 11:533–545.

Mendell

, Goemans

, Lowes

, Alfano

, Berry

, Shao

, Kaye

, Mercuri

, G Eteplirsen Study and DMDIN Telethon Foundation. (2016). Longitudinal effect of eteplirsen versus historical control on ambulation in Duchenne muscular dystrophy. Ann Neurol, 79:257–271.

Finkel

, Mercuri

, Darras

, Connolly

, Kuntz

, Kirschner

, Chiriboga

, Saito

, Servais

, et al. (2017). Nusinersen versus sham control in infantile-onset spinal muscular atrophy. N Engl J Med, 377:1723–1732.

Khorkova

and Wahlestedt

. (2017). Oligonucleotide therapies for disorders of the nervous system. Nat Biotechnol, 35:249–263.

Crooke

, Baker

, Kwoh

, Cheng

, Schulz

, Xia

, Salgado

, Bui

, Hart

, et al. (2016). Integrated safety assessment of 2′-O-methoxyethyl chimeric antisense oligonucleotides in nonhuman primates and healthy human volunteers. Mol Ther, 24:1771–1782.

Engelhardt

. (2016). Comparative renal toxicopathology of antisense oligonucleotides. Nucleic Acid Ther, 26:199–209.

10.

van Poelgeest

, Swart

, Betjes

, Moerland

, Weening

, Tessier

, Hodges

, Levin

and Burggraaf

. (2013). Acute kidney injury during therapy with an antisense oligonucleotide directed against PCSK9. Am J Kidney Dis, 62:796–800.

11.

van Poelgeest

, Hodges

, Moerland

, Tessier

, Levin

, Persson

, Lindholm

, Dumong Erichsen

, Orum

, et al. (2015). Antisense-mediated reduction of proprotein convertase subtilisin/kexin type 9 (PCSK9): a first-in-human randomized, placebo-controlled trial. Br J Clin Pharmacol, 80:1350–1361.

12.

van Meer

, Moerland

, van Dongen

, Goulouze

, de Kam

, Klaassen

, Cohen

and Burggraaf

. (2016). Renal effects of antisense-mediated inhibition of SGLT2. J Pharmacol Exp Ther, 359:280–289.

13.

van Meer

, van Dongen

, Moerland

, de Kam

, Cohen

and Burggraaf.

(2017). Novel SGLT2 inhibitor: first-in-man studies of antisense compound is associated with unexpected renal effects. Pharmacol Res Perspect, 5:e00292.

14.

Zanardi

, Han

, Jeong

, Rime

, Yu

, Chakravarty

and Henry

. (2012). Pharmacodynamics and subchronic toxicity in mice and monkeys of ISIS 388626, a second-generation antisense oligonucleotide that targets human sodium glucose cotransporter 2. J Pharmacol Exp Ther, 343:489–496.

15.

Yamamoto

, Harada-Shiba

, Nakatani

, Wada

, Yasuhara

, Narukawa

, Sasaki

, Shibata

, Torigoe

, et al. (2012). Cholesterol-lowering action of BNA-based antisense oligonucleotides targeting PCSK9 in atherogenic diet-induced hypercholesterolemic mice. Mol Ther Nucleic Acids, 1:e22.

16.

Agrawal

, Temsamani

and Tang

. (1991). Pharmacokinetics, biodistribution, and stability of oligodeoxynucleotide phosphorothioates in mice. Proc Natl Acad Sci U S A, 88:7595–7599.

17.

Sands

, Gorey-Feret

, Cocuzza

, Hobbs

, Chidester

and Trainor

. (1994). Biodistribution and metabolism of internally 3H-labeled oligonucleotides. I. Comparison of a phosphodiester and a phosphorothioate. Mol Pharmacol, 45:932–943.

18.

Geary

, Watanabe

, Truong

, Freier

, Lesnik

, Sioufi

, Sasmor

, Manoharan

and Levin

. (2001). Pharmacokinetic properties of 2′-O-(2-methoxyethyl)-modified oligonucleotide analogs in rats. J Pharmacol Exp Ther, 296:890–897.

19.

Miller

, Donner

, Blank

, Egger

, Kellar

, Ostergaard

, Seth

and Harris

. (2016). Stabilin-1 and Stabilin-2 are specific receptors for the cellular internalization of phosphorothioate-modified antisense oligonucleotides (ASOs) in the liver. Nucleic Acids Res, 44:2782–2794.

20.

Wolfrum

, Shi

, Jayaprakash

, Jayaraman

, Wang

, Pandey

, Rajeev

, Nakayama

, Charrise

, et al. (2007). Mechanisms and optimization of in vivo delivery of lipophilic siRNAs. Nat Biotechnol, 25:1149–1157.

21.

Grijalvo

, Avino

and Eritja

. (2014). Oligonucleotide delivery: a patent review (2010–2013). Expert Opin Ther Pat, 24:801–819.

22.

Bijsterbosch

, Rump

, De Vrueh

, Dorland

, van Veghel

, Tivel

, Biessen

, van Berkel

and Manoharan

. (2000). Modulation of plasma protein binding and in vivo liver cell uptake of phosphorothioate oligodeoxynucleotides by cholesterol conjugation. Nucleic Acids Res, 28:2717–2725.

23.

Bijsterbosch

, Manoharan

, Dorland

, Waarlo

, Biessen

and van Berkel TJ

. (2001). Delivery of cholesteryl-conjugated phosphorothioate oligodeoxynucleotides to Kupffer cells by lactosylated low-density lipoprotein. Biochem Pharmacol, 62:627–633.

24.

Bijsterbosch

, Manoharan

, Dorland

, Van Veghel

, Biessen

and Van Berkel

. (2002). bis-Cholesteryl-conjugated phosphorothioate oligodeoxynucleotides are highly selectively taken up by the liver. J Pharmacol Exp Ther, 302:619–626.

25.

Wada

, Yasuhara

, Wada

, Sawamura

, Waki

, Yamamoto

, Harada-Shiba

and Obika

. (2016). Evaluation of the effects of chemically different linkers on hepatic accumulations, cell tropism and gene silencing ability of cholesterol-conjugated antisense oligonucleotides. J Control Release, 226:57–65.

26.

Nakajima

, Kasuya

, Yokota

, Onishi

, Ikehara

, Kugimiya

and Watanabe

. (2017). Gene silencing activity and hepatic accumulation of antisense oligonucleotides bearing cholesterol-conjugated thiono triester at the gap region. Nucleic Acid Ther, 27:232–237.

27.

Watanabe

, Nakajima

, Kasuya

, Onishi

, Kitade

, Mayumi

, Ikehara

and Kugimiya

. (2016). Comparative characterization of hepatic distribution and mRNA reduction of antisense oligonucleotides conjugated with triantennary N-acetyl galactosamine and lipophilic ligands targeting apolipoprotein B. J Pharmacol Exp Ther, 357:320–330.

28.

Huang

. (2017). Preclinical and clinical advances of GalNAc-decorated nucleic acid therapeutics. Mol Ther Nucleic Acids, 6:116–132.

29.

Nair

, Willoughby

, Chan

, Charisse

, Alam

, Wang

, Hoekstra

, Kandasamy

, Kel'in

, et al. (2014). Multivalent N-acetylgalactosamine-conjugated siRNA localizes in hepatocytes and elicits robust RNAi-mediated gene silencing. J Am Chem Soc, 136:16958–16961.

30.

Prakash

, Graham

, Yu

, Carty

, Low

, Chappell

, Schmidt

, Zhao

, Aghajan

, et al. (2014). Targeted delivery of antisense oligonucleotides to hepatocytes using triantennary N-acetyl galactosamine improves potency 10-fold in mice. Nucleic Acids Res, 42:8796–8807.

31.

Baenziger

and Fiete

. (1980). Galactose and N-acetylgalactosamine-specific endocytosis of glycopeptides by isolated rat hepatocytes. Cell, 22:611–620.

32.

Rensen

, Sliedregt

, Ferns

, Kieviet

, van Rossenberg

, van Leeuwen

, van Berkel

and Biessen

. (2001). Determination of the upper size limit for uptake and processing of ligands by the asialoglycoprotein receptor on hepatocytes in vitro and in vivo. J Biol Chem, 276:37577–37584.

33.

Yamamoto

, Sawamura

, Wada

, Harada-Shiba

and Obika

. (2016). Serial incorporation of a monovalent GalNAc phosphoramidite unit into hepatocyte-targeting antisense oligonucleotides. Bioorg Med Chem, 24:26–32.

34.

Yamamoto

, Wada

and Harada-Shiba

. (2016). Development of antisense drugs for dyslipidemia. J Atheroscler Thromb, 23:1011–1025.

35.

Straarup

, Fisker

, Hedtjarn

, Lindholm

, Rosenbohm

, Aarup

, Hansen

, Orum

, Hansen

and Koch

. (2010). Short locked nucleic acid antisense oligonucleotides potently reduce apolipoprotein B mRNA and serum cholesterol in mice and non-human primates. Nucleic Acids Res, 38:7100–7111.

36.

Yamamoto

, Yahara

, Waki

, Yasuhara

, Wada

, Harada-Shiba

and Obika

. (2015). Amido-bridged nucleic acids with small hydrophobic residues enhance hepatic tropism of antisense oligonucleotides in vivo. Org Biomol Chem, 13:3757–3765.

37.

Rajeev

, Nair

, Jayaraman

, Charisse

, Taneja

, O'Shea

, Willoughby

, Yucius

, Nguyen

, et al. (2015). Hepatocyte-specific delivery of siRNAs conjugated to novel non-nucleosidic trivalent N-acetylgalactosamine elicits robust gene silencing in vivo. Chembiochem, 16:903–908.

38.

Ostergaard

, Yu

, Kinberger

, Wan

, Migawa

, Vasquez

, Schmidt

, Gaus

, Murray

, et al. (2015). Efficient synthesis and biological evaluation of 5′-GalNAc conjugated antisense oligonucleotides. Bioconjug Chem, 26:1451–1455.

39.

Donner

, Wancewicz

, Murray

, Greenlee

, Post

, Bell

, Lima

, Swayze

and Seth

. (2017). Co-administration of an excipient oligonucleotide helps delineate pathways of productive and nonproductive uptake of phosphorothioate antisense oligonucleotides in the liver. Nucleic Acid Ther, 27:209–220.

40.

, Graham

, Post

, Riney

, Zanardi

, Hall

, Burkey

, Shemesh

, Prakash

, et al. (2016). Disposition and pharmacology of a GalNAc3-conjugated ASO targeting human lipoprotein (a) in mice. Mol Ther Nucleic Acids, 5:e317.

41.

Nishina

, Piao

, Yoshida-Tanaka

, Sujino

, Nishina

, Yamamoto

, Nitta

, Yoshioka

, Kuwahara

, et al. (2015). DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nat Commun, 6:7969.

42.

Onishi

, Watanabe

, Nakajima

, Sekiguchi

, Kugimiya

, Kinouchi

, Nihashi

and Kamimori

. (2015). Surface plasmon resonance assay of binding properties of antisense oligonucleotides to serum albumins and lipoproteins. Anal Sci, 31:1255–1260.

43.

Larsen

, Kuhlmann

, Hvam

and Howard.

(2016). Albumin-based drug delivery: harnessing nature to cure disease. Mol Cell Ther, 4:3.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.35 MB

0.34 MB

0.47 MB

0.31 MB

0.91 MB

Cholesterol–GalNAc Dual Conjugation Strategy for Reducing Renal Distribution of Antisense Oligonucleotides

Abstract

Introduction

Materials and Methods

Oligonucleotides

Tm measurement

Animal study

Quantitative polymerase chain reaction analysis

Serum chemistry

ASO quantification

Statistics

Results and Discussion

Designs of cholesterol–GalNAc dual conjugated ASOs

In vivo gene-silencing activity and accumulation of cholesterol–GalNAc dual conjugated ASOs in liver

Renal accumulation of cholesterol–GalNAc dual conjugated ASOs

Footnotes

Acknowledgments

Author Disclosure Statement

References

Supplementary Material

T_m measurement